| Clone Name | rbasd24h22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC093559.1| Xenopus laevis cDNA clone MGC:115331 IMAGE:6948940, complete cds Length = 2739 Score = 42.1 bits (21), Expect = 0.48 Identities = 24/25 (96%) Strand = Plus / Minus Query: 103 tctcatggttcagttgctccacagg 127 ||||||||||||| ||||||||||| Sbjct: 730 tctcatggttcagctgctccacagg 706
>emb|AL008730.1|HS487J7 Human DNA sequence from clone RP3-487J7 on chromosome 6q21-22.1 Contains the C6orf5 gene for chromosome 6 open reading frame 5 (NFkB-activating protein ACT1, connection to IKK and SAPK/JNK, chromosome 6 open reading frame 6) (ACT1, CIKS, C6ORF6, DKFZP586G0522)(contains FLJ22949) and the 3' end of a novel gene, complete sequence Length = 116513 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 86 tgaattctaaatctcagtct 105 |||||||||||||||||||| Sbjct: 36835 tgaattctaaatctcagtct 36816
>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome Length = 1838554 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1342798 tgattctgatgaggacgattaac 1342820
>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome Length = 1899877 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1414927 tgattctgatgaggacgattaac 1414949
>gb|AE006597.1| Streptococcus pyogenes M1 GAS, section 126 of 167 of the complete genome Length = 14017 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 11951 tgattctgatgaggacgattaac 11973
>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome Length = 1937111 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1419911 tgattctgatgaggacgattaac 1419933
>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome Length = 1860355 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1361242 tgattctgatgaggacgattaac 1361264
>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome Length = 1928252 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1436370 tgattctgatgaggacgattaac 1436392
>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome Length = 1836467 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1337401 tgattctgatgaggacgattaac 1337423
>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome Length = 1897573 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1412455 tgattctgatgaggacgattaac 1412477
>emb|AL354864.16| Human DNA sequence from clone RP11-435D7 on chromosome 1 Contains the 5' end of the PSMB2 gene for proteasome (prosome, macropain) subunit, beta type, 2, a novel transcript (FLJ38984), a putative novel transcript, the CLSPN gene for claspin homolog (Xenopus laevis) and the 5' end of the EIF2C4 gene for eukaryotic translation initiation factor 2C, 4, complete sequence Length = 194296 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 108 tggttcagttgctccacag 126 ||||||||||||||||||| Sbjct: 26481 tggttcagttgctccacag 26499
>gb|AE010079.1| Streptococcus pyogenes strain MGAS8232, section 127 of 173 of the complete genome Length = 13328 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 11263 tgattctgatgaggacgattaac 11285
>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome Length = 1900521 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 1451328 tgattctgatgaggacgattaac 1451350
>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome Length = 1894275 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 44 tgattctgatggggacgattaac 66 ||||||||||| ||||||||||| Sbjct: 445557 tgattctgatgaggacgattaac 445535
>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17, complete sequence Length = 180659 Score = 38.2 bits (19), Expect = 7.5 Identities = 25/27 (92%) Strand = Plus / Minus Query: 94 aaatctcagtctcatggttcagttgct 120 ||||||||||||| || |||||||||| Sbjct: 48185 aaatctcagtctcttgcttcagttgct 48159 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 873,486 Number of Sequences: 3902068 Number of extensions: 873486 Number of successful extensions: 58000 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57927 Number of HSP's gapped (non-prelim): 73 length of query: 156 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 134 effective length of database: 17,147,199,772 effective search space: 2297724769448 effective search space used: 2297724769448 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)