ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd24g12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_479006.1| Oryza sativa (japonica cultivar-group), mRNA Length = 934 Score = 238 bits (120), Expect = 1e-59 Identities = 253/299 (84%) Strand = Plus / Minus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 588 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 529 Query: 206 acatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagctgggtcagga 265 |||||||||||| | | |||||| || ||| |||||||| ||||| ||| ||||| Sbjct: 528 acatgacagtcacaacaagatccttgccttcaccaaatccagtcttgatctgacccagga 469 Query: 266 tagcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggc 325 | ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| Sbjct: 468 gactgtcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggc 409 Query: 326 tcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggca 385 |||| ||||||||||||||||||||||||||||| ||||| || |||| |||||||| | Sbjct: 408 tcacgaatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtggaa 349 Query: 386 catngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||| ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 348 catcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 290
>ref|XM_506443.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E05.118 mRNA Length = 996 Score = 238 bits (120), Expect = 1e-59 Identities = 253/299 (84%) Strand = Plus / Minus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 591 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 532 Query: 206 acatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagctgggtcagga 265 |||||||||||| | | |||||| || ||| |||||||| ||||| ||| ||||| Sbjct: 531 acatgacagtcacaacaagatccttgccttcaccaaatccagtcttgatctgacccagga 472 Query: 266 tagcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggc 325 | ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| Sbjct: 471 gactgtcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggc 412 Query: 326 tcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggca 385 |||| ||||||||||||||||||||||||||||| ||||| || |||| |||||||| | Sbjct: 411 tcacgaatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtggaa 352 Query: 386 catngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||| ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 351 catcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 293
>dbj|AK062134.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-E11, full insert sequence Length = 934 Score = 238 bits (120), Expect = 1e-59 Identities = 253/299 (84%) Strand = Plus / Minus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 588 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 529 Query: 206 acatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagctgggtcagga 265 |||||||||||| | | |||||| || ||| |||||||| ||||| ||| ||||| Sbjct: 528 acatgacagtcacaacaagatccttgccttcaccaaatccagtcttgatctgacccagga 469 Query: 266 tagcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggc 325 | ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| Sbjct: 468 gactgtcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggc 409 Query: 326 tcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggca 385 |||| ||||||||||||||||||||||||||||| ||||| || |||| |||||||| | Sbjct: 408 tcacgaatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtggaa 349 Query: 386 catngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||| ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 348 catcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 290
>gb|AF094773.1|AF094773 Oryza sativa translation initiation factor 5A (eIF-5A) mRNA, complete cds Length = 822 Score = 238 bits (120), Expect = 1e-59 Identities = 253/299 (84%) Strand = Plus / Minus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 584 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 525 Query: 206 acatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagctgggtcagga 265 |||||||||||| | | |||||| || ||| |||||||| ||||| ||| ||||| Sbjct: 524 acatgacagtcacaacaagatccttgccttcaccaaatccagtcttgatctgacccagga 465 Query: 266 tagcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggc 325 | ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| Sbjct: 464 gactgtcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggc 405 Query: 326 tcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggca 385 |||| ||||||||||||||||||||||||||||| ||||| || |||| |||||||| | Sbjct: 404 tcacgaatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtggaa 345 Query: 386 catngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||| ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 344 catcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 286
>dbj|AK103429.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128M07, full insert sequence Length = 996 Score = 230 bits (116), Expect = 3e-57 Identities = 252/299 (84%) Strand = Plus / Minus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 591 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 532 Query: 206 acatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagctgggtcagga 265 |||||||||||| | | |||||| || ||| |||||||| || || ||| ||||| Sbjct: 531 acatgacagtcacaacaagatccttgccttcaccaaatccagtctcgatctgacccagga 472 Query: 266 tagcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggc 325 | ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| Sbjct: 471 gactgtcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggc 412 Query: 326 tcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggca 385 |||| ||||||||||||||||||||||||||||| ||||| || |||| |||||||| | Sbjct: 411 tcacgaatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtggaa 352 Query: 386 catngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||| ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 351 catcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 293
>gb|BT016590.1| Zea mays clone Contig423 mRNA sequence Length = 945 Score = 147 bits (74), Expect = 4e-32 Identities = 145/170 (85%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 537 tcatcagttgggagtctaagatcatccttagtgttgccatctgaagtaagaaggctcaca 478 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||| ||||||||||| ||||||||||||| |||||||| | || Sbjct: 477 aatccatcctctgatatatcaatcagctggtactcagtacggttcacatgtggaatatca 418 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| || ||| ||||||| || || |||||||| || |||||||| Sbjct: 417 cagttgtgtgacgaaggaacaatatcttcgagctttttcccgttgaatat 368 Score = 46.1 bits (23), Expect = 0.097 Identities = 58/70 (82%) Strand = Plus / Minus Query: 148 ggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccgac 207 ||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || ||| Sbjct: 660 ggaagttacttggggccaacatccttcagcgcgcagatctgctcctcccccatagcagac 601 Query: 208 atgacagtca 217 |||||||| Sbjct: 600 tggacagtca 591
>gb|BT018311.1| Zea mays clone EL01T0207A06.c mRNA sequence Length = 775 Score = 147 bits (74), Expect = 4e-32 Identities = 145/170 (85%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 411 tcatcagttgggagtctaagatcatccttagggttgccatctgaagtaagaaggctcaca 352 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||| || || ||||||||||||||||||||||||| ||||| || | | Sbjct: 351 aatccatcctcagaaatatcaatcagctgatactcagtacggttcacatgcggaatgtca 292 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| |||||| ||||||| || ||||||||||| ||||||||||| Sbjct: 291 cagttgtgtgatgaaggaacaatatcttcaagctttttcccattgaatat 242 Score = 48.1 bits (24), Expect = 0.025 Identities = 59/71 (83%) Strand = Plus / Minus Query: 147 aggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccga 206 |||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || || Sbjct: 535 aggaagttacttggggccaacatccttcagcgcgcagatctgctcctcccccatcgcaga 476 Query: 207 catgacagtca 217 | |||||||| Sbjct: 475 ctggacagtca 465
>gb|BT017712.1| Zea mays clone EL01N0446G03.c mRNA sequence Length = 800 Score = 147 bits (74), Expect = 4e-32 Identities = 145/170 (85%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 425 tcatcagttgggagtctaagatcatccttagtgttgccatctgaagtaagaaggctcaca 366 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||| ||||||||||| ||||||||||||| |||||||| | || Sbjct: 365 aatccatcctctgatatatcaatcagctggtactcagtacggttcacatgtggaatatca 306 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| || ||| ||||||| || || |||||||| || |||||||| Sbjct: 305 cagttgtgtgacgaaggaacaatatcttcgagctttttcccgttgaatat 256 Score = 46.1 bits (23), Expect = 0.097 Identities = 58/70 (82%) Strand = Plus / Minus Query: 148 ggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccgac 207 ||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || ||| Sbjct: 548 ggaagttacttggggccaacatccttcagcgcgcagatctgctcctcccccatagcagac 489 Query: 208 atgacagtca 217 |||||||| Sbjct: 488 tggacagtca 479
>emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation factor 5A Length = 807 Score = 147 bits (74), Expect = 4e-32 Identities = 145/170 (85%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 439 tcatcagttgggagtctaagatcatccttagtgttgccatctgaagtaagaaggctcaca 380 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||| || || ||||||||||||||||||||||||| ||||| || | | Sbjct: 379 aatccatcctcagaaatatcaatcagctgatactcagtacggttcacatgcggaatgtca 320 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| |||||| ||||||| || ||||||||||| ||||||||||| Sbjct: 319 cagttgtgtgatgaaggaacaatatcttcaagctttttcccattgaatat 270 Score = 48.1 bits (24), Expect = 0.025 Identities = 59/71 (83%) Strand = Plus / Minus Query: 147 aggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccga 206 |||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || || Sbjct: 563 aggaagttacttggggccaacatccttcaacgcgcagatctgctcctcccccatcgcaga 504 Query: 207 catgacagtca 217 | |||||||| Sbjct: 503 ctggacagtca 493
>gb|AY103556.1| Zea mays PCO150862 mRNA sequence Length = 966 Score = 147 bits (74), Expect = 4e-32 Identities = 145/170 (85%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 552 tcatcagttgggagtctaagatcatccttagtgttgccatctgaagtaagaaggctcaca 493 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||| || || ||||||||||||||||||||||||| ||||| || | | Sbjct: 492 aatccatcctcagaaatatcaatcagctgatactcagtacggttcacatgcggaatgtca 433 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| |||||| ||||||| || ||||||||||| ||||||||||| Sbjct: 432 cagttgtgtgatgaaggaacaatatcttcaagctttttcccattgaatat 383 Score = 48.1 bits (24), Expect = 0.025 Identities = 59/71 (83%) Strand = Plus / Minus Query: 147 aggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccga 206 |||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || || Sbjct: 676 aggaagttacttggggccaacatccttcagcgcgcagatctgctcctcccccatcgcaga 617 Query: 207 catgacagtca 217 | |||||||| Sbjct: 616 ctggacagtca 606
>gb|AF034943.1|AF034943 Zea mays translation initiation factor 5A (TIF5A) mRNA, complete cds Length = 831 Score = 139 bits (70), Expect = 9e-30 Identities = 144/170 (84%) Strand = Plus / Minus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcaca 330 ||||||||||||||| |||||||||||||| | | |||| |||||||||||||||| Sbjct: 430 tcatcagttgggagtctaagatcatccttagtgttgccatctgaagtaagaaggctcaca 371 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||| ||||||||||| ||||||||||||| ||||| || | || Sbjct: 370 aatccatcctctgatatatcaatcagctggtactcagtacggttcacatgcggaatatca 311 Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatat 440 |||||||| || ||| ||||||| || || |||||||| || |||||||| Sbjct: 310 cagttgtgtgacgaaggaacaatatcttcgagctttttcccgttgaatat 261 Score = 46.1 bits (23), Expect = 0.097 Identities = 58/70 (82%) Strand = Plus / Minus Query: 148 ggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccgac 207 ||||||||| ||||||| || ||||| | ||||||||||| | ||||||||| || ||| Sbjct: 553 ggaagttacttggggccaacatccttcagcgcgcagatctgctcctcccccatagcagac 494 Query: 208 atgacagtca 217 |||||||| Sbjct: 493 tggacagtca 484
>gb|DQ345329.1| Rosa chinensis eukaryotic translation initiation factor eIF5A mRNA, complete cds Length = 474 Score = 135 bits (68), Expect = 1e-28 Identities = 202/248 (81%) Strand = Plus / Minus Query: 196 cccatggccgacatgacagtcagcgccaaatccttcccctcagcaaatccatccttgagc 255 |||||||| ||||||||||||| | | | |||||| |||||||||||||||||||| ||| Sbjct: 437 cccatggcagacatgacagtcaccacaagatccttgccctcagcaaatccatccttaagc 378 Query: 256 tgggtcaggatagcatcatcagttgggagtttaagatcatccttanngctaccattctca 315 || || || | |||||||||||| || || | ||||||||||| | | ||||| ||| Sbjct: 377 tgagtgagcagagcatcatcagtgggaagcctcagatcatccttggtgtttccattttca 318 Query: 316 gtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtct 375 || | || |||||||| ||||| || || || ||||||||||| || |||||||||| Sbjct: 317 gtcaagagactcacaaagccatcttcagagatatcaatcagctggtagtcagtacggttc 258 Query: 376 acatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttaccattg 435 ||||| || |||| || |||||||||||| | ||||| ||||||||||| || |||||| Sbjct: 257 acatgaggaacatcacaattgtgggatgaagggacaatatcctcaagcttcttgccattg 198 Query: 436 aatatatc 443 || ||||| Sbjct: 197 aagatatc 190
>emb|AJ843977.1| Plantago major mRNA for eukaryotic translation initiation factor 5A-1 (eif5a1 gene) Length = 890 Score = 129 bits (65), Expect = 8e-27 Identities = 172/209 (82%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||| ||||| ||||| || ||||||| |||||| | |||||||||||||||||| Sbjct: 553 tcctttccctctgcaaacccctccttgatctgggttgctagagcatcatcagttgggagc 494 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 |||| ||||||||| ||| ||||| ||||| || | |||||||||||||||||| || Sbjct: 493 ctaaggtcatccttagtgcttccattgtcagttagcaagctcacaaatccatcctcagaa 434 Query: 346 atgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaa 405 ||||||||||||||||| ||| ||||| ||||| || |||| || |||||||| ||| Sbjct: 433 atgtcaatcagctgataatcaacacggttaacatgagggacatcacaattgtgggaagaa 374 Query: 406 ngaacaatgtcctcaagctttttaccatt 434 ||||||| ||||||||||| || ||||| Sbjct: 373 ggaacaatatcctcaagcttcttgccatt 345
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 115 bits (58), Expect = 1e-22 Identities = 185/227 (81%), Gaps = 5/227 (2%) Strand = Plus / Minus Query: 195 ccccatggccgacatgacagtcagcgccaaatccttcccctcagcaaatccatccttgag 254 ||||||||| ||||||||||||| | | |||||| || ||| |||||||| ||||| Sbjct: 7610186 ccccatggcggacatgacagtcacaacaacatccttgccttcaccaaatccagtcttgat 7610127 Query: 255 ctgggtcaggatagcatcatcagttgggagtttaagatcatccttanngctaccattctc 314 |||| ||||| | |||| |||||||||| ||||||||||||| | |||| |||| Sbjct: 7610126 ctggcccaggagattgtcataagttgggagtccaagatcatccttagtgttaccgctctc 7610067 Query: 315 agtaagaaggctcac---aaatccatcctctgatatgtcaatcagctgatactcagtacg 371 ||||||||||||||| ||||||||||||||||||||||||||||| || | ||||| Sbjct: 7610066 agtaagaaggctcacgaataatccatcctctgatatgtcaatcagctggtaatttgtacg 7610007 Query: 372 gtctacatgtggcacatngcagttgtgggatgaangaacaatgtcct 418 | | ||||||| |||| ||||||||||||||| ||||||| |||| Sbjct: 7610006 g--ttcatgtggaacatcacagttgtgggatgaaggaacaatatcct 7609962 Score = 109 bits (55), Expect = 8e-21 Identities = 125/148 (84%), Gaps = 5/148 (3%) Strand = Plus / Minus Query: 274 tcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcac---a 330 |||||||||||| ||||||||||||| | |||| ||||||||||||||||||| Sbjct: 7605354 tcagttgggagtccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaat 7605295 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||||||||||||||| || | |||||| | ||||||| |||| Sbjct: 7605294 aatccatcctctgatatgtcaatcagctggtaatttgtacgg--ttcatgtggaacatca 7605237 Query: 391 cagttgtgggatgaangaacaatgtcct 418 ||||||||||||||| ||||||| |||| Sbjct: 7605236 cagttgtgggatgaatgaacaatatcct 7605209 Score = 85.7 bits (43), Expect = 1e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 24265907 cagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 24265960 Score = 81.8 bits (41), Expect = 2e-12 Identities = 54/59 (91%) Strand = Plus / Plus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcac 329 ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||||||| Sbjct: 24265558 tcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggctcac 24265616 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtgg 383 ||||||||||||||||||||||||||||| ||||| || |||| |||||||| Sbjct: 24265710 aatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtgg 24265762 Score = 58.0 bits (29), Expect = 3e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 24264527 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 24264586 Query: 206 acatgacagtca 217 |||||||||||| Sbjct: 24264587 acatgacagtca 24264598 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatg 380 ||||||||||| || || |||||||||||||| || |||||||| || ||||| Sbjct: 703704 acaaatccatcttccgaaatgtcaatcagctggtaatcagtacgatcaacatg 703652 Score = 40.1 bits (20), Expect = 6.0 Identities = 40/47 (85%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaa 437 |||||||||||||| | ||||| || |||||||| || |||||||| Sbjct: 703552 cagttgtgggatgaggggacaatatcttcaagcttctttccattgaa 703506
>dbj|AP004303.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0407H12 Length = 167754 Score = 115 bits (58), Expect = 1e-22 Identities = 185/227 (81%), Gaps = 5/227 (2%) Strand = Plus / Minus Query: 195 ccccatggccgacatgacagtcagcgccaaatccttcccctcagcaaatccatccttgag 254 ||||||||| ||||||||||||| | | |||||| || ||| |||||||| ||||| Sbjct: 115596 ccccatggcggacatgacagtcacaacaacatccttgccttcaccaaatccagtcttgat 115537 Query: 255 ctgggtcaggatagcatcatcagttgggagtttaagatcatccttanngctaccattctc 314 |||| ||||| | |||| |||||||||| ||||||||||||| | |||| |||| Sbjct: 115536 ctggcccaggagattgtcataagttgggagtccaagatcatccttagtgttaccgctctc 115477 Query: 315 agtaagaaggctcac---aaatccatcctctgatatgtcaatcagctgatactcagtacg 371 ||||||||||||||| ||||||||||||||||||||||||||||| || | ||||| Sbjct: 115476 agtaagaaggctcacgaataatccatcctctgatatgtcaatcagctggtaatttgtacg 115417 Query: 372 gtctacatgtggcacatngcagttgtgggatgaangaacaatgtcct 418 | | ||||||| |||| ||||||||||||||| ||||||| |||| Sbjct: 115416 g--ttcatgtggaacatcacagttgtgggatgaaggaacaatatcct 115372 Score = 109 bits (55), Expect = 8e-21 Identities = 125/148 (84%), Gaps = 5/148 (3%) Strand = Plus / Minus Query: 274 tcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcac---a 330 |||||||||||| ||||||||||||| | |||| ||||||||||||||||||| Sbjct: 110764 tcagttgggagtccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaat 110705 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||||||||||||||| || | |||||| | ||||||| |||| Sbjct: 110704 aatccatcctctgatatgtcaatcagctggtaatttgtacgg--ttcatgtggaacatca 110647 Query: 391 cagttgtgggatgaangaacaatgtcct 418 ||||||||||||||| ||||||| |||| Sbjct: 110646 cagttgtgggatgaatgaacaatatcct 110619
>gb|AF296086.1|AF296086 Lycopersicon esculentum eukaryotic translation initiation factor 5A-4 mRNA, complete cds Length = 760 Score = 113 bits (57), Expect = 5e-22 Identities = 112/131 (85%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||||||||| |||||| ||||| || |||||||||||||||||||| ||| Sbjct: 380 ccattttcagtaagaagagacacaaaaccatcttcagatatgtcaatcagctgatagtca 321 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||||||||||| || |||||||||||| ||||||| || ||||||||| Sbjct: 320 gtacgattgacatgtggcacatcacaattgtgggatgaaggaacaatatcttcaagcttt 261 Query: 427 ttaccattgaa 437 || ||||||| Sbjct: 260 tttgcattgaa 250
>ref|NM_186716.1| Oryza sativa (japonica cultivar-group), mRNA Length = 771 Score = 109 bits (55), Expect = 8e-21 Identities = 125/148 (84%), Gaps = 5/148 (3%) Strand = Plus / Minus Query: 274 tcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcac---a 330 |||||||||||| ||||||||||||| | |||| ||||||||||||||||||| Sbjct: 680 tcagttgggagtccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaat 621 Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatng 390 ||||||||||||||||||||||||||||| || | |||||| | ||||||| |||| Sbjct: 620 aatccatcctctgatatgtcaatcagctggtaatttgtacgg--ttcatgtggaacatca 563 Query: 391 cagttgtgggatgaangaacaatgtcct 418 ||||||||||||||| ||||||| |||| Sbjct: 562 cagttgtgggatgaatgaacaatatcct 535
>emb|AJ238624.1|SVE238624 Senecio vernalis mRNA for translation initiation factor 5A precursor protein eIF-5A (eifsv1 gene) Length = 480 Score = 107 bits (54), Expect = 3e-20 Identities = 170/210 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||||||||| |||||| || | ||||||||||||||| || Sbjct: 408 atccttaccctctccaaatccatccttgatctgggtaagaagagcatcatcagttggcag 349 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || || |||||||| | ||||||| ||||| || | ||||||||||||||||| || Sbjct: 348 cttcaggtcatccttggtgttaccattttcagtcagcaaactcacaaatccatcctcaga 289 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||| ||||| || |||||||||| ||||| || |||| || |||||||| || Sbjct: 288 aatatcaattagctggtaatcagtacggttgacatgaggaacatcacaattgtgggaaga 229 Query: 405 angaacaatgtcctcaagctttttaccatt 434 ||||||| || |||||||| || ||||| Sbjct: 228 tggaacaatatcttcaagcttctttccatt 199
>gb|DQ234392.1| Thinopyrum intermedium translation initiation factor 5A mRNA, complete cds Length = 636 Score = 105 bits (53), Expect = 1e-19 Identities = 216/272 (79%) Strand = Plus / Minus Query: 163 ccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgcc 222 ||||| ||||| || ||||||||||||| || |||||||| ||||| |||| ||| | Sbjct: 528 ccgacttccttcacagcgcagatctgttcttcacccatggcggacatcacagacaggatc 469 Query: 223 aaatccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttggg 282 | ||||| || |||||||||||| |||||| ||||| || | |||||||||||| || Sbjct: 468 aggtccttgccatcagcaaatccagccttgatctgggcaagcagagcatcatcagtggga 409 Query: 283 agtttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctct 342 || || || ||||||||| ||| ||| ||||||| |||||||| ||| ||||||| || Sbjct: 408 agcttcaggtcatccttagtgctgccactctcagttagaaggctgacatatccatcatca 349 Query: 343 gatatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggat 402 | ||||||||||||||| | || |||| ||||| || |||| |||||||||||| Sbjct: 348 gtgatgtcaatcagctgaaaatccagacgggtaacatgggggacatcacagttgtgggat 289 Query: 403 gaangaacaatgtcctcaagctttttaccatt 434 ||| | || || ||||||||||| || ||||| Sbjct: 288 gaagggacgatatcctcaagcttctttccatt 257
>gb|AF516357.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform VIII (eIF-5A) mRNA, partial cds Length = 597 Score = 105 bits (53), Expect = 1e-19 Identities = 207/260 (79%) Strand = Plus / Minus Query: 184 atctgttnctcccccatggccgacatgacagtcagcgccaaatccttcccctcagcaaat 243 ||||| | ||| ||||||| ||||| ||||||| ||||||| |||||||| |||||| Sbjct: 446 atctgctcctctcccatggaagacatcacagtcacaaccaaatctttcccctcggcaaat 387 Query: 244 ccatccttgagctgggtcaggatagcatcatcagttgggagtttaagatcatccttanng 303 |||||||||| ||| ||||| | | ||||||||||| || | || |||||||| | Sbjct: 386 ccatccttgatctgagtcagcagattttcatcagttggaagccttaggtcatccttggtg 327 Query: 304 ctaccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatac 363 | ||||||||||| || || || |||||||||||||| || || |||||||||||||| Sbjct: 326 tttccattctcagtcagcagactgacaaatccatcctcagagatatcaatcagctgataa 267 Query: 364 tcagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagc 423 ||||||||| ||||| || |||| |||||||| || ||| | || || || |||||| Sbjct: 266 tcagtacgggtaacatggggaacatcacagttgtgagaagaagggacgatatcttcaagc 207 Query: 424 tttttaccattgaatatatc 443 || || |||||||| ||||| Sbjct: 206 ttcttgccattgaagatatc 187
>gb|AF266464.1|AF266464 Manihot esculenta translation initiation factor 5A mRNA, complete cds Length = 1288 Score = 105 bits (53), Expect = 1e-19 Identities = 111/131 (84%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| ||||| |||||||| ||||| || || || |||||||||||||| ||||||||| Sbjct: 390 tcagtcagaagactcacaaaaccatcttcagagatatcaatcagctgataatcagtacgg 331 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 | ||||| || |||| || |||||||||||| ||||||| || ||||| ||||| ||| Sbjct: 330 ttaacatgaggaacatcacaattgtgggatgaaggaacaatatcttcaagtttttttcca 271 Query: 433 ttgaatatatc 443 ||||||||||| Sbjct: 270 ttgaatatatc 260
>gb|AF323604.1|AF323604 Manihot esculenta initiation factor eIF5-A mRNA, complete cds Length = 925 Score = 105 bits (53), Expect = 1e-19 Identities = 111/131 (84%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| ||||| |||||||| ||||| || || || |||||||||||||| ||||||||| Sbjct: 370 tcagtcagaagactcacaaaaccatcttcagagatatcaatcagctgataatcagtacgg 311 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 | ||||| || |||| || |||||||||||| ||||||| || ||||| ||||| ||| Sbjct: 310 ttaacatgaggaacatcacaattgtgggatgaaggaacaatatcttcaagtttttttcca 251 Query: 433 ttgaatatatc 443 ||||||||||| Sbjct: 250 ttgaatatatc 240
>gb|DQ234391.1| Secale cereale translation initiation factor 5A mRNA, complete cds Length = 636 Score = 101 bits (51), Expect = 2e-18 Identities = 211/266 (79%) Strand = Plus / Minus Query: 169 tccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatcc 228 ||||| || ||||||||||||| || |||||||| ||||| |||| ||| || ||| Sbjct: 522 tccttcacagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtcc 463 Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 || || |||||||||||| ||||| |||| || | | |||||||||| || || || Sbjct: 462 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 403 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 || ||||||||| | | ||| ||||||| |||||||| ||| ||||||| || | |||| Sbjct: 402 aggtcatccttagtgttgccactctcagttagaaggctgacatatccatcatcagttatg 343 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 |||||||||||||| || ||||| ||||| || || | ||||||||||||||| || Sbjct: 342 tcaatcagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaagga 283 Query: 409 acaatgtcctcaagctttttaccatt 434 ||||| ||||||||||| || ||||| Sbjct: 282 acaatatcctcaagcttctttccatt 257
>gb|AY484392.1| Capsicum annuum eukaryotic initiation factor 5A2 (eIF5A2) mRNA, complete cds Length = 718 Score = 101 bits (51), Expect = 2e-18 Identities = 112/133 (84%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| ||||||||||| |||||| ||||| || || ||||||||||||||||| | Sbjct: 357 taccattttcagtaagaagagacacaaaaccatcttcagagatgtcaatcagctgatagt 298 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 | ||||||| ||||||||||||| || ||||| |||||| ||||||| || ||||||| Sbjct: 297 ctgtacggttgacatgtggcacatcacaattgtgagatgaaggaacaatatcttcaagct 238 Query: 425 ttttaccattgaa 437 | || |||||||| Sbjct: 237 tctttccattgaa 225
>gb|AY488173.1| Capsicum annuum M1C3b mRNA, partial sequence Length = 457 Score = 101 bits (51), Expect = 2e-18 Identities = 112/133 (84%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| ||||||||||| |||||| ||||| || || ||||||||||||||||| | Sbjct: 366 taccattttcagtaagaagagacacaaaaccatcttcagagatgtcaatcagctgatagt 307 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 | ||||||| ||||||||||||| || ||||| |||||| ||||||| || ||||||| Sbjct: 306 ctgtacggttgacatgtggcacatcacaattgtgagatgaaggaacaatatcttcaagct 247 Query: 425 ttttaccattgaa 437 | || |||||||| Sbjct: 246 tctttccattgaa 234
>gb|AY484391.1| Capsicum annuum mary storys protein mRNA, complete cds Length = 718 Score = 101 bits (51), Expect = 2e-18 Identities = 112/133 (84%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| ||||||||||| |||||| ||||| || || ||||||||||||||||| | Sbjct: 357 taccattttcagtaagaagagacacaaaaccatcttcagagatgtcaatcagctgatagt 298 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 | ||||||| ||||||||||||| || ||||| |||||| ||||||| || ||||||| Sbjct: 297 ctgtacggttgacatgtggcacatcacaattgtgagatgaaggaacaatatcttcaagct 238 Query: 425 ttttaccattgaa 437 | || |||||||| Sbjct: 237 tctttccattgaa 225
>gb|DQ407749.1| Gymnadenia conopsea eukaryotic translation initiation factor 5A mRNA, complete cds Length = 889 Score = 101 bits (51), Expect = 2e-18 Identities = 165/204 (80%) Strand = Plus / Minus Query: 168 gtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatc 227 ||||||||| |||||||||| | ||| ||||| |||||||| || | |||| ||||||| Sbjct: 593 gtccttgacgccgcagatctgctcctcacccatcgccgacatcaccgacagcaccaaatc 534 Query: 228 cttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttt 287 |||||| || ||||||| ||||| | |||| | || | |||||| || || ||||| | Sbjct: 533 cttcccttctccaaatccttcctttatctggctgagcagagcatcctcggtggggagcct 474 Query: 288 aagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatat 347 ||||||||||| | ||||||||||||| |||||||| | ||| ||||| |||||| Sbjct: 473 gagatcatccttggtgttaccattctcagtcagaaggctaagaaagccatctgatgatat 414 Query: 348 gtcaatcagctgatactcagtacg 371 |||||||||||||| |||||||| Sbjct: 413 atcaatcagctgatagtcagtacg 390
>gb|DQ167203.2| Triticum aestivum eukaryotic translation initiation factor 5A3 mRNA, complete cds Length = 768 Score = 101 bits (51), Expect = 2e-18 Identities = 211/266 (79%) Strand = Plus / Minus Query: 169 tccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatcc 228 ||||| || ||||||||||||| || |||||||| ||||| |||| ||| || ||| Sbjct: 563 tccttcacagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtcc 504 Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 || || |||||||||||| ||||| |||| || | | |||||||||| || || || Sbjct: 503 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 444 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 || ||||||||| | ||||| ||||||| |||||||| ||| ||||||| || | |||| Sbjct: 443 aggtcatccttagtgttaccactctcagtgagaaggctgacatatccatcatcagttatg 384 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 |||||||||||||| || ||||| ||||| || || | ||||||||||||||| || Sbjct: 383 tcaatcagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaagga 324 Query: 409 acaatgtcctcaagctttttaccatt 434 || || ||||||||||| || ||||| Sbjct: 323 acgatatcctcaagcttctttccatt 298
>ref|NM_105608.2| Arabidopsis thaliana translation initiation factor AT1G69410 mRNA, complete cds Length = 763 Score = 97.6 bits (49), Expect = 3e-17 Identities = 162/201 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 501 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 442 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || |||||||||||| ||||||||| ||||||||||| || ||||| ||||| || || Sbjct: 441 cttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttcaga 382 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||||| |||||| ||| ||| | |||||||| |||| || |||||||| || Sbjct: 381 gatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaaga 322 Query: 405 angaacaatgtcctcaagctt 425 | |||| || || |||||||| Sbjct: 321 aggaacgatatcttcaagctt 301
>gb|AY060530.1| Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds Length = 477 Score = 97.6 bits (49), Expect = 3e-17 Identities = 162/201 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 405 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 346 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || |||||||||||| ||||||||| ||||||||||| || ||||| ||||| || || Sbjct: 345 cttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttcaga 286 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||||| |||||| ||| ||| | |||||||| |||| || |||||||| || Sbjct: 285 gatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaaga 226 Query: 405 angaacaatgtcctcaagctt 425 | |||| || || |||||||| Sbjct: 225 aggaacgatatcttcaagctt 205
>gb|AF372933.1|AF372933 Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds Length = 676 Score = 97.6 bits (49), Expect = 3e-17 Identities = 162/201 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 469 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 410 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || |||||||||||| ||||||||| ||||||||||| || ||||| ||||| || || Sbjct: 409 cttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttcaga 350 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||||| |||||| ||| ||| | |||||||| |||| || |||||||| || Sbjct: 349 gatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaaga 290 Query: 405 angaacaatgtcctcaagctt 425 | |||| || || |||||||| Sbjct: 289 aggaacgatatcttcaagctt 269
>emb|BX818518.1|CNS0AE6E Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZE12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 723 Score = 97.6 bits (49), Expect = 3e-17 Identities = 162/201 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 459 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 400 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || |||||||||||| ||||||||| ||||||||||| || ||||| ||||| || || Sbjct: 399 cttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttcaga 340 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||||| |||||| ||| ||| | |||||||| |||| || |||||||| || Sbjct: 339 gatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaaga 280 Query: 405 angaacaatgtcctcaagctt 425 | |||| || || |||||||| Sbjct: 279 aggaacgatatcttcaagctt 259
>gb|AY087040.1| Arabidopsis thaliana clone 30884 mRNA, complete sequence Length = 752 Score = 97.6 bits (49), Expect = 3e-17 Identities = 162/201 (80%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 501 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 442 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 || |||||||||||| ||||||||| ||||||||||| || ||||| ||||| || || Sbjct: 441 cttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttcaga 382 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 || ||||||| |||||| ||| ||| | |||||||| |||| || |||||||| || Sbjct: 381 gatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaaga 322 Query: 405 angaacaatgtcctcaagctt 425 | |||| || || |||||||| Sbjct: 321 aggaacgatatcttcaagctt 301
>dbj|AB004827.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A1, complete cds Length = 632 Score = 97.6 bits (49), Expect = 3e-17 Identities = 110/131 (83%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||||||||| |||||| ||||| || || ||||||||||| ||||| ||| Sbjct: 368 ccattttcagtaagaagagacacaaaaccatcttcagagatgtcaatcagttgatagtca 309 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||||||||||| || |||||||||||| ||||||| || |||||||| Sbjct: 308 gtacgattgacatgtggcacatcacaattgtgggatgaaggaacaatatcttcaagcttc 249 Query: 427 ttaccattgaa 437 || |||||||| Sbjct: 248 tttccattgaa 238
>dbj|AB004823.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A2, complete cds Length = 716 Score = 97.6 bits (49), Expect = 3e-17 Identities = 110/131 (83%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||||||||| |||||| ||||| || || ||||||||||| ||||| ||| Sbjct: 382 ccattttcagtaagaagagacacaaaaccatcttcagagatgtcaatcagttgatagtca 323 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||||||||||| || |||||||||||| ||||||| || |||||||| Sbjct: 322 gtacgattgacatgtggcacatcacaattgtgggatgaaggaacaatatcttcaagcttc 263 Query: 427 ttaccattgaa 437 || |||||||| Sbjct: 262 tttccattgaa 252
>gb|DQ234394.1| Secale sylvestre translation initiation factor 5A mRNA, complete cds Length = 636 Score = 93.7 bits (47), Expect = 5e-16 Identities = 210/266 (78%) Strand = Plus / Minus Query: 169 tccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatcc 228 ||||| || ||||||||||||| || |||||||| ||||| |||| ||| || ||| Sbjct: 522 tccttaacagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtcc 463 Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 || || |||||||||||| ||||| |||| || | | |||||||||| || || || Sbjct: 462 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 403 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 || ||||||||| | | ||| ||||||| |||||||| ||| ||||||| || | |||| Sbjct: 402 aggtcatccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatg 343 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 |||||||||||||| || ||||| ||||| || || | ||||||||||||||| || Sbjct: 342 tcaatcagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaagga 283 Query: 409 acaatgtcctcaagctttttaccatt 434 || || ||||||||||| || ||||| Sbjct: 282 acgatatcctcaagcttctttccatt 257
>gb|DQ234393.1| Aegilops tauschii translation initiation factor 5A gene, complete cds Length = 636 Score = 93.7 bits (47), Expect = 5e-16 Identities = 210/266 (78%) Strand = Plus / Minus Query: 169 tccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatcc 228 ||||| || ||||||||||||| || |||||||| ||||| |||| ||| || ||| Sbjct: 522 tccttcacagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtcc 463 Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 || || |||||||||||| ||||| |||| || | | |||||||||| || || || Sbjct: 462 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 403 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 || ||||||||| | | ||| ||||||| |||||||| ||| ||||||| || | |||| Sbjct: 402 aggtcatccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatg 343 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 |||||||||||||| || ||||| ||||| || || | ||||||||||||||| || Sbjct: 342 tcaatcagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaagga 283 Query: 409 acaatgtcctcaagctttttaccatt 434 || || ||||||||||| || ||||| Sbjct: 282 acgatatcctcaagcttctttccatt 257
>gb|DQ234390.1| Dasypyrum breviaristatum translation initiation factor 5A mRNA, complete cds Length = 637 Score = 93.7 bits (47), Expect = 5e-16 Identities = 210/266 (78%) Strand = Plus / Minus Query: 169 tccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatcc 228 ||||| || ||||||||||||| || |||||||| ||||| |||| ||| || ||| Sbjct: 522 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 463 Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 || || |||||||||||| ||||| |||| || | | |||||||||| || || || Sbjct: 462 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 403 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 || ||||||||| | | ||| ||||||| |||||||| ||| ||||||| || | |||| Sbjct: 402 aggtcatccttagtgttgccactctcagtcagaaggctgacatatccatcatcagttatg 343 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 |||||||||||||| || ||||| ||||| || || | ||||||||||||||| || Sbjct: 342 tcaatcagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaagga 283 Query: 409 acaatgtcctcaagctttttaccatt 434 || || ||||||||||| || ||||| Sbjct: 282 acgatatcctcaagcttctttccatt 257
>gb|AF516352.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform III (eIF-5A) mRNA, complete cds Length = 781 Score = 93.7 bits (47), Expect = 5e-16 Identities = 114/137 (83%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||| ||||| |||||||| ||||| || || || |||||||||||||| ||| Sbjct: 351 ccattttcagtcagaagactcacaaagccatcttcagagatatcaatcagctgataatca 292 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||| || |||| || |||||||||||| ||||||| || ||||| ||| Sbjct: 291 gtacgattaacatgaggaacatcacaattgtgggatgaaggaacaatatcttcaagtttt 232 Query: 427 ttaccattgaatatatc 443 || ||||||||||||| Sbjct: 231 tttgcattgaatatatc 215
>gb|AF516351.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform II (eIF-5A) mRNA, complete cds Length = 828 Score = 93.7 bits (47), Expect = 5e-16 Identities = 114/137 (83%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||| ||||| |||||||| ||||| || || || |||||||||||||| ||| Sbjct: 356 ccattttcagtcagaagactcacaaagccatcttcagagatatcaatcagctgataatca 297 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||| || |||| || |||||||||||| ||||||| || ||||| ||| Sbjct: 296 gtacgattaacatgaggaacatcacaattgtgggatgaaggaacaatatcttcaagtttt 237 Query: 427 ttaccattgaatatatc 443 || ||||||||||||| Sbjct: 236 tttgcattgaatatatc 220
>gb|AF516350.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform I (eIF-5A) mRNA, complete cds Length = 775 Score = 93.7 bits (47), Expect = 5e-16 Identities = 114/137 (83%) Strand = Plus / Minus Query: 307 ccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactca 366 ||||| ||||| ||||| |||||||| ||||| || || || |||||||||||||| ||| Sbjct: 351 ccattttcagtcagaagactcacaaagccatcttcagagatatcaatcagctgataatca 292 Query: 367 gtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagcttt 426 ||||| | ||||| || |||| || |||||||||||| ||||||| || ||||| ||| Sbjct: 291 gtacgattaacatgaggaacatcacaattgtgggatgaaggaacaatatcttcaagtttt 232 Query: 427 ttaccattgaatatatc 443 || ||||||||||||| Sbjct: 231 tttgcattgaatatatc 215
>ref|XM_469841.1| Oryza sativa (japonica cultivar-group), mRNA Length = 859 Score = 89.7 bits (45), Expect = 7e-15 Identities = 170/213 (79%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 486 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 427 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 426 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 367 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 ||||||||||||||||| |||||||||| || || || || | ||||||||||| || Sbjct: 366 aatgtcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggagga 307 Query: 405 angaacaatgtcctcaagctttttaccattgaa 437 | ||||| || |||||||| || |||||||| Sbjct: 306 gggcacaatatcttcaagcttcttcccattgaa 274
>ref|NM_194115.2| Oryza sativa (japonica cultivar-group), mRNA Length = 863 Score = 89.7 bits (45), Expect = 7e-15 Identities = 106/127 (83%) Strand = Plus / Minus Query: 311 tctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtac 370 ||||||| | |||||||||||||||||| || || |||||||||||||| || ||||||| Sbjct: 409 tctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagctggtaatcagtac 350 Query: 371 ggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttac 430 | || ||||| || || | |||||||||||||| | ||||| || |||||||| || | Sbjct: 349 gatcaacatgaggaacgtcacagttgtgggatgaggggacaatatcttcaagcttctttc 290 Query: 431 cattgaa 437 ||||||| Sbjct: 289 cattgaa 283
>emb|AJ312906.1|OSA312906 Oryza sativa mRNA for translation initiation factor, eIF-5A (eIF-5A gene) Length = 831 Score = 89.7 bits (45), Expect = 7e-15 Identities = 170/213 (79%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 481 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 422 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 421 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 362 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 ||||||||||||||||| |||||||||| || || || || | ||||||||||| || Sbjct: 361 aatgtcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggagga 302 Query: 405 angaacaatgtcctcaagctttttaccattgaa 437 | ||||| || |||||||| || |||||||| Sbjct: 301 gggcacaatatcttcaagcttcttcccattgaa 269
>emb|AJ252135.1|OSA252135 Oryza sativa mRNA for translation initiation factor eIF-5A Length = 722 Score = 89.7 bits (45), Expect = 7e-15 Identities = 170/213 (79%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 481 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 422 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 421 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 362 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 ||||||||||||||||| |||||||||| || || || || | ||||||||||| || Sbjct: 361 aatgtcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggagga 302 Query: 405 angaacaatgtcctcaagctttttaccattgaa 437 | ||||| || |||||||| || |||||||| Sbjct: 301 gggcacaatatcttcaagcttcttcccattgaa 269
>dbj|AK121592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038B14, full insert sequence Length = 838 Score = 89.7 bits (45), Expect = 7e-15 Identities = 170/213 (79%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 491 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 432 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 431 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 372 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 ||||||||||||||||| |||||||||| || || || || | ||||||||||| || Sbjct: 371 aatgtcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggagga 312 Query: 405 angaacaatgtcctcaagctttttaccattgaa 437 | ||||| || |||||||| || |||||||| Sbjct: 311 gggcacaatatcttcaagcttcttcccattgaa 279
>dbj|AK060387.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-G06, full insert sequence Length = 947 Score = 89.7 bits (45), Expect = 7e-15 Identities = 170/213 (79%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 497 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 438 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 437 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 378 Query: 345 tatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatga 404 ||||||||||||||||| |||||||||| || || || || | ||||||||||| || Sbjct: 377 aatgtcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggagga 318 Query: 405 angaacaatgtcctcaagctttttaccattgaa 437 | ||||| || |||||||| || |||||||| Sbjct: 317 gggcacaatatcttcaagcttcttcccattgaa 285
>dbj|AK058206.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-A08, full insert sequence Length = 863 Score = 89.7 bits (45), Expect = 7e-15 Identities = 106/127 (83%) Strand = Plus / Minus Query: 311 tctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtac 370 ||||||| | |||||||||||||||||| || || |||||||||||||| || ||||||| Sbjct: 409 tctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagctggtaatcagtac 350 Query: 371 ggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttac 430 | || ||||| || || | |||||||||||||| | ||||| || |||||||| || | Sbjct: 349 gatcaacatgaggaacgtcacagttgtgggatgaggggacaatatcttcaagcttctttc 290 Query: 431 cattgaa 437 ||||||| Sbjct: 289 cattgaa 283
>gb|AF516358.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform IX (eIF-5A) mRNA, partial cds Length = 285 Score = 87.7 bits (44), Expect = 3e-14 Identities = 149/185 (80%) Strand = Plus / Minus Query: 184 atctgttnctcccccatggccgacatgacagtcagcgccaaatccttcccctcagcaaat 243 ||||| | ||| ||||||| ||||| ||||||| ||||||| |||||||| || ||| Sbjct: 238 atctgctcctctcccatggaagacatcacagtcacaaccaaatctttcccctcggcgaat 179 Query: 244 ccatccttgagctgggtcaggatagcatcatcagttgggagtttaagatcatccttanng 303 |||||||||| ||| ||||| | | ||||||||||| || | || |||||||| | Sbjct: 178 ccatccttgatctgagtcagcagattttcatcagttggaagcctcaggtcatccttggtg 119 Query: 304 ctaccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatac 363 | ||||||||||| || || ||||||||||||||||| || || |||||||||||||| Sbjct: 118 tttccattctcagtcagcagactcacaaatccatcctcagagatatcaatcagctgataa 59 Query: 364 tcagt 368 ||||| Sbjct: 58 tcagt 54
>dbj|AP004275.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0453E05 Length = 137364 Score = 85.7 bits (43), Expect = 1e-13 Identities = 51/54 (94%) Strand = Plus / Plus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatct 444 ||||||||||| ||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 77458 cagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatct 77511 Score = 81.8 bits (41), Expect = 2e-12 Identities = 54/59 (91%) Strand = Plus / Plus Query: 271 tcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcac 329 ||||||||||||||| |||||||||||||| | ||||| ||||||||||||||||||| Sbjct: 77109 tcatcagttgggagtctaagatcatccttagtgttaccactctcagtaagaaggctcac 77167 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 331 aatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtgg 383 ||||||||||||||||||||||||||||| ||||| || |||| |||||||| Sbjct: 77261 aatccatcctctgatatgtcaatcagctggtactctgtgcggttcacatgtgg 77313 Score = 58.0 bits (29), Expect = 3e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 146 gaggaagttacctggggccgacgtccttgactgcgcagatctgttnctcccccatggccg 205 |||| |||||| ||||||| | |||||| | || |||||||| | |||||||||||| | Sbjct: 76078 gagggagttacttggggccaatgtccttcagcgcacagatctgctcctcccccatggcgg 76137 Query: 206 acatgacagtca 217 |||||||||||| Sbjct: 76138 acatgacagtca 76149
>emb|X63542.1|NPNEIF5A2 N.plumbaginifolia mRNA NeIF-5A2 for initiation factor 5A(2) Length = 1224 Score = 83.8 bits (42), Expect = 4e-13 Identities = 155/194 (79%) Strand = Plus / Minus Query: 232 ccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagtttaaga 291 ||||||||||| |||||||||| ||| || |||| ||||||||| || || |||| Sbjct: 439 ccctcagcaaacccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaagg 380 Query: 292 tcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatgtca 351 |||||||| | ||||||||||||| || || |||||||||||||| || || |||||| Sbjct: 379 tcatccttggtgttaccattctcagtgagcagactcacaaatccatcttcagaaatgtca 320 Query: 352 atcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaangaaca 411 || |||||||| || ||||| | || || ||||||| || ||||| || || ||||| Sbjct: 319 ataagctgataatctgtacgattaacgtggggcacatcacaattgtgtgaagagggaaca 260 Query: 412 atgtcctcaagctt 425 || ||||||||||| Sbjct: 259 atatcctcaagctt 246
>emb|X63541.1|NPNEIF5A1 N.plumbaginifolia mRNA NeIF-5A1 for initiation factor 5A(1) Length = 702 Score = 81.8 bits (41), Expect = 2e-12 Identities = 210/268 (78%) Strand = Plus / Minus Query: 158 tggggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtca 217 ||||||| |||||||||| | || ||||| | ||| |||||||| ||||| || | || Sbjct: 435 tggggccaacgtccttgataccacaaatctgctcctctcccatggcagacatcactgaca 376 Query: 218 gcgccaaatccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcag 277 | |||| ||||||||||||||||| ||||| |||| | ||| ||| | | ||| |||| Sbjct: 375 gaaccaagtccttcccctcagcaaaaccatctttgatcagggccagaagattatcgtcag 316 Query: 278 ttgggagtttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccat 337 ||||||| | | |||||||| | ||||||| ||||| | || ||||||||||||| Sbjct: 315 ttgggagcctcaagtcatccttggtgttaccattttcagtcaacagactcacaaatccat 256 Query: 338 cctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgt 397 |||| || || |||||||||||||| ||||| | | ||||| || |||| ||||||| Sbjct: 255 cctcagagatatcaatcagctgatagtcagtcctattcacatgaggaacatcacagttgt 196 Query: 398 gggatgaangaacaatgtcctcaagctt 425 | || || |||||||||| |||||||| Sbjct: 195 gagaagagggaacaatgtcttcaagctt 168
>gb|AF416338.1|AF416338 Medicago sativa eukaryotic translation initiation factor 5A-2 mRNA, complete cds Length = 649 Score = 81.8 bits (41), Expect = 2e-12 Identities = 99/119 (83%) Strand = Plus / Minus Query: 325 ctcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggc 384 |||||||||||||| || || || ||||||| |||||| |||||||| | ||||| || Sbjct: 359 ctcacaaatccatcttcagaaatatcaatcaactgataatcagtacgattcacatgagga 300 Query: 385 acatngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatc 443 |||| || |||||||||||| ||||||| || ||||| ||||| |||||||| ||||| Sbjct: 299 acatcacaattgtgggatgaaggaacaatatcttcaagttttttcccattgaaaatatc 241
>dbj|AK061867.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-H10, full insert sequence Length = 961 Score = 77.8 bits (39), Expect = 3e-11 Identities = 188/239 (78%) Strand = Plus / Minus Query: 160 gggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagc 219 ||||||| |||||| | ||||||||||| | ||| |||||||| ||||| ||||||| | Sbjct: 576 gggccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcacc 517 Query: 220 gccaaatccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagtt 279 ||| |||||||| || ||||||||||||||| ||| | || | ||||||||| Sbjct: 516 accaggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagta 457 Query: 280 gggagtttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcc 339 ||||| | || |||||||| | | ||||| ||||| | || ||||||||||||||| Sbjct: 456 gggagcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcc 397 Query: 340 tctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtg 398 || ||||| ||||| ||||| ||||| ||||||| ||||| || |||| |||||||| Sbjct: 396 tcagatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtg 338
>dbj|AK099039.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131C14, full insert sequence Length = 981 Score = 77.8 bits (39), Expect = 3e-11 Identities = 188/239 (78%) Strand = Plus / Minus Query: 160 gggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagc 219 ||||||| |||||| | ||||||||||| | ||| |||||||| ||||| ||||||| | Sbjct: 575 gggccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcacc 516 Query: 220 gccaaatccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagtt 279 ||| |||||||| || ||||||||||||||| ||| | || | ||||||||| Sbjct: 515 accaggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagta 456 Query: 280 gggagtttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcc 339 ||||| | || |||||||| | | ||||| ||||| | || ||||||||||||||| Sbjct: 455 gggagcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcc 396 Query: 340 tctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtg 398 || ||||| ||||| ||||| ||||| ||||||| ||||| || |||| |||||||| Sbjct: 395 tcagatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtg 337
>gb|DQ083198.1| Oryza sativa (indica cultivar-group) clone 5S10E11 mRNA sequence Length = 371 Score = 75.8 bits (38), Expect = 1e-10 Identities = 117/144 (81%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||||||||| || ||||||||||||| ||| || || | ||| |||||| | ||||| Sbjct: 144 atccttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggag 85 Query: 285 tttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctga 344 | || ||||||||| || ||| | ||||| || ||||| ||||||||||| || || Sbjct: 84 cctcaggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcaga 25 Query: 345 tatgtcaatcagctgatactcagt 368 ||||||||||||||||| ||||| Sbjct: 24 aatgtcaatcagctgatagtcagt 1
>gb|AF516354.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform V (eIF-5A) mRNA, partial cds Length = 427 Score = 73.8 bits (37), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| ||||| |||||||| ||||| || || || |||||||||||||| |||||||| Sbjct: 352 tcagtcagaagactcacaaaaccatcttcagagatatcaatcagctgataatcagtacga 293 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 | ||||| || ||| || |||||||||||| ||||||| || ||||| ||||| || Sbjct: 292 ttaacatggggagcatcacaattgtgggatgaaggaacaatatcttcaagtttttttgca 233 Query: 433 ttgaatatatc 443 |||||||||| Sbjct: 232 gtgaatatatc 222
>gb|AF516353.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform IV (eIF-5A) mRNA, complete cds Length = 772 Score = 73.8 bits (37), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| ||||| |||||||| ||||| || || || |||||||||||||| |||||||| Sbjct: 349 tcagtcagaagactcacaaaaccatcttcagagatatcaatcagctgataatcagtacga 290 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 | ||||| || ||| || |||||||||||| ||||||| || ||||| ||||| || Sbjct: 289 ttaacatggggagcatcacaattgtgggatgaaggaacaatatcttcaagtttttttgca 230 Query: 433 ttgaatatatc 443 |||||||||| Sbjct: 229 gtgaatatatc 219 Score = 44.1 bits (22), Expect = 0.38 Identities = 66/81 (81%) Strand = Plus / Minus Query: 168 gtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagcgccaaatc 227 |||||||| || |||||||| | ||| ||||| || |||||||| |||| | | | || Sbjct: 494 gtccttgagggcacagatctgctcctctcccattgcagacatgacggtcaccacaaggtc 435 Query: 228 cttcccctcagcaaatccatc 248 ||||||||||||||| ||||| Sbjct: 434 cttcccctcagcaaacccatc 414
>emb|AJ608752.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, clone Np048 Length = 239 Score = 73.8 bits (37), Expect = 4e-10 Identities = 107/131 (81%) Strand = Plus / Minus Query: 232 ccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagtttaaga 291 ||||||||||| |||||||||| ||| || |||| ||||||||| || || |||| Sbjct: 139 ccctcagcaaacccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaagg 80 Query: 292 tcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatgtca 351 |||||||| | ||||||||||||| || || |||||||||||||| || || |||||| Sbjct: 79 tcatccttggtgttaccattctcagtgagcagactcacaaatccatcttcagaaatgtca 20 Query: 352 atcagctgata 362 || |||||||| Sbjct: 19 ataagctgata 9
>emb|BX816465.1|CNS0ABU4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH4ZG03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1411 Score = 73.8 bits (37), Expect = 4e-10 Identities = 83/99 (83%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 845 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 786 Query: 285 tttaagatcatccttanngctaccattctcagtaagaag 323 || |||||||||||| ||||||||| ||||||||||| Sbjct: 785 cttcagatcatccttagtgctaccattatcagtaagaag 747
>emb|BX817162.1|CNS0ABMR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH8ZF05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1461 Score = 73.8 bits (37), Expect = 4e-10 Identities = 83/99 (83%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 845 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 786 Query: 285 tttaagatcatccttanngctaccattctcagtaagaag 323 || |||||||||||| ||||||||| ||||||||||| Sbjct: 785 cttcagatcatccttagtgctaccattatcagtaagaag 747
>gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence Length = 107214 Score = 73.8 bits (37), Expect = 4e-10 Identities = 83/99 (83%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 33443 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 33384 Query: 285 tttaagatcatccttanngctaccattctcagtaagaag 323 || |||||||||||| ||||||||| ||||||||||| Sbjct: 33383 cttcagatcatccttagtgctaccattatcagtaagaag 33345
>gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23O10 genomic sequence, complete sequence Length = 93802 Score = 73.8 bits (37), Expect = 4e-10 Identities = 83/99 (83%) Strand = Plus / Plus Query: 225 atccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggag 284 |||||| ||||| ||||||||| ||||||||| || || | ||| ||||| ||||| || Sbjct: 6786 atccttaccctcctcaaatccattcttgagctgtgtgagtaaagcttcatctgttggcag 6845 Query: 285 tttaagatcatccttanngctaccattctcagtaagaag 323 || |||||||||||| ||||||||| ||||||||||| Sbjct: 6846 cttcagatcatccttagtgctaccattatcagtaagaag 6884
>gb|AF225297.1|AF225297 Euphorbia esula translation initiation factor 5A mRNA, partial cds Length = 725 Score = 73.8 bits (37), Expect = 4e-10 Identities = 113/139 (81%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| ||||| || || ||||||||||||||||| || || ||||||||||| || | Sbjct: 319 taccattttcagttagcagactcacaaatccatcctcggagatatcaatcagctggtagt 260 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 |||||||| || || || |||| || |||||||| ||| |||| || || ||||||| Sbjct: 259 cagtacgggtgacgtggggaacatcacaattgtgggaagaaggaacgatatcttcaagct 200 Query: 425 ttttaccattgaatatatc 443 | || |||||||| ||||| Sbjct: 199 tctttccattgaagatatc 181
>emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D Length = 741 Score = 71.9 bits (36), Expect = 2e-09 Identities = 118/146 (80%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||| |||||||||||||||||||||| ||| || || | | ||||| || || ||| Sbjct: 527 tcctttccctcagcaaatccatccttgatctgagtgagcagactgtcatcggtgggaagt 468 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 || || ||||||||| | | ||||| ||||| || | ||||||||||||||| || || Sbjct: 467 ttgaggtcatccttagtgtttccattttcagtgagcaagctcacaaatccatcttcagaa 408 Query: 346 atgtcaatcagctgatactcagtacg 371 |||||||| |||||||| || ||||| Sbjct: 407 atgtcaatgagctgataatcggtacg 382
>gb|AY389707.1| Hyacinthus orientalis eukaryotic translation initiation factor 5A-4 mRNA, complete cds Length = 794 Score = 69.9 bits (35), Expect = 7e-09 Identities = 172/219 (78%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||| || |||||||| ||||| |||| |||||| || | | ||||||||||| || Sbjct: 436 tccttgccttcagcaaaaccatctttgatctgggtaagcagggagtcatcagttggaagc 377 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 | |||||||||||| || |||||||||||| | || |||||||||||||| || ||| Sbjct: 376 ctcagatcatccttagtgccaccattctcagttaagagactcacaaatccatcttcagat 317 Query: 346 atgtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaa 405 ||||| || || ||||| ||||| ||| ||||| || |||| ||||| ||||| || Sbjct: 316 atgtcgatgagttgatagtcagtgcgggtaacatgaggaacatcacagttatgggaagat 257 Query: 406 ngaacaatgtcctcaagctttttaccattgaatatatct 444 | ||||| || |||||||| ||| || |||| |||||| Sbjct: 256 ggcacaatatcttcaagcttcttagcagtgaagatatct 218
>gb|AF296085.1|AF296085 Lycopersicon esculentum eukaryotic translation initiation factor 5A-3 mRNA, complete cds Length = 713 Score = 69.9 bits (35), Expect = 7e-09 Identities = 99/121 (81%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| |||||||| || |||||||||||||| || || |||||||| |||||||| | Sbjct: 379 taccattgtcagtaagcagactcacaaatccatcttcagagatgtcaataagctgataat 320 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 | ||||| | ||||| ||||||| || ||||| || || | ||||| |||||||||| Sbjct: 319 ctgtacgattaacatggggcacatcacaattgtgtgaagaggggacaatatcctcaagct 260 Query: 425 t 425 | Sbjct: 259 t 259
>ref|NM_101261.1| Arabidopsis thaliana EIF-5A; translation initiation factor AT1G13950 (EIF-5A) mRNA, complete cds Length = 705 Score = 63.9 bits (32), Expect = 4e-07 Identities = 69/82 (84%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngc 391 ||||||| || || ||||||||||||||||| |||||||||| ||||| || |||| | Sbjct: 353 atccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgaggaacatcac 294 Query: 392 agttgtgggatgaangaacaat 413 | |||||||| ||| ||||||| Sbjct: 293 aattgtgggaagaaggaacaat 272
>gb|AY117272.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950) mRNA, complete cds Length = 508 Score = 63.9 bits (32), Expect = 4e-07 Identities = 69/82 (84%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngc 391 ||||||| || || ||||||||||||||||| |||||||||| ||||| || |||| | Sbjct: 298 atccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgaggaacatcac 239 Query: 392 agttgtgggatgaangaacaat 413 | |||||||| ||| ||||||| Sbjct: 238 aattgtgggaagaaggaacaat 217
>gb|AY063780.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950) mRNA, complete cds Length = 676 Score = 63.9 bits (32), Expect = 4e-07 Identities = 69/82 (84%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngc 391 ||||||| || || ||||||||||||||||| |||||||||| ||||| || |||| | Sbjct: 338 atccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgaggaacatcac 279 Query: 392 agttgtgggatgaangaacaat 413 | |||||||| ||| ||||||| Sbjct: 278 aattgtgggaagaaggaacaat 257
>gb|AF296082.1|AF296082 Arabidopsis thaliana eukaryotic translation initiation factor 5A mRNA, complete cds Length = 702 Score = 63.9 bits (32), Expect = 4e-07 Identities = 69/82 (84%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngc 391 ||||||| || || ||||||||||||||||| |||||||||| ||||| || |||| | Sbjct: 353 atccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgaggaacatcac 294 Query: 392 agttgtgggatgaangaacaat 413 | |||||||| ||| ||||||| Sbjct: 293 aattgtgggaagaaggaacaat 272
>emb|BX817272.1|CNS0AAJ3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL10ZA11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 649 Score = 63.9 bits (32), Expect = 4e-07 Identities = 69/82 (84%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcacatngc 391 ||||||| || || ||||||||||||||||| |||||||||| ||||| || |||| | Sbjct: 331 atccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgaggaacatcac 272 Query: 392 agttgtgggatgaangaacaat 413 | |||||||| ||| ||||||| Sbjct: 271 aattgtgggaagaaggaacaat 250
>gb|AY961930.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A) mRNA, complete cds Length = 848 Score = 61.9 bits (31), Expect = 2e-06 Identities = 101/125 (80%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| || ||||| ||||| |||||||| || || ||||| |||||||| |||||||| Sbjct: 406 tcagtcagcaggctaacaaaaccatcctcagaaatatcaattagctgataatcagtacga 347 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 ||||| || |||| ||||||||| || || | ||||| || ||||||||||||||| Sbjct: 346 gtaacatgagggacatcgcagttgtgtgaagatggcacaatatcttcaagctttttacca 287 Query: 433 ttgaa 437 |||| Sbjct: 286 ctgaa 282
>gb|AY961928.1| Picea abies eukaryotic translation initiation factor 5A 2 (eIF5A) mRNA, complete cds Length = 622 Score = 61.9 bits (31), Expect = 2e-06 Identities = 101/125 (80%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 ||||| || ||||| ||||| |||||||| || || ||||| |||||||| |||||||| Sbjct: 407 tcagtcagcaggctaacaaaaccatcctcagaaatatcaattagctgataatcagtacga 348 Query: 373 tctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctttttacca 432 ||||| || |||| ||||||||| || || | ||||| || ||||||||||||||| Sbjct: 347 gtaacatgagggacatcgcagttgtgtgaagatggcacaatatcttcaagctttttacca 288 Query: 433 ttgaa 437 |||| Sbjct: 287 ctgaa 283
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 61.9 bits (31), Expect = 2e-06 Identities = 78/94 (82%) Strand = Plus / Minus Query: 160 gggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagc 219 ||||||| |||||| | ||||||||||| | ||| |||||||| ||||| ||||||| | Sbjct: 19506019 gggccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcacc 19505960 Query: 220 gccaaatccttcccctcagcaaatccatccttga 253 ||| |||||||| || ||||||||||||||| Sbjct: 19505959 accaggtccttcccttctccaaatccatccttga 19505926 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 |||||||||||||| ||||| ||||| ||||| ||||| ||||||| Sbjct: 19505212 acaaatccatcctcagatatatcaatgagctggtactccgtacggt 19505167
>emb|BX814148.1|CNS0AEAE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB59ZC08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 737 Score = 61.9 bits (31), Expect = 2e-06 Identities = 123/155 (79%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||||||||||||||| || |||||||| | || Sbjct: 398 agatcatccttggtgccaccactgtcagtaagaaggctcacgaagccatcctcagtgata 339 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 338 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 279 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 278 acaatatcttcaagcttcttagcagtgaagatatc 244
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 61.9 bits (31), Expect = 2e-06 Identities = 78/94 (82%) Strand = Plus / Minus Query: 160 gggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagc 219 ||||||| |||||| | ||||||||||| | ||| |||||||| ||||| ||||||| | Sbjct: 19432232 gggccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcacc 19432173 Query: 220 gccaaatccttcccctcagcaaatccatccttga 253 ||| |||||||| || ||||||||||||||| Sbjct: 19432172 accaggtccttcccttctccaaatccatccttga 19432139 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 |||||||||||||| ||||| ||||| ||||| ||||| ||||||| Sbjct: 19431425 acaaatccatcctcagatatatcaatgagctggtactccgtacggt 19431380
>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144596 Score = 61.9 bits (31), Expect = 2e-06 Identities = 78/94 (82%) Strand = Plus / Minus Query: 160 gggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtcagc 219 ||||||| |||||| | ||||||||||| | ||| |||||||| ||||| ||||||| | Sbjct: 38200 gggccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcacc 38141 Query: 220 gccaaatccttcccctcagcaaatccatccttga 253 ||| |||||||| || ||||||||||||||| Sbjct: 38140 accaggtccttcccttctccaaatccatccttga 38107 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 |||||||||||||| ||||| ||||| ||||| ||||| ||||||| Sbjct: 37393 acaaatccatcctcagatatatcaatgagctggtactccgtacggt 37348
>gb|DQ207846.1| Solanum tuberosum clone 073A09 eukaryotic initiation factor 5A3-like mRNA, complete cds Length = 696 Score = 60.0 bits (30), Expect = 6e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 |||||||||||| ||||| ||||| || || ||||||||||||||||| || |||||| Sbjct: 409 tcagtaagaagggagacaaaaccatcttcagagatgtcaatcagctgatagtcggtacgg 350 Query: 373 tctacatgtggcac 386 | ||||||||||| Sbjct: 349 ttgacatgtggcac 336
>gb|AY587771.1| Tamarix androssowii translation initiation factor 5A mRNA, complete cds Length = 801 Score = 60.0 bits (30), Expect = 6e-06 Identities = 97/120 (80%) Strand = Plus / Minus Query: 306 accattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactc 365 |||| ||||||| ||||| |||||||| ||||| || || || || || |||||||| || Sbjct: 391 accagtctcagtcagaagactcacaaaaccatcttcagagatatcgatgagctgatagtc 332 Query: 366 agtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagctt 425 |||||| ||||| || |||| |||||||| ||||| ||||||| ||||||||||| Sbjct: 331 ggtacgggtaacatgagggacatcacagttgtgagatgatggaacaatatcctcaagctt 272
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||||||| || || ||||||||||||||||| |||||||||| Sbjct: 31086031 acaaatccatcttcagaaatgtcaatcagctgataatcagtacggt 31085986 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttga 253 |||||||||||| || ||||||||||||| Sbjct: 31086509 atccttcccctcggcgaatccatccttga 31086481 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 15308284 agcaaatccatccttgagct 15308265
>gb|AF516356.1| Hevea brasiliensis eukaryotic translation initiation factor 5A isoform VII (eIF-5A) mRNA, complete cds Length = 895 Score = 60.0 bits (30), Expect = 6e-06 Identities = 161/206 (78%) Strand = Plus / Minus Query: 232 ccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagtttaaga 291 ||||||||||| |||||||||| ||| | ||| | | |||||||||||||| | || Sbjct: 421 ccctcagcaaaaccatccttgatctgagacagaagattctcatcagttgggagcctcagg 362 Query: 292 tcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatgtca 351 ||||| || | | ||||| |||||||| | ||||||||||||||||| || || ||| Sbjct: 361 tcatcttttgtgttcccattttcagtaagcaaactcacaaatccatcctcagaaatatca 302 Query: 352 atcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaangaaca 411 || ||||| || |||||||| ||||| || |||| ||||| ||||| || ||||| Sbjct: 301 attagctggtagtcagtacgagtgacatgaggaacatcacagttatgggaggagggaaca 242 Query: 412 atgtcctcaagctttttaccattgaa 437 || || ||||||||||| ||||||| Sbjct: 241 atatcttcaagctttttggcattgaa 216
>gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01 genomic sequence, complete sequence Length = 168759 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||||||| || || ||||||||||||||||| |||||||||| Sbjct: 10033 acaaatccatcttcagaaatgtcaatcagctgataatcagtacggt 10078 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 225 atccttcccctcagcaaatccatccttga 253 |||||||||||| || ||||||||||||| Sbjct: 9555 atccttcccctcggcgaatccatccttga 9583
>gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genomic sequence, complete sequence Length = 128017 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||||||| || || ||||||||||||||||| |||||||||| Sbjct: 6672 acaaatccatcttcagaaatgtcaatcagctgataatcagtacggt 6627 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttga 253 |||||||||||| || ||||||||||||| Sbjct: 7150 atccttcccctcggcgaatccatccttga 7122
>gb|AF296083.1|AF296083 Lycopersicon esculentum eukaryotic translation initiation factor 5A-1 mRNA, complete cds Length = 715 Score = 60.0 bits (30), Expect = 6e-06 Identities = 112/140 (80%) Strand = Plus / Minus Query: 229 ttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagttta 288 |||||||||||||| ||||| |||| ||| | ||| | || |||||||||||||||| | Sbjct: 459 ttcccctcagcaaaaccatctttgacctgagccagaagagtatcatcagttgggagtctc 400 Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 | |||||||| | ||||||| ||||| | || |||||||| |||||||| || || Sbjct: 399 aagtcatccttggtgttaccattttcagtcaacagactcacaaagccatcctcagagata 340 Query: 349 tcaatcagctgatactcagt 368 ||||| || ||||| ||||| Sbjct: 339 tcaataagttgataatcagt 320
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 60.0 bits (30), Expect = 6e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||||||| || || ||||||||||||||||| |||||||||| Sbjct: 31176554 acaaatccatcttcagaaatgtcaatcagctgataatcagtacggt 31176509 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 225 atccttcccctcagcaaatccatccttga 253 |||||||||||| || ||||||||||||| Sbjct: 31177032 atccttcccctcggcgaatccatccttga 31177004 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 15302818 agcaaatccatccttgagct 15302799
>dbj|AB004824.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A3, complete cds Length = 733 Score = 60.0 bits (30), Expect = 6e-06 Identities = 63/74 (85%) Strand = Plus / Minus Query: 313 tcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatactcagtacgg 372 |||||||||||| ||||| ||||| || || ||||||||||||||||| || |||||| Sbjct: 367 tcagtaagaagggagacaaaaccatcttcagagatgtcaatcagctgatagtcggtacgg 308 Query: 373 tctacatgtggcac 386 | ||||||||||| Sbjct: 307 ttgacatgtggcac 294
>gb|DQ228346.1| Solanum tuberosum clone 148H01 eukaryotic initiation factor 5A5-like protein mRNA, complete cds Length = 750 Score = 58.0 bits (29), Expect = 3e-05 Identities = 114/143 (79%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||||||||| ||||| ||||| |||| ||| | ||| | || ||||||||||||||| Sbjct: 453 tccttcccctcggcaaaaccatctttgacctgagccagaagagtatcatcagttgggagc 394 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 | | |||||||| | ||||||| ||||| | || |||||||| |||||||| || Sbjct: 393 ctcaagtcatccttggtgttaccattttcagtcaacagactcacaaagccatcctcagag 334 Query: 346 atgtcaatcagctgatactcagt 368 || ||||| |||||||| ||||| Sbjct: 333 atatcaataagctgataatcagt 311
>gb|DQ222495.1| Solanum tuberosum clone 103C10 eukaryotic initiation factor 5A5-like mRNA, complete cds Length = 757 Score = 58.0 bits (29), Expect = 3e-05 Identities = 114/143 (79%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||||||||| ||||| ||||| |||| ||| | ||| | || ||||||||||||||| Sbjct: 462 tccttcccctcggcaaaaccatctttgacctgagccagaagagtatcatcagttgggagc 403 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 | | |||||||| | ||||||| ||||| | || |||||||| |||||||| || Sbjct: 402 ctcaagtcatccttggtgttaccattttcagtcaacagactcacaaagccatcctcagag 343 Query: 346 atgtcaatcagctgatactcagt 368 || ||||| |||||||| ||||| Sbjct: 342 atatcaataagctgataatcagt 320
>gb|AY961927.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A) mRNA, partial cds Length = 714 Score = 58.0 bits (29), Expect = 3e-05 Identities = 96/119 (80%) Strand = Plus / Minus Query: 325 ctcacaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggc 384 ||||||||||||||||| ||||||||||||| |||| | ||||| || |||||||| Sbjct: 575 ctcacaaatccatcctcggatatgtcaatcaactgaaaatcagtgcgagtaacatgtggg 516 Query: 385 acatngcagttgtgggatgaangaacaatgtcctcaagctttttaccattgaatatatc 443 || | ||||| || || || | ||||| || ||||||||||||||||| || ||||| Sbjct: 515 acgtcacagttatgagaagatgggacaatatcttcaagctttttaccattaaaaatatc 457
>gb|DQ279897.1| Secale cereale translation initiation factor gene, partial cds Length = 1298 Score = 58.0 bits (29), Expect = 3e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| ||||||| ||||||||||| || ||||| Sbjct: 822 cagttgtgggatgaaggaacaatatcctcaagcttctttccatt 779
>dbj|AB004825.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A4, complete cds Length = 726 Score = 58.0 bits (29), Expect = 3e-05 Identities = 111/139 (79%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgatact 364 ||||||| ||||| || || |||||||||||||| || || |||||||| |||||||| | Sbjct: 371 taccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgataat 312 Query: 365 cagtacggtctacatgtggcacatngcagttgtgggatgaangaacaatgtcctcaagct 424 | || || | ||||| ||||||| || ||||| || || | ||||| |||||||||| Sbjct: 311 ctgtgcgattaacatggggcacatcacaattgtgagaagaggggacaatatcctcaagct 252 Query: 425 ttttaccattgaatatatc 443 | || ||| |||| ||||| Sbjct: 251 tctttccagtgaagatatc 233
>gb|AY961929.1| Picea abies eukaryotic translation initiation factor 5A hypusine 3-like mRNA sequence Length = 771 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 325 ctcacaaatccatcctctgatatgtcaatcagctga 360 ||||||||||||||||| ||||||||||||| |||| Sbjct: 433 ctcacaaatccatcctcggatatgtcaatcaactga 398
>gb|DQ279898.1| Psathyrostachys juncea translation initiation factor gene, partial cds Length = 1375 Score = 56.0 bits (28), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaa 437 ||||||||||||||| ||||||| ||||| ||||| || |||||||| Sbjct: 906 cagttgtgggatgaaggaacaatatcctccagcttctttccattgaa 860 Score = 44.1 bits (22), Expect = 0.38 Identities = 50/60 (83%) Strand = Plus / Minus Query: 267 agcatcatcagttgggagtttaagatcatccttanngctaccattctcagtaagaaggct 326 |||||||||||| || || || || ||||||||| ||| ||| ||||||| |||||||| Sbjct: 1202 agcatcatcagtgggaagcttcaggtcatccttagtgctgccactctcagttagaaggct 1143
>ref|NM_102425.2| Arabidopsis thaliana translation initiation factor AT1G26630 mRNA, complete cds Length = 929 Score = 54.0 bits (27), Expect = 4e-04 Identities = 122/155 (78%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||| ||||||||||| || |||||||| | || Sbjct: 473 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatcctcagtgata 414 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 413 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 354 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 353 acaatatcttcaagcttcttagcagtgaagatatc 319
>gb|AF492850.1| Arabidopsis thaliana putative initiation factor 5A mRNA, complete cds Length = 726 Score = 54.0 bits (27), Expect = 4e-04 Identities = 122/155 (78%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||| ||||||||||| || |||||||| | || Sbjct: 418 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatcctcagtgata 359 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 358 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 299 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 298 acaatatcttcaagcttcttagcagtgaagatatc 264
>gb|AY055789.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds Length = 480 Score = 54.0 bits (27), Expect = 4e-04 Identities = 122/155 (78%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||| ||||||||||| || |||||||| | || Sbjct: 341 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatcctcagtgata 282 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 281 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 222 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 221 acaatatcttcaagcttcttagcagtgaagatatc 187
>gb|AY039588.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds Length = 765 Score = 54.0 bits (27), Expect = 4e-04 Identities = 122/155 (78%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||| ||||||||||| || |||||||| | || Sbjct: 424 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatcctcagtgata 365 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 364 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 305 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 304 acaatatcttcaagcttcttagcagtgaagatatc 270
>gb|AF296084.1|AF296084 Lycopersicon esculentum eukaryotic translation initiation factor 5A-2 mRNA, complete cds Length = 779 Score = 54.0 bits (27), Expect = 4e-04 Identities = 62/74 (83%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatgtggcaca 387 ||||| ||||| || || || |||||||||||||| || ||||||| |||||||||||| Sbjct: 347 acaaaaccatcttcagagatatcaatcagctgatagtcggtacggttaacatgtggcaca 288 Query: 388 tngcagttgtggga 401 | || |||||||| Sbjct: 287 tcacaattgtggga 274
>gb|AY084827.1| Arabidopsis thaliana clone 118823 mRNA, complete sequence Length = 781 Score = 54.0 bits (27), Expect = 4e-04 Identities = 122/155 (78%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgatatg 348 ||||||||||| || |||| | ||||| ||||||||||| || |||||||| | || Sbjct: 472 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatcctcagtgata 413 Query: 349 tcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaanga 408 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || || Sbjct: 412 tcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgga 353 Query: 409 acaatgtcctcaagctttttaccattgaatatatc 443 ||||| || |||||||| ||| || |||| ||||| Sbjct: 352 acaatatcttcaagcttcttagcagtgaagatatc 318
>gb|DQ200358.1| Solanum tuberosum clone 053D09 eukaryotic initiation factor 5A4-like protein mRNA, complete cds Length = 790 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 305 taccattctcagtaagaaggctcacaaatccatcctctgatatgtcaatcagctgata 362 ||||||| ||||| || || |||||||||||||| || || |||||||| |||||||| Sbjct: 376 taccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgata 319
>gb|AC007576.3| Arabidopsis thaliana chromosome I BAC F7A19 genomic sequence, complete sequence Length = 112126 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||| || || ||||||||||||||||| |||||||||| Sbjct: 17344 atccatcttcagaaatgtcaatcagctgataatcagtacggt 17303
>gb|AC068197.4|AC068197 Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I, complete sequence Length = 99547 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 332 atccatcctctgatatgtcaatcagctgatactcagtacggt 373 ||||||| || || ||||||||||||||||| |||||||||| Sbjct: 49556 atccatcttcagaaatgtcaatcagctgataatcagtacggt 49515
>gb|DQ167202.1| Triticum aestivum eukaryotic translation initiation factor 5A2 gene, complete cds Length = 1679 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 1079 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 1036
>gb|DQ167201.1| Triticum aestivum eukaryotic translation initiation factor 5A1 gene, complete cds Length = 1910 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 1315 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 1272
>gb|DQ414518.1| Dasypyrum breviaristatum eukaryotic translation initiation factor eIF5A gene, partial cds Length = 1344 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 872 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 829
>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1118_G09 Length = 115815 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatg 380 ||||||||||| || || |||||||||||||| || |||||||| || ||||| Sbjct: 42235 acaaatccatcttccgaaatgtcaatcagctggtaatcagtacgatcaacatg 42183 Score = 40.1 bits (20), Expect = 6.0 Identities = 40/47 (85%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaa 437 |||||||||||||| | ||||| || |||||||| || |||||||| Sbjct: 42083 cagttgtgggatgaggggacaatatcttcaagcttctttccattgaa 42037
>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1513_F02 Length = 126845 Score = 50.1 bits (25), Expect = 0.006 Identities = 46/53 (86%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacggtctacatg 380 ||||||||||| || || |||||||||||||| || |||||||| || ||||| Sbjct: 23511 acaaatccatcttccgaaatgtcaatcagctggtaatcagtacgatcaacatg 23459 Score = 40.1 bits (20), Expect = 6.0 Identities = 40/47 (85%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccattgaa 437 |||||||||||||| | ||||| || |||||||| || |||||||| Sbjct: 23359 cagttgtgggatgaggggacaatatcttcaagcttctttccattgaa 23313
>gb|DQ279900.1| Haynaldia villosa translation initiation factor gene, partial cds Length = 1338 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 867 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 824
>gb|DQ279896.1| Aegilops tauschii translation initiation factor gene, partial cds Length = 1282 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 811 cagttgtgggatgaaggaacgatatcctcaagcttcttcccatt 768
>gb|DQ279895.1| Eremopyrum bonaepartis translation initiation factor gene, partial cds Length = 1334 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 876 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 833
>gb|DQ279894.1| Lophopyrum elongatum translation initiation factor gene, partial cds Length = 1334 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| |||| || ||||||||||| || ||||| Sbjct: 859 cagttgtgggatgaaggaacgatatcctcaagcttctttccatt 816
>gb|DQ279893.1| Pseudoroegneria spicata translation initiation factor gene, partial cds Length = 1358 Score = 50.1 bits (25), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 391 cagttgtgggatgaangaacaatgtcctcaagctttttaccatt 434 ||||||||||||||| | ||||| ||||||||||| || ||||| Sbjct: 879 cagttgtgggatgaagggacaatatcctcaagcttctttccatt 836
>dbj|AB004826.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A5, complete cds Length = 688 Score = 50.1 bits (25), Expect = 0.006 Identities = 113/143 (79%) Strand = Plus / Minus Query: 226 tccttcccctcagcaaatccatccttgagctgggtcaggatagcatcatcagttgggagt 285 ||||||||||| ||||| ||||| |||| ||| | ||| | || ||||||||||||||| Sbjct: 470 tccttcccctcggcaaaaccatctttgacctgagccagaagagtatcatcagttgggagc 411 Query: 286 ttaagatcatccttanngctaccattctcagtaagaaggctcacaaatccatcctctgat 345 | | |||||||| | ||||||| ||||| | | |||||||| |||||||| || Sbjct: 410 ctcaagtcatccttggtgttaccattttcagtcaacaaactcacaaagccatcctcagag 351 Query: 346 atgtcaatcagctgatactcagt 368 || ||||| |||||||| ||||| Sbjct: 350 atatcaataagctgataatcagt 328
>dbj|AP004534.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT14P20, TM0087, complete sequence Length = 124300 Score = 46.1 bits (23), Expect = 0.097 Identities = 41/47 (87%) Strand = Plus / Plus Query: 325 ctcacaaatccatcctctgatatgtcaatcagctgatactcagtacg 371 ||||||||||||||||| || || ||||| ||||| || |||||||| Sbjct: 9986 ctcacaaatccatcctcagaaatatcaatgagctggtaatcagtacg 10032
>gb|AY961931.1| Picea abies eukaryotic translation initiation factor 5A 4 (eIF5A) mRNA, complete cds Length = 676 Score = 44.1 bits (22), Expect = 0.38 Identities = 34/38 (89%) Strand = Plus / Minus Query: 316 gtaagaaggctcacaaatccatcctctgatatgtcaat 353 ||||| |||||||| || ||||||||||| |||||||| Sbjct: 478 gtaagcaggctcacgaagccatcctctgaaatgtcaat 441
>ref|XM_848899.1| PREDICTED: Canis familiaris similar to Tumor necrosis factor ligand superfamily member 18 (Glucocorticoid-induced TNF-related ligand) (hGITRL) (Activation-inducible TNF-related ligand) (AITRL) (LOC611257), mRNA Length = 1074 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Plus Query: 420 aagctttttaccattgaatata 441 |||||||||||||||||||||| Sbjct: 120 aagctttttaccattgaatata 141
>gb|AY961932.1| Picea abies eukaryotic translation initiation factor 5A 2 (eIF5A) mRNA, complete cds Length = 835 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 329 caaatccatcctctgatatgtcaat 353 |||||||||| |||||||||||||| Sbjct: 501 caaatccatcttctgatatgtcaat 477
>gb|AC163350.4| Mus musculus BAC clone RP23-186B12 from chromosome 9, complete sequence Length = 203468 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 342 tgatatgtcaatcagctgatactca 366 |||||||| |||||||||||||||| Sbjct: 116620 tgatatgtaaatcagctgatactca 116596
>emb|X63543.1|NTNEIF5A3 N.tabacum NeIF-5A3 gene for initiation factor 5A(3) Length = 2443 Score = 42.1 bits (21), Expect = 1.5 Identities = 77/96 (80%) Strand = Plus / Minus Query: 158 tggggccgacgtccttgactgcgcagatctgttnctcccccatggccgacatgacagtca 217 ||||||| |||||||||| | || ||||| | ||| |||||||| ||||| || | || Sbjct: 2355 tggggccaacgtccttgataccacaaatctgctcctctcccatggcagacatcactgaca 2296 Query: 218 gcgccaaatccttcccctcagcaaatccatccttga 253 | ||| ||||||||||||||||| ||||| |||| Sbjct: 2295 gaaccaggtccttcccctcagcaaaaccatctttga 2260 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagt 368 |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 1709 acaaatccatcctcagagatatcaataagctgatagtcagt 1669
>gb|AC104361.3| Homo sapiens chromosome 11, clone RP11-950A3, complete sequence Length = 145172 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 421 agctttttaccattgaatata 441 ||||||||||||||||||||| Sbjct: 23464 agctttttaccattgaatata 23484
>gb|AC073172.5| Homo sapiens chromosome 11, clone RP11-531H8, complete sequence Length = 168080 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 421 agctttttaccattgaatata 441 ||||||||||||||||||||| Sbjct: 136190 agctttttaccattgaatata 136210
>gb|AC068135.5| Homo sapiens BAC clone RP11-764E7 from 2, complete sequence Length = 164736 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 409 acaatgtcctcaagcttttta 429 ||||||||||||||||||||| Sbjct: 118861 acaatgtcctcaagcttttta 118841
>emb|AJ422210.2|PVI422210 Plasmodium vivax eIF-5A gene for eukaryotic translation initiation factor 5A Length = 486 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagt 368 ||||| |||||||||| |||||||||||||| ||||||| Sbjct: 299 acaaaaccatcctctgtaatgtcaatcagctgcaactcagt 259
>gb|AC103551.7| Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence Length = 137709 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 29064 agcaaatccatccttgagct 29083
>gb|AC122160.21| Medicago truncatula clone mth2-23d6, complete sequence Length = 125105 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacg 371 ||||||||||| || || || ||||||| |||||| |||||||| Sbjct: 12933 acaaatccatcttcagagatatcaatcaactgataatcagtacg 12976
>gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete sequence Length = 118589 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 328 acaaatccatcctctgatatgtcaatcagctgatactcagtacg 371 ||||||||||| || || || ||||||| |||||| |||||||| Sbjct: 46364 acaaatccatcttcagagatatcaatcaactgataatcagtacg 46321
>emb|BX814371.1|CNS0ABYU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZA04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 689 Score = 40.1 bits (20), Expect = 6.0 Identities = 122/156 (78%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 289 agatcatccttanngctaccattctcagtaagaaggctcacaaatccat-cctctgatat 347 ||||||||||| || |||| | ||||| ||||||||||| || |||| |||| | || Sbjct: 393 agatcatccttggtgccaccactgtcagtgagaaggctcacgaagccatccctcagtgat 334 Query: 348 gtcaatcagctgatactcagtacggtctacatgtggcacatngcagttgtgggatgaang 407 ||||||| ||| || ||| ||||| |||||||| |||| || |||||||| || | Sbjct: 333 atcaatcaactggtaatcaacacggttcacatgtggaacatcacaattgtgggaagatgg 274 Query: 408 aacaatgtcctcaagctttttaccattgaatatatc 443 |||||| || |||||||| ||| || |||| ||||| Sbjct: 273 aacaatatcttcaagcttcttagcagtgaagatatc 238
>gb|AC005904.19| Homo sapiens 12 PAC RP4-751H1 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 65139 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 270 atcatcagttgggagtttaa 289 |||||||||||||||||||| Sbjct: 16281 atcatcagttgggagtttaa 16262
>gb|AC006560.8| Homo sapiens 12 BAC RPCI11-792F18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 202478 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cttgagctgggtcaggatag 268 |||||||||||||||||||| Sbjct: 82088 cttgagctgggtcaggatag 82107
>gb|AC078962.30| Homo sapiens 12 BAC RP11-338E21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 162644 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ctaccattctcagtaagaag 323 |||||||||||||||||||| Sbjct: 112896 ctaccattctcagtaagaag 112877
>gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219072 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 tcaagctttttaccattgaa 437 |||||||||||||||||||| Sbjct: 117139 tcaagctttttaccattgaa 117120
>dbj|AK105057.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-C07, full insert sequence Length = 2283 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 335 agcaaatccatccttgagct 316
>dbj|AK100539.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023102F06, full insert sequence Length = 2472 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 411 agcaaatccatccttgagct 392
>dbj|AK099666.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067D14, full insert sequence Length = 2166 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 agcaaatccatccttgagct 256 |||||||||||||||||||| Sbjct: 255 agcaaatccatccttgagct 236
>emb|AL929563.15| Mouse DNA sequence from clone RP23-68O14 on chromosome 2, complete sequence Length = 113198 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 280 gggagtttaagatcatcctt 299 |||||||||||||||||||| Sbjct: 102245 gggagtttaagatcatcctt 102264 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,971,804 Number of Sequences: 3902068 Number of extensions: 2971804 Number of successful extensions: 46244 Number of sequences better than 10.0: 136 Number of HSP's better than 10.0 without gapping: 139 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 45860 Number of HSP's gapped (non-prelim): 343 length of query: 444 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 422 effective length of database: 17,147,199,772 effective search space: 7236118303784 effective search space used: 7236118303784 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
