ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd24f09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_550252.1| Oryza sativa (japonica cultivar-group), mRNA 68 2e-08
2dbj|AK067805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 54 3e-04
4dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic D... 54 3e-04
5dbj|AP002912.2| Oryza sativa (japonica cultivar-group) genomic D... 54 3e-04
6emb|BX901889.4| Zebrafish DNA sequence from clone CH211-96I7 in ... 44 0.31
7emb|AL591517.8| Zebrafish DNA sequence from clone XX-204C9, comp... 44 0.31
8gb|AC125153.3| Mus musculus BAC clone RP24-378F2 from chromosome... 42 1.2
9gb|AY510069.1| Fusarium sporotrichioides 5.8S ribosomal RNA gene... 40 4.9
10gb|AF414973.1| Fusarium sporotrichioides var. minor strain BBA 6... 40 4.9
11gb|AF414972.1| Fusarium sporotrichioides strain BBA 69072 16S ri... 40 4.9
12gb|AF414970.1| Fusarium sporotrichioides strain BBA 70746 16S ri... 40 4.9
13gb|AF414969.1| Fusarium pulverosum strain IBT 8051 16S ribosomal... 40 4.9
14gb|AY680864.1| Fusarium langsethiae and 5.8S ribosomal RNA genes... 40 4.9
15emb|CR726316.2|CNS0GNDE Tetraodon nigroviridis full-length cDNA 40 4.9
16emb|AL672040.10| Human DNA sequence from clone RP11-449L4 on chr... 40 4.9
17gb|DQ093674.1| Fusarium sporotrichioides isolate aurim1238 small... 40 4.9
18emb|CR450798.13| Zebrafish DNA sequence from clone DKEY-21P1 in ... 40 4.9
19dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111 40 4.9
20ref|XM_687618.1| PREDICTED: Danio rerio similar to Voltage-depen... 40 4.9
21emb|AM162681.1| Uncultured Fusarium sp. ITS1, 5.8S rRNA gene and... 40 4.9
22gb|AF111059.1|AF111059 Fusarium chlamydosporum strain BBA62170 1... 40 4.9
23gb|AF111055.1|AF111055 Fusarium sporotrichioides strain BBA69073... 40 4.9
24gb|AF111053.1|AF111053 Fusarium sporotrichioides strain RUS446 1... 40 4.9
25gb|U85541.1|FSU85541 Fusarium sporotrichioides internal transcri... 40 4.9
26gb|AF006348.1|AF006348 Fusarium sporotrichioides NRRL 25479 inte... 40 4.9
27gb|AF006347.1|AF006347 Fusarium sporotrichioides NRRL 25474 inte... 40 4.9
28gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 4.9
29gb|U85533.1|GAU85533 Gibberella acuminata internal transcribed s... 40 4.9
30emb|AL844218.7| Mouse DNA sequence from clone RP23-409B1 on chro... 40 4.9
31gb|U38553.1|FSU38553 Fusarium sporotrichioides 5.8S ribosomal RN... 40 4.9
32gb|U38551.1|FSU38551 Fusarium sporotrichioides 5.8S ribosomal RN... 40 4.9
33gb|AY188917.1| Fusarium sporotrichioides 18S ribosomal RNA gene,... 40 4.9 
>ref|XM_550252.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1301

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 114/141 (80%)
 Strand = Plus / Minus

                                                                       
Query: 199 agcagacgtccgtcgtctcaaggaacgtctgagtcttcaccanaatcagtgggatatagt 258
           |||||||||| ||||||||||| ||| ||||||  ||||||| |||||  ||| |||| |
Sbjct: 901 agcagacgtctgtcgtctcaagaaacttctgagatttcaccagaatcaaaggggtatatt 842

                                                                       
Query: 259 caagaacaagcctcttgcactgtggttcatagttcttcgccttgctgcatgttttgaaaa 318
           |||| || | | ||||||||||  || |||| || |  ||||||||||||| ||||| ||
Sbjct: 841 caaggaccatcttcttgcactgctgtacataattatctgccttgctgcatgctttgagaa 782

                                
Query: 319 gaagcccgactatctccagct 339
             | | |||||||||||||||
Sbjct: 781 atatctcgactatctccagct 761
to top
>dbj|AK067805.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013119N08, full
           insert sequence
          Length = 1301

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 114/141 (80%)
 Strand = Plus / Minus

                                                                       
Query: 199 agcagacgtccgtcgtctcaaggaacgtctgagtcttcaccanaatcagtgggatatagt 258
           |||||||||| ||||||||||| ||| ||||||  ||||||| |||||  ||| |||| |
Sbjct: 901 agcagacgtctgtcgtctcaagaaacttctgagatttcaccagaatcaaaggggtatatt 842

                                                                       
Query: 259 caagaacaagcctcttgcactgtggttcatagttcttcgccttgctgcatgttttgaaaa 318
           |||| || | | ||||||||||  || |||| || |  ||||||||||||| ||||| ||
Sbjct: 841 caaggaccatcttcttgcactgctgtacataattatctgccttgctgcatgctttgagaa 782

                                
Query: 319 gaagcccgactatctccagct 339
             | | |||||||||||||||
Sbjct: 781 atatctcgactatctccagct 761
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                           
Query: 199     agcagacgtccgtcgtctcaaggaacgtctgagtcttcaccanaatcagtgggatatagt 258
               |||||||||| ||||||||||| ||| ||||||  ||||||| |||||  ||| |||| |
Sbjct: 3424100 agcagacgtctgtcgtctcaagaaacttctgagatttcaccagaatcaaaggggtatatt 3424041

                                     
Query: 259     caagaacaagcctcttgcactg 280
               |||| || | | ||||||||||
Sbjct: 3424040 caaggaccatcttcttgcactg 3424019
to top
>dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0701D05
          Length = 172161

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                          
Query: 199    agcagacgtccgtcgtctcaaggaacgtctgagtcttcaccanaatcagtgggatatagt 258
              |||||||||| ||||||||||| ||| ||||||  ||||||| |||||  ||| |||| |
Sbjct: 102470 agcagacgtctgtcgtctcaagaaacttctgagatttcaccagaatcaaaggggtatatt 102411

                                    
Query: 259    caagaacaagcctcttgcactg 280
              |||| || | | ||||||||||
Sbjct: 102410 caaggaccatcttcttgcactg 102389
to top
>dbj|AP002912.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0028E10
          Length = 140791

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                         
Query: 199   agcagacgtccgtcgtctcaaggaacgtctgagtcttcaccanaatcagtgggatatagt 258
             |||||||||| ||||||||||| ||| ||||||  ||||||| |||||  ||| |||| |
Sbjct: 10860 agcagacgtctgtcgtctcaagaaacttctgagatttcaccagaatcaaaggggtatatt 10801

                                   
Query: 259   caagaacaagcctcttgcactg 280
             |||| || | | ||||||||||
Sbjct: 10800 caaggaccatcttcttgcactg 10779
to top
>emb|BX901889.4| Zebrafish DNA sequence from clone CH211-96I7 in linkage group 2, complete
              sequence
          Length = 172284

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 100    ccctgtatgattcctacacatt 121
              ||||||||||||||||||||||
Sbjct: 115852 ccctgtatgattcctacacatt 115831
to top
>emb|AL591517.8| Zebrafish DNA sequence from clone XX-204C9, complete sequence
          Length = 110834

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 100   ccctgtatgattcctacacatt 121
             ||||||||||||||||||||||
Sbjct: 77899 ccctgtatgattcctacacatt 77878
to top
>gb|AC125153.3| Mus musculus BAC clone RP24-378F2 from chromosome 6, complete sequence
          Length = 195328

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 265   caagcctcttgcactgtggtt 285
             |||||||||||||||||||||
Sbjct: 70101 caagcctcttgcactgtggtt 70121
to top
>gb|AY510069.1| Fusarium sporotrichioides 5.8S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 339

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 49  ccagcttggtgttgggatct 68
to top
>gb|AF414973.1| Fusarium sporotrichioides var. minor strain BBA 62425 16S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene and internal transcribed
           spacer 2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 537

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>gb|AF414972.1| Fusarium sporotrichioides strain BBA 69072 16S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 537

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>gb|AF414970.1| Fusarium sporotrichioides strain BBA 70746 16S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 537

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>gb|AF414969.1| Fusarium pulverosum strain IBT 8051 16S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 537

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>gb|AY680864.1| Fusarium langsethiae and 5.8S ribosomal RNA genes and internal
           transcribed spacer 2, complete sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 320 ccagcttggtgttgggatct 339
to top
>emb|CR726316.2|CNS0GNDE Tetraodon nigroviridis full-length cDNA
          Length = 1402

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 329 tatctccagcttggtgttgg 348
           ||||||||||||||||||||
Sbjct: 378 tatctccagcttggtgttgg 359
to top
>emb|AL672040.10| Human DNA sequence from clone RP11-449L4 on chromosome X, complete
              sequence
          Length = 117297

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    tgctgcatgttttgaaaaga 320
              ||||||||||||||||||||
Sbjct: 100464 tgctgcatgttttgaaaaga 100445
to top
>gb|DQ093674.1| Fusarium sporotrichioides isolate aurim1238 small subunit ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and large subunit ribosomal
           RNA gene, partial sequence
          Length = 524

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 359 ccagcttggtgttgggatct 378
to top
>emb|CR450798.13| Zebrafish DNA sequence from clone DKEY-21P1 in linkage group 8,
             complete sequence
          Length = 194659

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   gaacgtctgagtcttcacca 240
             ||||||||||||||||||||
Sbjct: 74493 gaacgtctgagtcttcacca 74474
to top
>dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111
          Length = 2356219

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    aggaattgtttccgttgttg 165
              ||||||||||||||||||||
Sbjct: 900808 aggaattgtttccgttgttg 900827
to top
>ref|XM_687618.1| PREDICTED: Danio rerio similar to Voltage-dependent N-type calcium
           channel alpha-1B subunit (Voltage-gated calcium channel
           alpha subunit Cav2.2) (Calcium channel, L type, alpha-1
           polypeptide isoform 5) (Brain calcium channel III)
           (BIII) (LOC564274), mRNA
          Length = 6321

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 221 gaacgtctgagtcttcacca 240
           ||||||||||||||||||||
Sbjct: 945 gaacgtctgagtcttcacca 926
to top
>emb|AM162681.1| Uncultured Fusarium sp. ITS1, 5.8S rRNA gene and ITS2, clone (16)5
          Length = 462

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 308 ccagcttggtgttgggatct 327
to top
>gb|AF111059.1|AF111059 Fusarium chlamydosporum strain BBA62170 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 492

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 320 ccagcttggtgttgggatct 339
to top
>gb|AF111055.1|AF111055 Fusarium sporotrichioides strain BBA69073 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 493

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 320 ccagcttggtgttgggatct 339
to top
>gb|AF111053.1|AF111053 Fusarium sporotrichioides strain RUS446 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 492

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 320 ccagcttggtgttgggatct 339
to top
>gb|U85541.1|FSU85541 Fusarium sporotrichioides internal transcribed spacer ITS1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer
           ITS2, complete sequence
          Length = 522

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>gb|AF006348.1|AF006348 Fusarium sporotrichioides NRRL 25479 internal transcribed spacer 1,
           5.8S ribosomal RNA gene; and internal transcribed spacer
           2, complete sequence
          Length = 516

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 344 ccagcttggtgttgggatct 363
to top
>gb|AF006347.1|AF006347 Fusarium sporotrichioides NRRL 25474 internal transcribed spacer 1,
           5.8S ribosomal RNA gene; and internal transcribed spacer
           2, complete sequence
          Length = 515

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 346 ccagcttggtgttgggatct 365
to top
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 335     cagcttggtgttgggatctt 354
               ||||||||||||||||||||
Sbjct: 4951094 cagcttggtgttgggatctt 4951075
to top
>gb|U85533.1|GAU85533 Gibberella acuminata internal transcribed spacer ITS1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer
           ITS2, complete sequence
          Length = 522

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369
to top
>emb|AL844218.7| Mouse DNA sequence from clone RP23-409B1 on chromosome 4, complete
             sequence
          Length = 197419

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    aaatataggaagaacaatta 86
             ||||||||||||||||||||
Sbjct: 29042 aaatataggaagaacaatta 29061
to top
>gb|U38553.1|FSU38553 Fusarium sporotrichioides 5.8S ribosomal RNA gene, complete
           sequence and internal transcribed spacers 1 and 2
          Length = 457

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 319 ccagcttggtgttgggatct 338
to top
>gb|U38551.1|FSU38551 Fusarium sporotrichioides 5.8S ribosomal RNA gene, complete
           sequence and internal transcribed spacers 1 and 2
          Length = 457

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 319 ccagcttggtgttgggatct 338
to top
>gb|AY188917.1| Fusarium sporotrichioides 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 1135

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 334 ccagcttggtgttgggatct 353
           ||||||||||||||||||||
Sbjct: 350 ccagcttggtgttgggatct 369


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,387,696
Number of Sequences: 3902068
Number of extensions: 3387696
Number of successful extensions: 59671
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59603
Number of HSP's gapped (non-prelim): 66
length of query: 369
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 347
effective length of database: 17,147,199,772
effective search space: 5950078320884
effective search space used: 5950078320884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top