Clone Information

BLAST Search Result

Clone Name	rbasd24e10
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AK121844.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	113	6e-22
2	gb\|AC111016.2\| Oryza sativa (japonica cultivar-group) chromosome...	78	3e-11
3	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
4	gb\|AC145574.5\| Mus musculus BAC clone RP24-411C16 from chromosom...	46	0.11
5	gb\|AC165428.1\| Strongylocentrotus purpuratus BAC clone contig co...	46	0.11
6	gb\|AC174081.1\| Mus musculus BAC clone RP24-376P15 from chromosom...	46	0.11
7	gb\|AE017355.1\| Bacillus thuringiensis serovar konkukian str. 97-...	44	0.45
8	gb\|AE017334.2\| Bacillus anthracis str. 'Ames Ancestor', complete...	44	0.45
9	gb\|AE017225.1\| Bacillus anthracis str. Sterne, complete genome	44	0.45
10	gb\|AC159139.9\| Mus musculus 10 BAC RP24-370M23 (Roswell Park Can...	44	0.45
11	gb\|CP000001.1\| Bacillus cereus E33L, complete genome	44	0.45
12	gb\|AE016879.1\| Bacillus anthracis str. Ames, complete genome	44	0.45
13	gb\|AE017194.1\| Bacillus cereus ATCC 10987, complete genome	44	0.45
14	gb\|AE010368.1\| Methanopyrus kandleri AV19 section 67 of 157 of t...	42	1.8
15	emb\|AL157831.29\| Human DNA sequence from clone RP11-108B14 on ch...	42	1.8
16	gb\|AC103691.2\| Homo sapiens chromosome 15, clone RP11-959H21, co...	42	1.8
17	gb\|AC013553.14\| Homo sapiens chromosome 15, clone RP11-325L12, c...	42	1.8
18	dbj\|BA000012.4\| Mesorhizobium loti MAFF303099 DNA, complete genome	42	1.8
19	gb\|BC105767.1\| Rattus norvegicus xylosyltransferase II, mRNA (cD...	40	7.0
20	ref\|NM_022296.2\| Rattus norvegicus xylosyltransferase II (Xylt2)...	40	7.0
21	gb\|AC124083.14\| Mus musculus chromosome 5, clone RP24-400H4, com...	40	7.0
22	gb\|AC105323.28\| Mus musculus chromosome 3, clone RP23-424L10, co...	40	7.0
23	gb\|AE013198.1\| Thermoanaerobacter tengcongensis MB4, section 225...	40	7.0
24	ref\|XM_420162.1\| PREDICTED: Gallus gallus similar to Oligophreni...	40	7.0
25	gb\|AC146197.3\| Pan troglodytes BAC clone CH251-450H3 from Y, com...	40	7.0
26	gb\|AC111128.24\| Mus musculus chromosome 18, clone RP23-338I7, co...	40	7.0
27	gb\|AC132106.4\| Mus musculus BAC clone RP24-240D2 from chromosome...	40	7.0
28	emb\|CT009577.5\| Mouse DNA sequence from clone RP23-24C24 on chro...	40	7.0
29	gb\|AC112256.4\| Mus musculus BAC clone RP23-40C8 from 10, complet...	40	7.0
30	gb\|AC121576.2\| Mus musculus BAC clone RP23-244D21 from 18, compl...	40	7.0
31	gb\|AC146173.2\| Pan troglodytes BAC clone RP43-36F20 from 7, comp...	40	7.0
32	gb\|AC092098.3\| Homo sapiens BAC clone RP11-533K11 from 7, comple...	40	7.0
33	gb\|AC146290.1\| Pan troglodytes BAC clone CH251-549P23 from Y, co...	40	7.0
34	emb\|AL591604.6\| Human DNA sequence from clone RP11-356F4 on chro...	40	7.0
35	emb\|AL139133.8\| Human DNA sequence from clone RP11-185C19 on chr...	40	7.0
36	emb\|CR382123.1\| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	7.0
37	gb\|AC164579.5\| Mus musculus 6 BAC RP23-384P24 (Roswell Park Canc...	40	7.0
38	gb\|AC165442.1\| Mus musculus BAC clone RP23-164P21 from chromosom...	40	7.0
39	gb\|AC119840.12\| Mus musculus chromosome 3, clone RP24-112E5, com...	40	7.0
40	dbj\|BS000590.1\| Pan troglodytes chromosome Y clone:PTB-194A24, c...	40	7.0
41	emb\|BX548247.6\| Zebrafish DNA sequence from clone DKEY-177G18 in...	40	7.0
42	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	40	7.0
43	gb\|AC158662.7\| Mus musculus 6 BAC RP23-20K24 (Roswell Park Cance...	40	7.0
44	gb\|AC149092.6\| Pan troglodytes BAC clone CH251-553I6 from chromo...	40	7.0
45	gb\|AC161019.3\| Pan troglodytes BAC clone CH251-7O2 from chromoso...	40	7.0
46	gb\|AC155643.8\| Mus musculus 10 BAC RP24-132F13 (Roswell Park Can...	40	7.0
47	gb\|AC073057.6\| Homo sapiens BAC clone RP11-114G11 from 7, comple...	40	7.0
48	emb\|CR387771.1\| Gallus gallus finished cDNA, clone ChEST535m13	40	7.0
49	gb\|AC154736.2\| Mus musculus BAC clone RP24-389J14 from chromosom...	40	7.0
50	gb\|AC022209.4\|AC022209 Homo sapiens BAC clone RP11-588M21 from 1...	40	7.0
51	gb\|AC158623.5\| Mus musculus 10 BAC RP23-302A11 (Roswell Park Can...	40	7.0
52	emb\|BX005167.12\| Mouse DNA sequence from clone RP23-247K19 on ch...	40	7.0
53	gb\|AC126415.9\| Mus musculus chromosome 5, clone RP24-476K21, com...	40	7.0
54	gb\|AC010726.4\|AC010726 Homo sapiens BAC clone RP11-224C16 from Y...	40	7.0
55	gb\|AC015799.23\| Homo sapiens chromosome 17, clone RP11-135N5, co...	40	7.0
56	emb\|BX000536.7\| Zebrafish DNA sequence from clone CH211-10C6 in ...	40	7.0
57	emb\|AJ969201.2\| Helicobacter pullorum partial gyrB gene for gyra...	40	7.0
58	emb\|CR847514.13\| Zebrafish DNA sequence from clone DKEYP-11D6 in...	40	7.0
59	emb\|AJ295749.2\|RNO295749 Rattus norvegicus mRNA for xylosyltrans...	40	7.0
60	gb\|AC148935.6\| Pan troglodytes BAC clone CH251-485J2 from chromo...	40	7.0
61	gb\|AC132603.4\| Mus musculus BAC clone RP24-66C10 from 1, complet...	40	7.0
62	gb\|AC140402.2\| Mus musculus BAC clone RP24-90D2 from 10, complet...	40	7.0
63	gb\|AC137555.4\| Mus musculus BAC clone RP23-445B17 from 1, comple...	40	7.0
64	gb\|AC118547.41\| Mus musculus strain C57BL/6J clone rp23-3g4 map ...	40	7.0

>dbj|AK121844.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033101G01, full
           insert sequence
          Length = 924

 Score =  113 bits (57), Expect = 6e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 372 acaataggagagtccactgcaaagtatttagtagtacagtgaaccttgccaccaatcacc 431
           |||| ||||||| || |||||||||| |||||| || |||||||||||||||||||||||
Sbjct: 684 acaaaaggagagccctctgcaaagtacttagtaatagagtgaaccttgccaccaatcacc 625

                                
Query: 432 tctggtagccagggagccatc 452
           |||||||||||||||||||||
Sbjct: 624 tctggtagccagggagccatc 604

to top

>gb|AC111016.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_D06,
            complete sequence
          Length = 145323

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                   
Query: 414  accttgccaccaatcacctctggtagccagggagccatc 452
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 3156 accttgccaccaatcacctctggtagccagggagccatc 3194

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                       
Query: 414      accttgccaccaatcacctctggtagccagggagccatc 452
                |||||||||||||||||||||||||||||||||||||||
Sbjct: 22159891 accttgccaccaatcacctctggtagccagggagccatc 22159929

to top

>gb|AC145574.5| Mus musculus BAC clone RP24-411C16 from chromosome 6, complete sequence
          Length = 147836

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 191   gggcaaacaaaagggaaatacatatatatgt 221
             ||||||||| |||||||||||| ||||||||
Sbjct: 49175 gggcaaacagaagggaaatacagatatatgt 49205

to top

>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox
             cluster, cholinesterase, and COLP5alpha genes, complete
             sequence
          Length = 796348

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 294   cttcttctttttatgcctgatga 316
             |||||||||||||||||||||||
Sbjct: 81631 cttcttctttttatgcctgatga 81609

to top

>gb|AC174081.1| Mus musculus BAC clone RP24-376P15 from chromosome 6, complete sequence
          Length = 153392

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 191    gggcaaacaaaagggaaatacatatatatgt 221
              ||||||||| |||||||||||| ||||||||
Sbjct: 130419 gggcaaacagaagggaaatacagatatatgt 130449

to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1624461 aaacaaaagggaaatacatata 1624440

to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1595401 aaacaaaagggaaatacatata 1595380

to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1595353 aaacaaaagggaaatacatata 1595332

to top

>gb|AC159139.9| Mus musculus 10 BAC RP24-370M23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 185202

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    atacatatatatgtctacatct 229
              ||||||||||||||||||||||
Sbjct: 150063 atacatatatatgtctacatct 150042

to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1621516 aaacaaaagggaaatacatata 1621495

to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1595278 aaacaaaagggaaatacatata 1595257

to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 195     aaacaaaagggaaatacatata 216
               ||||||||||||||||||||||
Sbjct: 1720668 aaacaaaagggaaatacatata 1720647

to top

>gb|AE010368.1| Methanopyrus kandleri AV19 section 67 of 157 of the complete genome
          Length = 12015

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 335  cctaccagctcgacctgctcc 355
            |||||||||||||||||||||
Sbjct: 7778 cctaccagctcgacctgctcc 7758

to top

>emb|AL157831.29| Human DNA sequence from clone RP11-108B14 on chromosome 10 Contains a
             ribosomal protein L29 (RPL29)(HIP,HUMRPL29) pseudogene, a
             CGI-45 protein (CGI-45) pseudogene, a novel pseudogene, a
             pseudogene similar to part of PSME2
             (PA28B,REGbeta,PA28beta) (proteasome (prosome, macropain)
             activator subunit 2 (PA28 beta)) and a CpG island,
             complete sequence
          Length = 176577

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    aaggatacataaagcatgcag 78
             |||||||||||||||||||||
Sbjct: 33741 aaggatacataaagcatgcag 33761

to top

>gb|AC103691.2| Homo sapiens chromosome 15, clone RP11-959H21, complete sequence
          Length = 82781

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 199   aaaagggaaatacatatatat 219
             |||||||||||||||||||||
Sbjct: 74475 aaaagggaaatacatatatat 74495

to top

>gb|AC013553.14| Homo sapiens chromosome 15, clone RP11-325L12, complete sequence
          Length = 184864

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 199   aaaagggaaatacatatatat 219
             |||||||||||||||||||||
Sbjct: 12999 aaaagggaaatacatatatat 13019

to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 283     ccccactatgacttcttcttt 303
               |||||||||||||||||||||
Sbjct: 3720250 ccccactatgacttcttcttt 3720270

to top

>gb|BC105767.1| Rattus norvegicus xylosyltransferase II, mRNA (cDNA clone MGC:124608
            IMAGE:7930580), complete cds
          Length = 3375

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 430  cctctggtagccagggagcc 449
            ||||||||||||||||||||
Sbjct: 3127 cctctggtagccagggagcc 3146

to top

>ref|NM_022296.2| Rattus norvegicus xylosyltransferase II (Xylt2), mRNA
          Length = 3375

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 430  cctctggtagccagggagcc 449
            ||||||||||||||||||||
Sbjct: 3127 cctctggtagccagggagcc 3146

to top

>gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, complete sequence
          Length = 172336

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 393    aagtatttagtagtacagtgaacc 416
              |||||||||| |||||||||||||
Sbjct: 154461 aagtatttagaagtacagtgaacc 154484

to top

>gb|AC105323.28| Mus musculus chromosome 3, clone RP23-424L10, complete sequence
          Length = 183897

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   aaagggaaatacatatatat 219
             ||||||||||||||||||||
Sbjct: 71983 aaagggaaatacatatatat 72002

to top

>gb|AE013198.1| Thermoanaerobacter tengcongensis MB4, section 225 of 244 of the
            complete genome
          Length = 10429

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  gctcctttttattccttgtt 370
            ||||||||||||||||||||
Sbjct: 4811 gctcctttttattccttgtt 4830

to top

>ref|XM_420162.1| PREDICTED: Gallus gallus similar to Oligophrenin 1 (LOC422163), mRNA
          Length = 1928

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 136  tttgctgctgccctgccagtccca 159
            ||||||||||||||||||| ||||
Sbjct: 1412 tttgctgctgccctgccagcccca 1389

to top

>gb|AC146197.3| Pan troglodytes BAC clone CH251-450H3 from Y, complete sequence
          Length = 182113

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    tacatatatatgtctacatc 228
              ||||||||||||||||||||
Sbjct: 166273 tacatatatatgtctacatc 166292

to top

>gb|AC111128.24| Mus musculus chromosome 18, clone RP23-338I7, complete sequence
          Length = 209784

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 197   acaaaagggaaatacatatatatg 220
             |||||||||||||| |||||||||
Sbjct: 28576 acaaaagggaaatatatatatatg 28599

to top

>gb|AC132106.4| Mus musculus BAC clone RP24-240D2 from chromosome 17, complete sequence
          Length = 169722

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   atacatatatatgtctacat 227
             ||||||||||||||||||||
Sbjct: 58248 atacatatatatgtctacat 58267

to top

>emb|CT009577.5| Mouse DNA sequence from clone RP23-24C24 on chromosome 16, complete
              sequence
          Length = 258862

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    agtcccattacacttcagca 172
              ||||||||||||||||||||
Sbjct: 205688 agtcccattacacttcagca 205669

to top

>gb|AC112256.4| Mus musculus BAC clone RP23-40C8 from 10, complete sequence
          Length = 157928

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 126583 atacatatatatgtctacat 126564

to top

>gb|AC121576.2| Mus musculus BAC clone RP23-244D21 from 18, complete sequence
          Length = 158243

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 197   acaaaagggaaatacatatatatg 220
             |||||||||||||| |||||||||
Sbjct: 21887 acaaaagggaaatatatatatatg 21864

to top

>gb|AC146173.2| Pan troglodytes BAC clone RP43-36F20 from 7, complete sequence
          Length = 197121

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 198   caaaagggaaatacatatatatgt 221
             |||||||||| |||||||||||||
Sbjct: 40075 caaaagggaattacatatatatgt 40098

to top

>gb|AC092098.3| Homo sapiens BAC clone RP11-533K11 from 7, complete sequence
          Length = 198786

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 198    caaaagggaaatacatatatatgt 221
              |||||||||| |||||||||||||
Sbjct: 104749 caaaagggaattacatatatatgt 104772

to top

>gb|AC146290.1| Pan troglodytes BAC clone CH251-549P23 from Y, complete sequence
          Length = 176345

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tacatatatatgtctacatc 228
             ||||||||||||||||||||
Sbjct: 95967 tacatatatatgtctacatc 95986

to top

>emb|AL591604.6| Human DNA sequence from clone RP11-356F4 on chromosome 1 Contains the 5'
              end of the SLICK gene for a sodium- and chloride-activated
              ATP-sensitive potassium channel, complete sequence
          Length = 185560

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 205    gaaatacatatatatgtcta 224
              ||||||||||||||||||||
Sbjct: 154498 gaaatacatatatatgtcta 154517

to top

>emb|AL139133.8| Human DNA sequence from clone RP11-185C19 on chromosome 1q31.1-31.3
            Contains the 3' end of the HRPT2 gene for
            hyperparathyroidism 2 (with jaw tumor), complete sequence
          Length = 19720

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 386  cactgcaaagtatttagtag 405
            ||||||||||||||||||||
Sbjct: 6289 cactgcaaagtatttagtag 6270

to top

>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1753957

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 174    tcaaatcaggtaacatagggcaaa 197
              ||||||||||||||||||| ||||
Sbjct: 205968 tcaaatcaggtaacataggccaaa 205991

to top

>gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 214578

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 413    aaccttgccaccaatcacct 432
              ||||||||||||||||||||
Sbjct: 169230 aaccttgccaccaatcacct 169249

to top

>gb|AC165442.1| Mus musculus BAC clone RP23-164P21 from chromosome 10, complete
             sequence
          Length = 209583

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   atacatatatatgtctacat 227
             ||||||||||||||||||||
Sbjct: 42345 atacatatatatgtctacat 42326

to top

>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence
          Length = 206159

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    aaagggaaatacatatatat 219
              ||||||||||||||||||||
Sbjct: 205625 aaagggaaatacatatatat 205644

to top

>dbj|BS000590.1| Pan troglodytes chromosome Y clone:PTB-194A24, complete sequence
          Length = 219969

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    tacatatatatgtctacatc 228
              ||||||||||||||||||||
Sbjct: 115385 tacatatatatgtctacatc 115404

to top

>emb|BX548247.6| Zebrafish DNA sequence from clone DKEY-177G18 in linkage group 23,
             complete sequence
          Length = 180406

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    aaatattcctaaaacacacc 51
             ||||||||||||||||||||
Sbjct: 96678 aaatattcctaaaacacacc 96659

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 209      tacatatatatgtctacatc 228
                ||||||||||||||||||||
Sbjct: 20843615 tacatatatatgtctacatc 20843596

to top

>gb|AC158662.7| Mus musculus 6 BAC RP23-20K24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 250218

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 413   aaccttgccaccaatcacct 432
             ||||||||||||||||||||
Sbjct: 97913 aaccttgccaccaatcacct 97932

to top

>gb|AC149092.6| Pan troglodytes BAC clone CH251-553I6 from chromosome 7, complete
             sequence
          Length = 194702

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   aaagggaaatacatatatat 219
             ||||||||||||||||||||
Sbjct: 73251 aaagggaaatacatatatat 73270

to top

>gb|AC161019.3| Pan troglodytes BAC clone CH251-7O2 from chromosome 7, complete
             sequence
          Length = 165769

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 200   aaagggaaatacatatatat 219
             ||||||||||||||||||||
Sbjct: 62235 aaagggaaatacatatatat 62216

to top

>gb|AC155643.8| Mus musculus 10 BAC RP24-132F13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 187480

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 143501 atacatatatatgtctacat 143482

to top

>gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, complete sequence
          Length = 178105

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 200    aaagggaaatacatatatat 219
              ||||||||||||||||||||
Sbjct: 163652 aaagggaaatacatatatat 163633

to top

>emb|CR387771.1| Gallus gallus finished cDNA, clone ChEST535m13
          Length = 1425

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 136 tttgctgctgccctgccagtccca 159
           ||||||||||||||||||| ||||
Sbjct: 889 tttgctgctgccctgccagcccca 866

to top

>gb|AC154736.2| Mus musculus BAC clone RP24-389J14 from chromosome 16, complete sequence
          Length = 141092

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    agtcccattacacttcagca 172
              ||||||||||||||||||||
Sbjct: 128605 agtcccattacacttcagca 128586

to top

>gb|AC022209.4|AC022209 Homo sapiens BAC clone RP11-588M21 from 11, complete sequence
          Length = 177314

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 205   gaaatacatatatatgtcta 224
             ||||||||||||||||||||
Sbjct: 76956 gaaatacatatatatgtcta 76975

to top

>gb|AC158623.5| Mus musculus 10 BAC RP23-302A11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 191932

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 112899 atacatatatatgtctacat 112918

to top

>emb|BX005167.12| Mouse DNA sequence from clone RP23-247K19 on chromosome X, complete
              sequence
          Length = 212046

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 176469 atacatatatatgtctacat 176488

to top

>gb|AC126415.9| Mus musculus chromosome 5, clone RP24-476K21, complete sequence
          Length = 168525

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 393   aagtatttagtagtacagtgaacc 416
             |||||||||| |||||||||||||
Sbjct: 42697 aagtatttagaagtacagtgaacc 42720

to top

>gb|AC010726.4|AC010726 Homo sapiens BAC clone RP11-224C16 from Y, complete sequence
          Length = 176524

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    tacatatatatgtctacatc 228
              ||||||||||||||||||||
Sbjct: 160407 tacatatatatgtctacatc 160426

to top

>gb|AC015799.23| Homo sapiens chromosome 17, clone RP11-135N5, complete sequence
          Length = 180157

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 190   agggcaaacaaaagggaaatacat 213
             |||| |||||||||||||||||||
Sbjct: 89881 agggaaaacaaaagggaaatacat 89858

to top

>emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in linkage group 7,
             complete sequence
          Length = 199752

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   tgtcaactctacagcctacc 340
             ||||||||||||||||||||
Sbjct: 80725 tgtcaactctacagcctacc 80706

to top

>emb|AJ969201.2| Helicobacter pullorum partial gyrB gene for gyrase B, strain CCUG
           33842
          Length = 1098

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 190 agggcaaacaaaagggaaat 209
           ||||||||||||||||||||
Sbjct: 651 agggcaaacaaaagggaaat 670

to top

>emb|CR847514.13| Zebrafish DNA sequence from clone DKEYP-11D6 in linkage group 3, complete
              sequence
          Length = 165569

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    ctgatgactcatgtcaactc 329
              ||||||||||||||||||||
Sbjct: 102510 ctgatgactcatgtcaactc 102529

to top

>emb|AJ295749.2|RNO295749 Rattus norvegicus mRNA for xylosyltransferase II (XT-II gene)
          Length = 2806

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 430  cctctggtagccagggagcc 449
            ||||||||||||||||||||
Sbjct: 2669 cctctggtagccagggagcc 2688

to top

>gb|AC148935.6| Pan troglodytes BAC clone CH251-485J2 from chromosome 7, complete
             sequence
          Length = 215177

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   aaagggaaatacatatatat 219
             ||||||||||||||||||||
Sbjct: 84910 aaagggaaatacatatatat 84929

to top

>gb|AC132603.4| Mus musculus BAC clone RP24-66C10 from 1, complete sequence
          Length = 218575

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 58    aaggatacataaagcatgcagcaa 81
             ||||||||||||||| ||||||||
Sbjct: 19985 aaggatacataaagcctgcagcaa 20008

to top

>gb|AC140402.2| Mus musculus BAC clone RP24-90D2 from 10, complete sequence
          Length = 237935

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 220732 atacatatatatgtctacat 220713

to top

>gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, complete sequence
          Length = 174607

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 58     aaggatacataaagcatgcagcaa 81
              ||||||||||||||| ||||||||
Sbjct: 135151 aaggatacataaagcctgcagcaa 135174

to top

>gb|AC118547.41| Mus musculus strain C57BL/6J clone rp23-3g4 map 17, complete sequence
          Length = 234061

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    atacatatatatgtctacat 227
              ||||||||||||||||||||
Sbjct: 180014 atacatatatatgtctacat 180033


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,597,206
Number of Sequences: 3902068
Number of extensions: 5597206
Number of successful extensions: 137835
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 137277
Number of HSP's gapped (non-prelim): 558
length of query: 519
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 496
effective length of database: 17,143,297,704
effective search space: 8503075661184
effective search space used: 8503075661184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result