ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23o09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK062354.1| Oryza sativa (japonica cultivar-group) cDNA clon... 444 e-121
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 287 2e-74
3dbj|AP005453.1| Oryza sativa (japonica cultivar-group) genomic D... 287 2e-74
4dbj|AK099513.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 4e-63
5gb|AY090541.1| Deschampsia antarctica clone Dacor 1.0 polyubiqui... 246 6e-62
6ref|NM_102873.3| Arabidopsis thaliana RUB1 (RELATED TO UBIQUITIN... 214 2e-52
7gb|BT006110.1| Arabidopsis thaliana clone U50103 putative ubiqui... 214 2e-52
8gb|BT005749.1| Arabidopsis thaliana clone RAFL15-38-H20 (R50103)... 214 2e-52
9gb|AY104764.1| Zea mays PCO108118 mRNA sequence 210 3e-51
10ref|NM_129118.3| Arabidopsis thaliana UBQ7 AT2G35635 (UBQ7) mRNA... 188 1e-44
11gb|AY093802.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, com... 188 1e-44
12gb|AY074850.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, com... 188 1e-44
13dbj|AK118678.1| Arabidopsis thaliana mRNA for ubiquitin-like pro... 188 1e-44
14gb|AC007654.2|AC007654 Genomic sequence for Arabidopsis thaliana... 163 6e-37
15gb|AC006068.4| Arabidopsis thaliana chromosome 2 clone T20F21 ma... 161 3e-36
16gb|L05364.1|ATHUBQ7G Arabidopsis thaliana polyubiquitin (ubq7) g... 161 3e-36
17dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
18dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
19dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
20gb|AF240445.1|AF240445 Populus tremula x Populus tremuloides pol... 147 4e-32
21gb|AF297089.1|AF297089 Coffea arabica ubiquitin-like protein UBI... 113 5e-22
22emb|AJ270957.1|LES270957 Lycopersicon esculentum partial mRNA fo... 78 3e-11
23dbj|AB240583.1| Physcomitrella patens ubq1 mRNA for putative pol... 74 5e-10
24ref|NM_102190.2| Arabidopsis thaliana protein binding / structur... 72 2e-09
25gb|BT024763.1| Arabidopsis thaliana At1g23410 mRNA, complete cds 72 2e-09
26gb|AY085389.1| Arabidopsis thaliana clone 1496 mRNA, complete se... 72 2e-09
27gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana... 72 2e-09
28gb|AC007945.3|AC007945 Genomic sequence for Arabidopsis thaliana... 72 2e-09
29dbj|AB240584.1| Physcomitrella patens ubq1 gene for putative pol... 70 7e-09
30gb|AY389656.1| Hyacinthus orientalis ubiquitin fusion protein UB... 68 3e-08
31emb|X17020.1|PISUMPUI Pea PU1 gene mRNA for polyubiquitin 68 3e-08
32gb|L81140.1| Pisum sativum (Alaska) ubiquitin (PUB2) gene, compl... 68 3e-08
33gb|L81139.1| Pisum sativum (Alaska) ubiquitin (PUB1) gene, compl... 62 2e-06
34emb|X66876.1|AOPOLUBI A.officinalis mRNA for poly-ubiquitin 62 2e-06
35gb|AC170154.2| Phakopsora pachyrhizi clone JGIAFNA-1965K4, compl... 60 7e-06
36ref|XM_780079.1| PREDICTED: Strongylocentrotus purpuratus simila... 60 7e-06
37emb|X77456.1|NTUBIU4 N.tabacum Ubi.U4 gene 60 7e-06
38emb|AJ841743.1| Plantago major ubi1 gene for ubiquitin 60 7e-06
39emb|AJ844617.1| Plantago major mRNA for polyubiquitin (ubq3 gene) 60 7e-06
40gb|L81142.1| Pisum sativum (Alaska) ubuquitin (PUB4) gene, compl... 60 7e-06
41gb|L81141.1| Pisum sativum (Alaska) ubiquitin (PUB3) gene, compl... 60 7e-06
42gb|DQ011576.1| Euphorbia characias polyubiquitin mRNA, partial cds 60 7e-06
43gb|AC158180.2| Selaginella moellendorffii chromosome JGIASXY-5A1... 60 7e-06
44gb|AC170150.2| Phakopsora pachyrhizi clone JGIAFNA-1237E23, comp... 60 7e-06
45gb|BC074652.1| Xenopus tropicalis ubiquitin C, mRNA (cDNA clone ... 58 3e-05
46emb|CT025321.2| Xenopus tropicalis finished cDNA, clone TNeu128o12 58 3e-05
47gb|AY057500.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, co... 58 3e-05
48ref|NM_001006687.1| Xenopus tropicalis ubiquitin C (ubc), mRNA 58 3e-05
49emb|CR848533.2| Xenopus tropicalis finished cDNA, clone TEgg052p01 58 3e-05
50gb|BT012724.1| Lycopersicon esculentum clone 113652F, mRNA sequence 56 1e-04
51gb|BT012698.1| Lycopersicon esculentum clone 113569R, mRNA sequence 56 1e-04
52emb|Y10639.1|CCPOLYUBQ C.capitata gene encoding polyubiquitin, p... 56 1e-04
53ref|NM_171868.3| Caenorhabditis elegans UBiQuitin family member ... 56 1e-04
54ref|NM_171139.3| Caenorhabditis elegans UBiQuitin family member ... 56 1e-04
55gb|AF148448.1|AF148448 Sporobolus stapfianus polyubiquitin mRNA,... 56 1e-04
56gb|AY452186.1| Plasmodiophora brassicae polyubiquitin 5 gene, pa... 54 4e-04
57gb|AF481059.1| Aplysia californica ubiquitin/ribosomal L40 fusio... 54 4e-04
58emb|Z28649.1|ACPOLUB Acetabularia cliftonii gene for polyubiquitin 54 4e-04
59emb|X67957.1|AMUBIQMRP A.majus mRNA for ubiquitin (partial) 54 4e-04
60gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-6... 54 4e-04
61gb|BC102306.1| Bos taurus neural precursor cell expressed, devel... 54 4e-04
62gb|AF227256.1|AF227256 Bos taurus NEDD8 mRNA, complete cds 54 4e-04
63gb|AF227253.1|AF227253 Bovine viral diarrhea virus-1 strain CP82... 54 4e-04
64ref|NM_174764.3| Bos taurus neural precursor cell expressed, dev... 54 4e-04
65gb|M74156.1|TOBUBI4A Nicotiana sylvestris (clone 6PU4) pentameri... 54 4e-04
66gb|AY684128.2| Vitis vinifera polyubiquitin mRNA, partial cds 52 0.002
67gb|AY496112.1| Capsicum annuum hexameric polyubiquitin 6PU11 (ub... 52 0.002
68ref|XM_537389.2| PREDICTED: Canis familiaris similar to neural p... 52 0.002
69emb|X64344.1|PCCUBI41 P.crispum mRNA Pcubi4-1 for polyubiquitin 52 0.002
70emb|AJ223330.1|NTAJ3330 Nicotiana tabacum TUQG4 gene, complete CDS 52 0.002
71dbj|D26092.1|SOYSUBI2 Glycine max SUBI-2 gene for ubiquitin, com... 52 0.002
72ref|NM_111814.1| Arabidopsis thaliana UBQ8 AT3G09790 (UBQ8) mRNA... 50 0.007
73gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BA... 50 0.007
74emb|AL450063.14| Human DNA sequence from clone RP11-82H13 on chr... 50 0.007
75emb|AJ223329.1|NTAJ3329 Nicotiana tabacum TUQG3 gene, complete CDS 50 0.007
76ref|XM_936308.1| PREDICTED: Homo sapiens hypothetical protein LO... 50 0.007
77ref|XM_929535.1| PREDICTED: Homo sapiens hypothetical protein LO... 50 0.007
78gb|DQ067448.1| Oryctolagus cuniculus nedd8 mRNA, complete cds 50 0.007
79gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11... 50 0.007
80ref|NM_001009202.1| Ovis aries polyubiquitin (LOC443016), mRNA 50 0.007
81gb|AF038129.1|AF038129 Ovis aries polyubiquitin mRNA, complete cds 50 0.007
82dbj|AB182939.1| Populus nigra PnUB1 mRNA for polyubiquitin, comp... 50 0.007
83gb|AY288520.1| Heterodera schachtii ubiquitin extension protein ... 50 0.007
84gb|U84967.1|ATU84967 Arabidopsis thaliana ubiquitin (UBQ11) gene... 50 0.007
85gb|L05917.1|ATHUBQ8G Arabidopsis thaliana polyubiquitin (ubq8) g... 50 0.007
86gb|M23433.1|CELUBIA C.elegans polyubiquitin (UbiA) gene, complet... 50 0.007
87gb|AY748813.1| Cercomonas agilis polyubiquitin (UBQ) gene, parti... 50 0.007
88gb|DQ226839.1| Boechera divaricarpa isolate SLW-C-B11 mRNA sequence 48 0.026
89gb|BT012977.1| Lycopersicon esculentum clone 114188F, mRNA sequence 48 0.026
90gb|AY456195.1| Helicoverpa armigera ubiquitin mRNA, partial cds 48 0.026
91gb|AC125059.4| Mus musculus BAC clone RP23-404P13 from chromosom... 48 0.026
92ref|XM_726244.1| Plasmodium yoelii yoelii str. 17XNL ubiquitin (... 48 0.026
93gb|AF429429.1|AF429429 Olea europaea polyubiquitin OUB1 mRNA, co... 48 0.026
94dbj|AB070526.1| Physarum polycephalum ub2 mRNA for ubiquitin 2, ... 48 0.026
95gb|AY117058.1| Gossypium barbadense D-subgenome putative polyubi... 48 0.026
96gb|AY117056.1| Gossypium raimondii putative polyubiquitin gene, ... 48 0.026
97gb|AY930681.1| Rhagoletis electromorpha isolate Relect12 locus P... 48 0.026
98gb|AY930679.1| Rhagoletis electromorpha isolate Relect8 locus P3... 48 0.026
99gb|AY930676.1| Rhagoletis electromorpha isolate Relect3 locus P3... 48 0.026
100gb|AY930674.1| Rhagoletis pomonella isolate TX15 locus P309 geno... 48 0.026
101gb|AY930673.1| Rhagoletis pomonella isolate TX13 locus P309 geno... 48 0.026
102gb|AY930672.1| Rhagoletis pomonella isolate MIHaw10 locus P309 g... 48 0.026
103gb|AY930671.1| Rhagoletis pomonella isolate MIHaw9 locus P309 ge... 48 0.026
104gb|AY930670.1| Rhagoletis pomonella isolate MIHaw8 locus P309 ge... 48 0.026
105gb|AY930669.1| Rhagoletis pomonella isolate MIHaw6 locus P309 ge... 48 0.026
106gb|AY930668.1| Rhagoletis pomonella isolate MIHaw5 locus P309 ge... 48 0.026
107gb|AY930667.1| Rhagoletis pomonella isolate MIHaw4 locus P309 ge... 48 0.026
108gb|AY930666.1| Rhagoletis pomonella isolate MIHaw3 locus P309 ge... 48 0.026
109gb|AY930658.1| Rhagoletis pomonella isolate NY12 locus P309 geno... 48 0.026
110gb|AY930657.1| Rhagoletis pomonella isolate NY6 locus P309 genom... 48 0.026
111gb|AY930656.1| Rhagoletis pomonella isolate NY5 locus P309 genom... 48 0.026
112gb|AY930655.1| Rhagoletis pomonella isolate NY2 locus P309 genom... 48 0.026
113gb|AY930654.1| Rhagoletis pomonella isolate CJ8 locus P309 genom... 48 0.026
114gb|AY930653.1| Rhagoletis pomonella isolate CJ7 locus P309 genom... 48 0.026
115gb|AY930652.1| Rhagoletis pomonella isolate CJ6 locus P309 genom... 48 0.026
116gb|AY930651.1| Rhagoletis pomonella isolate CJ5 locus P309 genom... 48 0.026
117gb|AY930650.1| Rhagoletis pomonella isolate CJ4 locus P309 genom... 48 0.026
118gb|AY930649.1| Rhagoletis pomonella isolate CJ3 locus P309 genom... 48 0.026
119gb|AY930648.1| Rhagoletis pomonella isolate CJ2 locus P309 genom... 48 0.026
120gb|AY930646.1| Rhagoletis pomonella isolate MC8 locus P309 genom... 48 0.026
121gb|AY930645.1| Rhagoletis pomonella isolate MC7 locus P309 genom... 48 0.026
122gb|AY930644.1| Rhagoletis pomonella isolate MC6 locus P309 genom... 48 0.026
123gb|AY930643.1| Rhagoletis pomonella isolate MC5 locus P309 genom... 48 0.026
124gb|AY930642.1| Rhagoletis pomonella isolate MC4 locus P309 genom... 48 0.026
125gb|AY930641.1| Rhagoletis pomonella isolate MC3 locus P309 genom... 48 0.026
126gb|AY930640.1| Rhagoletis pomonella isolate MC2 locus P309 genom... 48 0.026
127gb|AY930639.1| Rhagoletis pomonella isolate MC1 locus P309 genom... 48 0.026
128gb|U26831.1|STU26831 Solanum tuberosum polyubiquitin gene, promo... 48 0.026
129gb|U03703.1|ABU03703 Ammonia beccarii ubiquitin gene, partial cds 48 0.026
130dbj|AB045756.1| Physarum polycephalum ppub2 mRNA for polyubiquit... 48 0.026
131gb|AF253517.1| Biomphalaria glabrata ubiquitin mRNA, complete cds 46 0.10
132gb|AF268491.1| Biomphalaria glabrata strain 13-16-R1 ubiquitin m... 46 0.10
133gb|AF268492.1| Biomphalaria glabrata strain NMRI ubiquitin mRNA,... 46 0.10
134gb|BC104201.1| Homo sapiens neural precursor cell expressed, dev... 46 0.10
135gb|BC104664.1| Homo sapiens neural precursor cell expressed, dev... 46 0.10
136gb|BC104200.1| Homo sapiens neural precursor cell expressed, dev... 46 0.10
137ref|XM_755610.1| Ustilago maydis 521 hypothetical protein (UM045... 46 0.10
138emb|CR663707.2|CNS0FB35 Tetraodon nigroviridis full-length cDNA 46 0.10
139emb|CR732773.2|CNS0GSCI Tetraodon nigroviridis full-length cDNA 46 0.10
140emb|CR712162.2|CNS0GCGE Tetraodon nigroviridis full-length cDNA 46 0.10
141emb|CR720164.2|CNS0GIMI Tetraodon nigroviridis full-length cDNA 46 0.10
142emb|CR723131.2|CNS0GKWX Tetraodon nigroviridis full-length cDNA 46 0.10
143emb|CR722974.2|CNS0GKSK Tetraodon nigroviridis full-length cDNA 46 0.10
144emb|CR722853.2|CNS0GKP7 Tetraodon nigroviridis full-length cDNA 46 0.10
145emb|CR722615.2|CNS0GKIL Tetraodon nigroviridis full-length cDNA 46 0.10
146emb|CR722276.2|CNS0GK96 Tetraodon nigroviridis full-length cDNA 46 0.10
147emb|CR722104.2|CNS0GK4E Tetraodon nigroviridis full-length cDNA 46 0.10
148emb|CR722086.2|CNS0GK3W Tetraodon nigroviridis full-length cDNA 46 0.10
149emb|CR721324.2|CNS0GJIQ Tetraodon nigroviridis full-length cDNA 46 0.10
150emb|CR720859.2|CNS0GJ5T Tetraodon nigroviridis full-length cDNA 46 0.10
151emb|CR719571.2|CNS0GI61 Tetraodon nigroviridis full-length cDNA 46 0.10
152emb|CR719270.2|CNS0GHXO Tetraodon nigroviridis full-length cDNA 46 0.10
153emb|CR719156.2|CNS0GHUI Tetraodon nigroviridis full-length cDNA 46 0.10
154emb|CR718539.2|CNS0GHDD Tetraodon nigroviridis full-length cDNA 46 0.10
155emb|CR718156.2|CNS0GH2Q Tetraodon nigroviridis full-length cDNA 46 0.10
156emb|CR718025.2|CNS0GGZ3 Tetraodon nigroviridis full-length cDNA 46 0.10
157emb|CR717822.2|CNS0GGTG Tetraodon nigroviridis full-length cDNA 46 0.10
158emb|CR717655.2|CNS0GGOT Tetraodon nigroviridis full-length cDNA 46 0.10
159emb|CR717482.2|CNS0GGK0 Tetraodon nigroviridis full-length cDNA 46 0.10
160emb|CR717388.2|CNS0GGHE Tetraodon nigroviridis full-length cDNA 46 0.10
161emb|CR717212.2|CNS0GGCL Tetraodon nigroviridis full-length cDNA 46 0.10
162emb|CR717188.2|CNS0GGBX Tetraodon nigroviridis full-length cDNA 46 0.10
163emb|CR717112.2|CNS0GG9T Tetraodon nigroviridis full-length cDNA 46 0.10
164emb|CR717034.2|CNS0GG7N Tetraodon nigroviridis full-length cDNA 46 0.10
165emb|CR716741.2|CNS0GFZI Tetraodon nigroviridis full-length cDNA 46 0.10
166emb|CR716666.2|CNS0GFXF Tetraodon nigroviridis full-length cDNA 46 0.10
167emb|CR716451.2|CNS0GFRG Tetraodon nigroviridis full-length cDNA 46 0.10
168emb|CR716373.2|CNS0GFPA Tetraodon nigroviridis full-length cDNA 46 0.10
169emb|CR716303.2|CNS0GFNC Tetraodon nigroviridis full-length cDNA 46 0.10
170emb|CR716061.2|CNS0GFGP Tetraodon nigroviridis full-length cDNA 46 0.10
171emb|CR715961.2|CNS0GFDX Tetraodon nigroviridis full-length cDNA 46 0.10
172emb|CR715868.2|CNS0GFBC Tetraodon nigroviridis full-length cDNA 46 0.10
173emb|CR715716.2|CNS0GF74 Tetraodon nigroviridis full-length cDNA 46 0.10
174emb|CR715670.2|CNS0GF5U Tetraodon nigroviridis full-length cDNA 46 0.10
175emb|CR714709.2|CNS0GEF5 Tetraodon nigroviridis full-length cDNA 46 0.10
176emb|CR711481.2|CNS0GBXH Tetraodon nigroviridis full-length cDNA 46 0.10
177emb|CR714625.2|CNS0GECT Tetraodon nigroviridis full-length cDNA 46 0.10
178emb|CR714267.2|CNS0GE2V Tetraodon nigroviridis full-length cDNA 46 0.10
179emb|CR712553.2|CNS0GCR9 Tetraodon nigroviridis full-length cDNA 46 0.10
180emb|CR712361.2|CNS0GCLX Tetraodon nigroviridis full-length cDNA 46 0.10
181emb|CR714032.2|CNS0GDWC Tetraodon nigroviridis full-length cDNA 46 0.10
182emb|CR713568.2|CNS0GDJG Tetraodon nigroviridis full-length cDNA 46 0.10
183emb|CR713553.2|CNS0GDJ1 Tetraodon nigroviridis full-length cDNA 46 0.10
184emb|CR713492.2|CNS0GDHC Tetraodon nigroviridis full-length cDNA 46 0.10
185emb|CR713372.2|CNS0GDE0 Tetraodon nigroviridis full-length cDNA 46 0.10
186emb|CR713156.2|CNS0GD80 Tetraodon nigroviridis full-length cDNA 46 0.10
187emb|CR712641.2|CNS0GCTP Tetraodon nigroviridis full-length cDNA 46 0.10
188emb|CR712106.2|CNS0GCEU Tetraodon nigroviridis full-length cDNA 46 0.10
189emb|CR711983.2|CNS0GCBF Tetraodon nigroviridis full-length cDNA 46 0.10
190emb|CR711300.2|CNS0GBSG Tetraodon nigroviridis full-length cDNA 46 0.10
191emb|CR711253.2|CNS0GBR5 Tetraodon nigroviridis full-length cDNA 46 0.10
192emb|CR711098.2|CNS0GBMU Tetraodon nigroviridis full-length cDNA 46 0.10
193emb|CR710670.2|CNS0GBAY Tetraodon nigroviridis full-length cDNA 46 0.10
194emb|CR710588.2|CNS0GB8O Tetraodon nigroviridis full-length cDNA 46 0.10
195emb|CR710002.2|CNS0GASE Tetraodon nigroviridis full-length cDNA 46 0.10
196emb|CR709772.2|CNS0GAM0 Tetraodon nigroviridis full-length cDNA 46 0.10
197emb|CR709398.2|CNS0GABM Tetraodon nigroviridis full-length cDNA 46 0.10
198emb|CR709287.2|CNS0GA8J Tetraodon nigroviridis full-length cDNA 46 0.10
199emb|CR709245.2|CNS0GA7D Tetraodon nigroviridis full-length cDNA 46 0.10
200emb|CR709475.2|CNS0GADR Tetraodon nigroviridis full-length cDNA 46 0.10
201emb|CR708941.2|CNS0G9YX Tetraodon nigroviridis full-length cDNA 46 0.10
202emb|CR708744.2|CNS0G9TG Tetraodon nigroviridis full-length cDNA 46 0.10
203emb|CR708483.2|CNS0G9M7 Tetraodon nigroviridis full-length cDNA 46 0.10
204ref|XM_858590.1| PREDICTED: Canis familiaris similar to ubiquiti... 46 0.10
205ref|XM_536651.2| PREDICTED: Canis familiaris similar to ubiquiti... 46 0.10
206ref|XM_858547.1| PREDICTED: Canis familiaris similar to ubiquiti... 46 0.10
207emb|CR708091.2|CNS0G9BB Tetraodon nigroviridis full-length cDNA 46 0.10
208emb|CR708014.2|CNS0G996 Tetraodon nigroviridis full-length cDNA 46 0.10
209emb|CR707958.2|CNS0G97M Tetraodon nigroviridis full-length cDNA 46 0.10
210emb|CR707556.2|CNS0G8WG Tetraodon nigroviridis full-length cDNA 46 0.10
211emb|CR707464.2|CNS0G8TW Tetraodon nigroviridis full-length cDNA 46 0.10
212emb|CR707461.2|CNS0G8TT Tetraodon nigroviridis full-length cDNA 46 0.10
213emb|CR707358.2|CNS0G8QY Tetraodon nigroviridis full-length cDNA 46 0.10
214emb|CR705976.2|CNS0G7OK Tetraodon nigroviridis full-length cDNA 46 0.10
215emb|CR707014.2|CNS0G8HE Tetraodon nigroviridis full-length cDNA 46 0.10
216emb|CR706909.2|CNS0G8EH Tetraodon nigroviridis full-length cDNA 46 0.10
217emb|CR706806.2|CNS0G8BM Tetraodon nigroviridis full-length cDNA 46 0.10
218emb|CR706732.2|CNS0G89K Tetraodon nigroviridis full-length cDNA 46 0.10
219emb|CR706705.2|CNS0G88T Tetraodon nigroviridis full-length cDNA 46 0.10
220emb|CR706640.2|CNS0G870 Tetraodon nigroviridis full-length cDNA 46 0.10
221emb|CR706607.2|CNS0G863 Tetraodon nigroviridis full-length cDNA 46 0.10
222emb|CR706282.2|CNS0G7X2 Tetraodon nigroviridis full-length cDNA 46 0.10
223emb|CR705715.2|CNS0G7HB Tetraodon nigroviridis full-length cDNA 46 0.10
224emb|CR705408.2|CNS0G78S Tetraodon nigroviridis full-length cDNA 46 0.10
225emb|CR705348.2|CNS0G774 Tetraodon nigroviridis full-length cDNA 46 0.10
226emb|CR705091.2|CNS0G6ZZ Tetraodon nigroviridis full-length cDNA 46 0.10
227emb|CR705082.2|CNS0G6ZQ Tetraodon nigroviridis full-length cDNA 46 0.10
228emb|CR704829.2|CNS0G6SP Tetraodon nigroviridis full-length cDNA 46 0.10
229emb|CR704554.2|CNS0G6L2 Tetraodon nigroviridis full-length cDNA 46 0.10
230emb|CR703692.2|CNS0G5X4 Tetraodon nigroviridis full-length cDNA 46 0.10
231emb|CR703659.2|CNS0G5W7 Tetraodon nigroviridis full-length cDNA 46 0.10
232emb|CR703300.2|CNS0G5M8 Tetraodon nigroviridis full-length cDNA 46 0.10
233emb|CR703020.2|CNS0G5EG Tetraodon nigroviridis full-length cDNA 46 0.10
234emb|CR702938.2|CNS0G5C6 Tetraodon nigroviridis full-length cDNA 46 0.10
235emb|CR702722.2|CNS0G566 Tetraodon nigroviridis full-length cDNA 46 0.10
236emb|CR701459.2|CNS0G473 Tetraodon nigroviridis full-length cDNA 46 0.10
237emb|CR701379.2|CNS0G44V Tetraodon nigroviridis full-length cDNA 46 0.10
238emb|CR700574.2|CNS0G3II Tetraodon nigroviridis full-length cDNA 46 0.10
239emb|CR700493.2|CNS0G3G9 Tetraodon nigroviridis full-length cDNA 46 0.10
240emb|CR699039.2|CNS0G2BV Tetraodon nigroviridis full-length cDNA 46 0.10
241emb|CR698685.2|CNS0G221 Tetraodon nigroviridis full-length cDNA 46 0.10
242emb|CR698653.2|CNS0G215 Tetraodon nigroviridis full-length cDNA 46 0.10
243emb|CR698629.2|CNS0G20H Tetraodon nigroviridis full-length cDNA 46 0.10
244emb|CR698437.2|CNS0G1V5 Tetraodon nigroviridis full-length cDNA 46 0.10
245emb|CR698409.2|CNS0G1UD Tetraodon nigroviridis full-length cDNA 46 0.10
246emb|CR697948.2|CNS0G1HK Tetraodon nigroviridis full-length cDNA 46 0.10
247emb|CR697683.2|CNS0G1A7 Tetraodon nigroviridis full-length cDNA 46 0.10
248emb|CR697335.2|CNS0G10J Tetraodon nigroviridis full-length cDNA 46 0.10
249emb|CR697273.2|CNS0G0YT Tetraodon nigroviridis full-length cDNA 46 0.10
250emb|CR696866.2|CNS0G0NI Tetraodon nigroviridis full-length cDNA 46 0.10
251emb|CR696204.2|CNS0G054 Tetraodon nigroviridis full-length cDNA 46 0.10
252emb|CR694298.2|CNS0FYO6 Tetraodon nigroviridis full-length cDNA 46 0.10
253emb|CR694147.2|CNS0FYJZ Tetraodon nigroviridis full-length cDNA 46 0.10
254emb|CR694142.2|CNS0FYJU Tetraodon nigroviridis full-length cDNA 46 0.10
255emb|CR694068.2|CNS0FYHS Tetraodon nigroviridis full-length cDNA 46 0.10
256emb|CR694055.2|CNS0FYHF Tetraodon nigroviridis full-length cDNA 46 0.10
257emb|CR693995.2|CNS0FYFR Tetraodon nigroviridis full-length cDNA 46 0.10
258emb|CR693273.2|CNS0FXVP Tetraodon nigroviridis full-length cDNA 46 0.10
259emb|CR693257.2|CNS0FXV9 Tetraodon nigroviridis full-length cDNA 46 0.10
260emb|CR685890.2|CNS0FS6M Tetraodon nigroviridis full-length cDNA 46 0.10
261emb|CR690169.2|CNS0FVHH Tetraodon nigroviridis full-length cDNA 46 0.10
262emb|CR690168.2|CNS0FVHG Tetraodon nigroviridis full-length cDNA 46 0.10
263emb|CR689851.2|CNS0FV8N Tetraodon nigroviridis full-length cDNA 46 0.10
264emb|CR688875.2|CNS0FUHJ Tetraodon nigroviridis full-length cDNA 46 0.10
265emb|CR688565.2|CNS0FU8X Tetraodon nigroviridis full-length cDNA 46 0.10
266emb|CR688519.2|CNS0FU7N Tetraodon nigroviridis full-length cDNA 46 0.10
267emb|CR688517.2|CNS0FU7L Tetraodon nigroviridis full-length cDNA 46 0.10
268emb|CR688008.2|CNS0FTTG Tetraodon nigroviridis full-length cDNA 46 0.10
269emb|CR687846.2|CNS0FTOY Tetraodon nigroviridis full-length cDNA 46 0.10
270emb|CR686816.2|CNS0FSWC Tetraodon nigroviridis full-length cDNA 46 0.10
271emb|CR686326.2|CNS0FSIQ Tetraodon nigroviridis full-length cDNA 46 0.10
272emb|CR685417.2|CNS0FRTH Tetraodon nigroviridis full-length cDNA 46 0.10
273emb|CR685235.2|CNS0FROF Tetraodon nigroviridis full-length cDNA 46 0.10
274emb|CR684608.2|CNS0FR70 Tetraodon nigroviridis full-length cDNA 46 0.10
275emb|CR684322.2|CNS0FQZ2 Tetraodon nigroviridis full-length cDNA 46 0.10
276emb|CR684166.2|CNS0FQUQ Tetraodon nigroviridis full-length cDNA 46 0.10
277emb|CR683913.2|CNS0FQNP Tetraodon nigroviridis full-length cDNA 46 0.10
278emb|CR683886.2|CNS0FQMY Tetraodon nigroviridis full-length cDNA 46 0.10
279emb|CR683862.2|CNS0FQMA Tetraodon nigroviridis full-length cDNA 46 0.10
280emb|CR683767.2|CNS0FQJN Tetraodon nigroviridis full-length cDNA 46 0.10
281emb|CR683153.2|CNS0FQ2L Tetraodon nigroviridis full-length cDNA 46 0.10
282emb|CR682733.2|CNS0FPQX Tetraodon nigroviridis full-length cDNA 46 0.10
283emb|CR682377.2|CNS0FPH1 Tetraodon nigroviridis full-length cDNA 46 0.10
284emb|CR682208.2|CNS0FPCC Tetraodon nigroviridis full-length cDNA 46 0.10
285emb|CR682161.2|CNS0FPB1 Tetraodon nigroviridis full-length cDNA 46 0.10
286emb|CR681454.2|CNS0FORE Tetraodon nigroviridis full-length cDNA 46 0.10
287emb|CR681172.2|CNS0FOJK Tetraodon nigroviridis full-length cDNA 46 0.10
288emb|CR681360.2|CNS0FOOS Tetraodon nigroviridis full-length cDNA 46 0.10
289emb|CR681268.2|CNS0FOM8 Tetraodon nigroviridis full-length cDNA 46 0.10
290emb|CR679854.2|CNS0FNIY Tetraodon nigroviridis full-length cDNA 46 0.10
291emb|CR679188.2|CNS0FN0G Tetraodon nigroviridis full-length cDNA 46 0.10
292emb|CR678880.2|CNS0FMRW Tetraodon nigroviridis full-length cDNA 46 0.10
293emb|CR678789.2|CNS0FMPD Tetraodon nigroviridis full-length cDNA 46 0.10
294emb|CR679124.2|CNS0FMYO Tetraodon nigroviridis full-length cDNA 46 0.10
295emb|CR679071.2|CNS0FMX7 Tetraodon nigroviridis full-length cDNA 46 0.10
296emb|CR679018.2|CNS0FMVQ Tetraodon nigroviridis full-length cDNA 46 0.10
297emb|CR678489.2|CNS0FMH1 Tetraodon nigroviridis full-length cDNA 46 0.10
298emb|CR677814.2|CNS0FLYM Tetraodon nigroviridis full-length cDNA 46 0.10
299emb|CR678036.2|CNS0FM4S Tetraodon nigroviridis full-length cDNA 46 0.10
300emb|CR677065.2|CNS0FLDX Tetraodon nigroviridis full-length cDNA 46 0.10
301emb|CR677043.2|CNS0FLDB Tetraodon nigroviridis full-length cDNA 46 0.10
302emb|CR676329.2|CNS0FKTH Tetraodon nigroviridis full-length cDNA 46 0.10
303emb|CR676085.2|CNS0FKMZ Tetraodon nigroviridis full-length cDNA 46 0.10
304emb|CR675813.2|CNS0FKFF Tetraodon nigroviridis full-length cDNA 46 0.10
305emb|CR675359.2|CNS0FK2T Tetraodon nigroviridis full-length cDNA 46 0.10
306emb|CR675517.2|CNS0FK77 Tetraodon nigroviridis full-length cDNA 46 0.10
307emb|CR674687.2|CNS0FJK5 Tetraodon nigroviridis full-length cDNA 46 0.10
308emb|CR674654.2|CNS0FJJ8 Tetraodon nigroviridis full-length cDNA 46 0.10
309emb|CR673484.2|CNS0FIMQ Tetraodon nigroviridis full-length cDNA 46 0.10
310emb|CR672950.2|CNS0FI7W Tetraodon nigroviridis full-length cDNA 46 0.10
311emb|CR672943.2|CNS0FI7P Tetraodon nigroviridis full-length cDNA 46 0.10
312emb|CR672122.2|CNS0FHKW Tetraodon nigroviridis full-length cDNA 46 0.10
313emb|CR672072.2|CNS0FHJI Tetraodon nigroviridis full-length cDNA 46 0.10
314emb|CR672349.2|CNS0FHR7 Tetraodon nigroviridis full-length cDNA 46 0.10
315emb|CR670971.2|CNS0FGOX Tetraodon nigroviridis full-length cDNA 46 0.10
316emb|CR671544.2|CNS0FH4U Tetraodon nigroviridis full-length cDNA 46 0.10
317emb|CR670416.2|CNS0FG9I Tetraodon nigroviridis full-length cDNA 46 0.10
318emb|CR670397.2|CNS0FG8Z Tetraodon nigroviridis full-length cDNA 46 0.10
319emb|CR670259.2|CNS0FG55 Tetraodon nigroviridis full-length cDNA 46 0.10
320emb|CR670215.2|CNS0FG3X Tetraodon nigroviridis full-length cDNA 46 0.10
321emb|CR670000.2|CNS0FFXY Tetraodon nigroviridis full-length cDNA 46 0.10
322emb|CR669792.2|CNS0FFS6 Tetraodon nigroviridis full-length cDNA 46 0.10
323emb|CR669718.2|CNS0FFQ4 Tetraodon nigroviridis full-length cDNA 46 0.10
324emb|CR669061.2|CNS0FF7V Tetraodon nigroviridis full-length cDNA 46 0.10
325emb|CR668982.2|CNS0FF5O Tetraodon nigroviridis full-length cDNA 46 0.10
326emb|CR668738.2|CNS0FEYW Tetraodon nigroviridis full-length cDNA 46 0.10
327emb|CR668687.2|CNS0FEXH Tetraodon nigroviridis full-length cDNA 46 0.10
328emb|CR668658.2|CNS0FEWO Tetraodon nigroviridis full-length cDNA 46 0.10
329emb|CR668480.2|CNS0FERQ Tetraodon nigroviridis full-length cDNA 46 0.10
330emb|CR668396.2|CNS0FEPE Tetraodon nigroviridis full-length cDNA 46 0.10
331emb|CR667693.2|CNS0FE5V Tetraodon nigroviridis full-length cDNA 46 0.10
332emb|CR667676.2|CNS0FE5E Tetraodon nigroviridis full-length cDNA 46 0.10
333emb|CR667388.2|CNS0FDXE Tetraodon nigroviridis full-length cDNA 46 0.10
334emb|CR667344.2|CNS0FDW6 Tetraodon nigroviridis full-length cDNA 46 0.10
335emb|CR667326.2|CNS0FDVO Tetraodon nigroviridis full-length cDNA 46 0.10
336emb|CR667093.2|CNS0FDP7 Tetraodon nigroviridis full-length cDNA 46 0.10
337emb|CR666814.2|CNS0FDHG Tetraodon nigroviridis full-length cDNA 46 0.10
338emb|CR666812.2|CNS0FDHE Tetraodon nigroviridis full-length cDNA 46 0.10
339emb|CR664565.2|CNS0FBQZ Tetraodon nigroviridis full-length cDNA 46 0.10
340emb|CR666461.2|CNS0FD7N Tetraodon nigroviridis full-length cDNA 46 0.10
341emb|CR666320.2|CNS0FD3Q Tetraodon nigroviridis full-length cDNA 46 0.10
342emb|CR665889.2|CNS0FCRR Tetraodon nigroviridis full-length cDNA 46 0.10
343emb|CR665887.2|CNS0FCRP Tetraodon nigroviridis full-length cDNA 46 0.10
344emb|CR665630.2|CNS0FCKK Tetraodon nigroviridis full-length cDNA 46 0.10
345emb|CR665528.2|CNS0FCHQ Tetraodon nigroviridis full-length cDNA 46 0.10
346emb|CR665378.2|CNS0FCDK Tetraodon nigroviridis full-length cDNA 46 0.10
347emb|CR665175.2|CNS0FC7X Tetraodon nigroviridis full-length cDNA 46 0.10
348emb|CR664930.2|CNS0FC14 Tetraodon nigroviridis full-length cDNA 46 0.10
349emb|CR664775.2|CNS0FBWT Tetraodon nigroviridis full-length cDNA 46 0.10
350emb|CR663735.2|CNS0FB3X Tetraodon nigroviridis full-length cDNA 46 0.10
351emb|CR663298.2|CNS0FARS Tetraodon nigroviridis full-length cDNA 46 0.10
352emb|CR663637.2|CNS0FB17 Tetraodon nigroviridis full-length cDNA 46 0.10
353emb|CR663041.2|CNS0FAKN Tetraodon nigroviridis full-length cDNA 46 0.10
354emb|CR663037.2|CNS0FAKJ Tetraodon nigroviridis full-length cDNA 46 0.10
355emb|CR662931.2|CNS0FAHL Tetraodon nigroviridis full-length cDNA 46 0.10
356emb|CR662209.2|CNS0F9XJ Tetraodon nigroviridis full-length cDNA 46 0.10
357emb|CR662177.2|CNS0F9WN Tetraodon nigroviridis full-length cDNA 46 0.10
358emb|CR661907.2|CNS0F9P5 Tetraodon nigroviridis full-length cDNA 46 0.10
359emb|CR661870.2|CNS0F9O4 Tetraodon nigroviridis full-length cDNA 46 0.10
360emb|CR661780.2|CNS0F9LM Tetraodon nigroviridis full-length cDNA 46 0.10
361emb|CR661758.2|CNS0F9L0 Tetraodon nigroviridis full-length cDNA 46 0.10
362emb|CR661384.2|CNS0F9AM Tetraodon nigroviridis full-length cDNA 46 0.10
363emb|CR660915.2|CNS0F8XL Tetraodon nigroviridis full-length cDNA 46 0.10
364emb|CR660908.2|CNS0F8XE Tetraodon nigroviridis full-length cDNA 46 0.10
365emb|CR660571.2|CNS0F8O1 Tetraodon nigroviridis full-length cDNA 46 0.10
366emb|CR660512.2|CNS0F8ME Tetraodon nigroviridis full-length cDNA 46 0.10
367emb|CR660140.2|CNS0F8C2 Tetraodon nigroviridis full-length cDNA 46 0.10
368emb|CR660065.2|CNS0F89Z Tetraodon nigroviridis full-length cDNA 46 0.10
369emb|CR659992.2|CNS0F87Y Tetraodon nigroviridis full-length cDNA 46 0.10
370emb|CR659211.2|CNS0F7M9 Tetraodon nigroviridis full-length cDNA 46 0.10
371emb|CR659188.2|CNS0F7LM Tetraodon nigroviridis full-length cDNA 46 0.10
372emb|CR659185.2|CNS0F7LJ Tetraodon nigroviridis full-length cDNA 46 0.10
373emb|CR659631.2|CNS0F7XX Tetraodon nigroviridis full-length cDNA 46 0.10
374emb|CR658663.2|CNS0F771 Tetraodon nigroviridis full-length cDNA 46 0.10
375emb|CR658335.2|CNS0F6XX Tetraodon nigroviridis full-length cDNA 46 0.10
376emb|CR658308.2|CNS0F6X6 Tetraodon nigroviridis full-length cDNA 46 0.10
377emb|CR658290.2|CNS0F6WO Tetraodon nigroviridis full-length cDNA 46 0.10
378emb|CR658164.2|CNS0F6T6 Tetraodon nigroviridis full-length cDNA 46 0.10
379emb|CR658093.2|CNS0F6R7 Tetraodon nigroviridis full-length cDNA 46 0.10
380emb|CR657830.2|CNS0F6JW Tetraodon nigroviridis full-length cDNA 46 0.10
381emb|CR657672.2|CNS0F6FI Tetraodon nigroviridis full-length cDNA 46 0.10
382emb|CR657152.2|CNS0F612 Tetraodon nigroviridis full-length cDNA 46 0.10
383emb|CR657135.2|CNS0F60L Tetraodon nigroviridis full-length cDNA 46 0.10
384emb|CR657038.2|CNS0F5XW Tetraodon nigroviridis full-length cDNA 46 0.10
385emb|CR657509.2|CNS0F6AZ Tetraodon nigroviridis full-length cDNA 46 0.10
386emb|CR657419.2|CNS0F68H Tetraodon nigroviridis full-length cDNA 46 0.10
387emb|CR657418.2|CNS0F68G Tetraodon nigroviridis full-length cDNA 46 0.10
388emb|CR657404.2|CNS0F682 Tetraodon nigroviridis full-length cDNA 46 0.10
389emb|CR656549.2|CNS0F5KB Tetraodon nigroviridis full-length cDNA 46 0.10
390emb|CR656524.2|CNS0F5JM Tetraodon nigroviridis full-length cDNA 46 0.10
391emb|CR655354.2|CNS0F4N4 Tetraodon nigroviridis full-length cDNA 46 0.10
392emb|CR656387.2|CNS0F5FT Tetraodon nigroviridis full-length cDNA 46 0.10
393emb|CR656030.2|CNS0F55W Tetraodon nigroviridis full-length cDNA 46 0.10
394emb|CR655907.2|CNS0F52H Tetraodon nigroviridis full-length cDNA 46 0.10
395emb|CR655443.2|CNS0F4PL Tetraodon nigroviridis full-length cDNA 46 0.10
396emb|CR655412.2|CNS0F4OQ Tetraodon nigroviridis full-length cDNA 46 0.10
397emb|CR655394.2|CNS0F4O8 Tetraodon nigroviridis full-length cDNA 46 0.10
398emb|CR655169.2|CNS0F4HZ Tetraodon nigroviridis full-length cDNA 46 0.10
399emb|CR655165.2|CNS0F4HV Tetraodon nigroviridis full-length cDNA 46 0.10
400emb|CR653288.2|CNS0F31Q Tetraodon nigroviridis full-length cDNA 46 0.10
401emb|CR654667.2|CNS0F441 Tetraodon nigroviridis full-length cDNA 46 0.10
402emb|CR654320.2|CNS0F3UE Tetraodon nigroviridis full-length cDNA 46 0.10
403emb|CR654133.2|CNS0F3P7 Tetraodon nigroviridis full-length cDNA 46 0.10
404emb|CR653753.2|CNS0F3EN Tetraodon nigroviridis full-length cDNA 46 0.10
405emb|CR653577.2|CNS0F39R Tetraodon nigroviridis full-length cDNA 46 0.10
406emb|CR652947.2|CNS0F2S9 Tetraodon nigroviridis full-length cDNA 46 0.10
407emb|CR652629.2|CNS0F2JF Tetraodon nigroviridis full-length cDNA 46 0.10
408emb|CR652008.2|CNS0F226 Tetraodon nigroviridis full-length cDNA 46 0.10
409emb|CR651676.2|CNS0F1SY Tetraodon nigroviridis full-length cDNA 46 0.10
410emb|CR651637.2|CNS0F1RV Tetraodon nigroviridis full-length cDNA 46 0.10
411emb|CR651567.2|CNS0F1PX Tetraodon nigroviridis full-length cDNA 46 0.10
412emb|CR650893.2|CNS0F177 Tetraodon nigroviridis full-length cDNA 46 0.10
413emb|CR650588.2|CNS0F0YQ Tetraodon nigroviridis full-length cDNA 46 0.10
414emb|CR648432.2|CNS0EZAU Tetraodon nigroviridis full-length cDNA 46 0.10
415emb|CR650034.2|CNS0F0JC Tetraodon nigroviridis full-length cDNA 46 0.10
416emb|CR650227.2|CNS0F0OP Tetraodon nigroviridis full-length cDNA 46 0.10
417emb|CR650144.2|CNS0F0ME Tetraodon nigroviridis full-length cDNA 46 0.10
418emb|CR649393.2|CNS0F01J Tetraodon nigroviridis full-length cDNA 46 0.10
419emb|CR649350.2|CNS0F00C Tetraodon nigroviridis full-length cDNA 46 0.10
420emb|CR649229.2|CNS0EZWZ Tetraodon nigroviridis full-length cDNA 46 0.10
421emb|CR649125.2|CNS0EZU3 Tetraodon nigroviridis full-length cDNA 46 0.10
422emb|CR649070.2|CNS0EZSK Tetraodon nigroviridis full-length cDNA 46 0.10
423emb|CR648996.2|CNS0EZQI Tetraodon nigroviridis full-length cDNA 46 0.10
424emb|CR648886.2|CNS0EZNG Tetraodon nigroviridis full-length cDNA 46 0.10
425emb|CR648351.2|CNS0EZ8L Tetraodon nigroviridis full-length cDNA 46 0.10
426emb|CR648348.2|CNS0EZ8I Tetraodon nigroviridis full-length cDNA 46 0.10
427emb|CR648175.2|CNS0EZ3P Tetraodon nigroviridis full-length cDNA 46 0.10
428emb|CR647764.2|CNS0EYSA Tetraodon nigroviridis full-length cDNA 46 0.10
429emb|CR646870.2|CNS0EY3G Tetraodon nigroviridis full-length cDNA 46 0.10
430emb|CR646832.2|CNS0EY2E Tetraodon nigroviridis full-length cDNA 46 0.10
431emb|CR646799.2|CNS0EY1H Tetraodon nigroviridis full-length cDNA 46 0.10
432emb|CR646256.2|CNS0EXME Tetraodon nigroviridis full-length cDNA 46 0.10
433emb|CR646125.2|CNS0EXIR Tetraodon nigroviridis full-length cDNA 46 0.10
434emb|CR644678.2|CNS0EWEK Tetraodon nigroviridis full-length cDNA 46 0.10
435emb|CR644631.2|CNS0EWD9 Tetraodon nigroviridis full-length cDNA 46 0.10
436emb|CR644976.2|CNS0EWMU Tetraodon nigroviridis full-length cDNA 46 0.10
437emb|CR643926.2|CNS0EVTO Tetraodon nigroviridis full-length cDNA 46 0.10
438emb|CR643644.2|CNS0EVLU Tetraodon nigroviridis full-length cDNA 46 0.10
439emb|CR643877.2|CNS0EVSB Tetraodon nigroviridis full-length cDNA 46 0.10
440emb|CR643825.2|CNS0EVQV Tetraodon nigroviridis full-length cDNA 46 0.10
441emb|CR643708.2|CNS0EVNM Tetraodon nigroviridis full-length cDNA 46 0.10
442emb|CR642624.2|CNS0EUTI Tetraodon nigroviridis full-length cDNA 46 0.10
443emb|CR642070.2|CNS0EUE4 Tetraodon nigroviridis full-length cDNA 46 0.10
444emb|CR642044.2|CNS0EUDE Tetraodon nigroviridis full-length cDNA 46 0.10
445emb|CR641126.3|CNS0ETNW Tetraodon nigroviridis full-length cDNA 46 0.10
446emb|CR642024.2|CNS0EUCU Tetraodon nigroviridis full-length cDNA 46 0.10
447emb|CR641632.2|CNS0EU1Y Tetraodon nigroviridis full-length cDNA 46 0.10
448emb|CR641259.2|CNS0ETRL Tetraodon nigroviridis full-length cDNA 46 0.10
449emb|CR640983.2|CNS0ETJX Tetraodon nigroviridis full-length cDNA 46 0.10
450emb|CR640308.2|CNS0ET16 Tetraodon nigroviridis full-length cDNA 46 0.10
451emb|CR640244.2|CNS0ESZE Tetraodon nigroviridis full-length cDNA 46 0.10
452emb|CR640135.2|CNS0ESWD Tetraodon nigroviridis full-length cDNA 46 0.10
453emb|CR639590.2|CNS0ESH8 Tetraodon nigroviridis full-length cDNA 46 0.10
454emb|CR639457.2|CNS0ESDJ Tetraodon nigroviridis full-length cDNA 46 0.10
455emb|CR638878.2|CNS0ERXG Tetraodon nigroviridis full-length cDNA 46 0.10
456emb|CR638779.2|CNS0ERUP Tetraodon nigroviridis full-length cDNA 46 0.10
457emb|CR638709.2|CNS0ERSR Tetraodon nigroviridis full-length cDNA 46 0.10
458emb|CR638616.2|CNS0ERQ6 Tetraodon nigroviridis full-length cDNA 46 0.10
459emb|CR637993.2|CNS0ER8V Tetraodon nigroviridis full-length cDNA 46 0.10
460emb|CR637973.2|CNS0ER8B Tetraodon nigroviridis full-length cDNA 46 0.10
461emb|CR637871.2|CNS0ER5H Tetraodon nigroviridis full-length cDNA 46 0.10
462emb|CR637863.2|CNS0ER59 Tetraodon nigroviridis full-length cDNA 46 0.10
463emb|CR637219.2|CNS0EQND Tetraodon nigroviridis full-length cDNA 46 0.10
464emb|CR637156.2|CNS0EQLM Tetraodon nigroviridis full-length cDNA 46 0.10
465emb|CR637145.2|CNS0EQLB Tetraodon nigroviridis full-length cDNA 46 0.10
466emb|CR637690.2|CNS0ER0G Tetraodon nigroviridis full-length cDNA 46 0.10
467emb|CR637369.2|CNS0EQRJ Tetraodon nigroviridis full-length cDNA 46 0.10
468emb|CR636370.2|CNS0EPZS Tetraodon nigroviridis full-length cDNA 46 0.10
469emb|CR636176.2|CNS0EPUE Tetraodon nigroviridis full-length cDNA 46 0.10
470emb|CR636066.2|CNS0EPRC Tetraodon nigroviridis full-length cDNA 46 0.10
471emb|CR634840.2|CNS0EOTA Tetraodon nigroviridis full-length cDNA 46 0.10
472emb|CR635557.2|CNS0EPD7 Tetraodon nigroviridis full-length cDNA 46 0.10
473emb|CR635036.2|CNS0EOYQ Tetraodon nigroviridis full-length cDNA 46 0.10
474emb|CR634406.2|CNS0EOH8 Tetraodon nigroviridis full-length cDNA 46 0.10
475emb|CR634284.2|CNS0EODU Tetraodon nigroviridis full-length cDNA 46 0.10
476emb|CR632877.2|CNS0ENAR Tetraodon nigroviridis full-length cDNA 46 0.10
477emb|CR632755.2|CNS0EN7D Tetraodon nigroviridis full-length cDNA 46 0.10
478emb|CR633656.2|CNS0ENWE Tetraodon nigroviridis full-length cDNA 46 0.10
479emb|CR633571.2|CNS0ENU1 Tetraodon nigroviridis full-length cDNA 46 0.10
480emb|CR633559.2|CNS0ENTP Tetraodon nigroviridis full-length cDNA 46 0.10
481emb|CR633339.2|CNS0ENNL Tetraodon nigroviridis full-length cDNA 46 0.10
482emb|CR633199.2|CNS0ENJP Tetraodon nigroviridis full-length cDNA 46 0.10
483emb|CR633154.2|CNS0ENIG Tetraodon nigroviridis full-length cDNA 46 0.10
484emb|CR633147.2|CNS0ENI9 Tetraodon nigroviridis full-length cDNA 46 0.10
485emb|CR633142.2|CNS0ENI4 Tetraodon nigroviridis full-length cDNA 46 0.10
486emb|CR633040.2|CNS0ENFA Tetraodon nigroviridis full-length cDNA 46 0.10
487emb|CR633001.2|CNS0ENE7 Tetraodon nigroviridis full-length cDNA 46 0.10
488emb|CR632963.2|CNS0END5 Tetraodon nigroviridis full-length cDNA 46 0.10
489emb|CR632468.2|CNS0EMZE Tetraodon nigroviridis full-length cDNA 46 0.10
490emb|CR631305.2|CNS0EM32 Tetraodon nigroviridis full-length cDNA 46 0.10
491emb|CR631246.2|CNS0EM1F Tetraodon nigroviridis full-length cDNA 46 0.10
492emb|CR632378.2|CNS0EMWW Tetraodon nigroviridis full-length cDNA 46 0.10
493emb|CR632113.2|CNS0EMPJ Tetraodon nigroviridis full-length cDNA 46 0.10
494emb|CR631879.2|CNS0EMJ1 Tetraodon nigroviridis full-length cDNA 46 0.10
495emb|CR631854.2|CNS0EMIC Tetraodon nigroviridis full-length cDNA 46 0.10
496emb|CR631834.2|CNS0EMHS Tetraodon nigroviridis full-length cDNA 46 0.10
497emb|CR631530.2|CNS0EM9C Tetraodon nigroviridis full-length cDNA 46 0.10
498gb|BC038290.2| Homo sapiens neural precursor cell expressed, dev... 46 0.10
499gb|AF527442.1| Phaseolus vulgaris clone PvDR-9 polyubiquitin 2 m... 46 0.10
500emb|X64345.1|PCCUBI42 P.crispum gene Pcubi4-2 for polyubiquitin 46 0.10

>dbj|AK062354.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-101-G08, full
           insert sequence
          Length = 832

 Score =  444 bits (224), Expect = e-121
 Identities = 291/314 (92%)
 Strand = Plus / Minus

                                                                       
Query: 139 catctactgaccacccctcagagcaagcacaagatggagcactgaaccaccttcgatgtt 198
           |||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 610 catctactgaccacccctcagagcaagcacgagatggagcactgagccaccttcaatgtt 551

                                                                       
Query: 199 gtagtcctttgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttg 258
           ||| ||||| |||||||| |||||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 550 gtaatccttggcagttttatcatcagcaagttgcttcccagcataaatgagcctctgctg 491

                                                                       
Query: 259 aacaggtggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagt 318
           ||||||||||||||||||||||||||||||||| |||||||||||||| || || |||||
Sbjct: 490 aacaggtggaataccctctttctcctcaacacgctccttgattctatcaatggtatcagt 431

                                                                       
Query: 319 gggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttcc 378
           ||||||||| || ||||| |||||||||||||  |||||||||||||||||||| |||||
Sbjct: 430 gggctcaatgtcgatctcgatttccttcccagtgagtgtcttcaccttgatcatggttcc 371

                                                                       
Query: 379 acccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaa 438
           ||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 370 acccctgagcctcaggaccaaatggagcgttgactctttctgaatgttgtaatcagctaa 311

                         
Query: 439 tgttcgcccatctt 452
           ||| || |||||||
Sbjct: 310 tgtacgtccatctt 297



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  287 bits (145), Expect = 2e-74
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                            
Query: 250      cctctgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcgat 309
                |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||
Sbjct: 26204048 cctctgctgaacaggtggaataccctctttctcctcaacacgctccttgattctatcaat 26203989

                                                                            
Query: 310      tgtgtcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgat 369
                 || |||||||||||||| || ||||| |||||||||||||  |||||||||||||||||
Sbjct: 26203988 ggtatcagtgggctcaatgtcgatctcgatttccttcccagtgagtgtcttcaccttgat 26203929

                                                                            
Query: 370      catagttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgta 429
                ||| |||||||||||||||||||||||||||||||||||  |||||||||||||||||||
Sbjct: 26203928 catggttccacccctgagcctcaggaccaaatggagcgttgactctttctgaatgttgta 26203869

                                       
Query: 430      atcagctaatgttcgcccatctt 452
                |||||||||||| || |||||||
Sbjct: 26203868 atcagctaatgtacgtccatctt 26203846



 Score =  163 bits (82), Expect = 6e-37
 Identities = 106/114 (92%)
 Strand = Plus / Minus

                                                                            
Query: 139      catctactgaccacccctcagagcaagcacaagatggagcactgaaccaccttcgatgtt 198
                |||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 26204256 catctactgaccacccctcagagcaagcacgagatggagcactgagccaccttcaatgtt 26204197

                                                                      
Query: 199      gtagtcctttgcagttttgtcatcagcgagttgcttcccagcatagatgagcct 252
                ||| ||||| |||||||| |||||||| ||||||||||||||||| ||||||||
Sbjct: 26204196 gtaatccttggcagttttatcatcagcaagttgcttcccagcataaatgagcct 26204143



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 411      actctttctgaatgttgtaatcagc 435
                |||| ||||||||||||||||||||
Sbjct: 27575254 actccttctgaatgttgtaatcagc 27575278



to top

>dbj|AP005453.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0453H04
          Length = 175047

 Score =  287 bits (145), Expect = 2e-74
 Identities = 188/203 (92%)
 Strand = Plus / Minus

                                                                         
Query: 250   cctctgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcgat 309
             |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||
Sbjct: 68588 cctctgctgaacaggtggaataccctctttctcctcaacacgctccttgattctatcaat 68529

                                                                         
Query: 310   tgtgtcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgat 369
              || |||||||||||||| || ||||| |||||||||||||  |||||||||||||||||
Sbjct: 68528 ggtatcagtgggctcaatgtcgatctcgatttccttcccagtgagtgtcttcaccttgat 68469

                                                                         
Query: 370   catagttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgta 429
             ||| |||||||||||||||||||||||||||||||||||  |||||||||||||||||||
Sbjct: 68468 catggttccacccctgagcctcaggaccaaatggagcgttgactctttctgaatgttgta 68409

                                    
Query: 430   atcagctaatgttcgcccatctt 452
             |||||||||||| || |||||||
Sbjct: 68408 atcagctaatgtacgtccatctt 68386



 Score =  163 bits (82), Expect = 6e-37
 Identities = 106/114 (92%)
 Strand = Plus / Minus

                                                                         
Query: 139   catctactgaccacccctcagagcaagcacaagatggagcactgaaccaccttcgatgtt 198
             |||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 68796 catctactgaccacccctcagagcaagcacgagatggagcactgagccaccttcaatgtt 68737

                                                                   
Query: 199   gtagtcctttgcagttttgtcatcagcgagttgcttcccagcatagatgagcct 252
             ||| ||||| |||||||| |||||||| ||||||||||||||||| ||||||||
Sbjct: 68736 gtaatccttggcagttttatcatcagcaagttgcttcccagcataaatgagcct 68683



to top

>dbj|AK099513.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029K20, full
           insert sequence
          Length = 795

 Score =  250 bits (126), Expect = 4e-63
 Identities = 267/315 (84%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 609 accacccctcagagcaaggacaagatggaggacagagccaccttcgatgttatagtcctt 550

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
            ||||| ||||| || || || ||||| ||||||||||| ||||| || || || || ||
Sbjct: 549 cgcagtcttgtcgtcggcaagctgcttaccagcatagataagcctttgctgcacgggagg 490

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
           ||| || ||||||||||||||||| |||||||| |||||||| ||||| |||||||||||
Sbjct: 489 aatgccttctttctcctcaacacgctccttgatcctatcgatcgtgtcggtgggctcaat 430

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
            ||||| ||||| || || ||||  || ||||| |||||||||||||| |||||||||||
Sbjct: 429 gtcaatttcaatctcttttccagtgagggtcttaaccttgatcatagtgccacccctgag 370

                                                                       
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           ||| |||||||| || || ||  |||| |||||||||||||| || || | ||| |||||
Sbjct: 369 cctgaggaccaagtgaagagttgactccttctgaatgttgtagtcggccagtgtgcgccc 310

                          
Query: 448 atcttncaactgctt 462
           ||||| || ||||||
Sbjct: 309 atcttccagctgctt 295



to top

>gb|AY090541.1| Deschampsia antarctica clone Dacor 1.0 polyubiquitin 2 mRNA,
           complete cds
          Length = 831

 Score =  246 bits (124), Expect = 6e-62
 Identities = 273/324 (84%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           |||||||||||||||||| ||||||||||| || || |||||||||||||||||||||||
Sbjct: 576 accacccctcagagcaagtacaagatggaggacggagccaccttcgatgttgtagtcctt 517

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
            ||||| |||||||| || || ||||| |||||||| || | ||| || || || || ||
Sbjct: 516 cgcagtcttgtcatctgcaagctgcttaccagcataaatcaacctttgctgcacgggagg 457

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
           ||| || ||||||||||||||||| |||||||  ||||| || |||||||||||||||||
Sbjct: 456 aatgccttctttctcctcaacacgctccttgaccctatcaatcgtgtcagtgggctcaat 397

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
            ||||| || || ||||| ||||  |||||||| |||||||||||||| || ||||||||
Sbjct: 396 gtcaatttcgatctcctttccagtgagtgtcttaaccttgatcatagtaccgcccctgag 337

                                                                       
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           ||| |||||||| || || ||  |||| || ||||| ||||||||||| | ||| || ||
Sbjct: 336 cctgaggaccaagtgaagagtagactccttttgaatattgtaatcagcaagtgtgcgtcc 277

                                   
Query: 448 atcttncaactgctttncagcaaa 471
           ||||| |||||||||  |||||||
Sbjct: 276 atcttccaactgcttgccagcaaa 253



to top

>ref|NM_102873.3| Arabidopsis thaliana RUB1 (RELATED TO UBIQUITIN 1) AT1G31340 (RUB1)
           mRNA, complete cds
          Length = 702

 Score =  214 bits (108), Expect = 2e-52
 Identities = 269/324 (83%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           ||||||||| || ||||| || ||||| || || || || || || ||||||||||||||
Sbjct: 495 accacccctaagggcaagaaccagatgaagaacagagcctccctctatgttgtagtcctt 436

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
           ||| |||||||||||||| || || || || || ||||| ||||| ||||||||||| ||
Sbjct: 435 tgccgttttgtcatcagctagctgttttccggcgtagattagcctttgttgaacaggagg 376

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
            ||||| ||||||||||||||||||||||| || | ||| || || || || || || ||
Sbjct: 375 gataccttctttctcctcaacacgttccttaatccgatcaatagtatcggttggttcgat 316

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
           ||||||||||||||||||||| |  || ||||||||||| |||||||| |||||||| ||
Sbjct: 315 atcaatctcaatttccttccctgtgagagtcttcaccttaatcatagtcccacccctaag 256

                                                                       
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           |||||  ||||| || || ||| | |||||||||||||||||||| ||||||||||  ||
Sbjct: 255 cctcaataccaagtgaagagtcgattctttctgaatgttgtaatccgctaatgttctacc 196

                                   
Query: 448 atcttncaactgctttncagcaaa 471
           |||||  | ||||||  |||||||
Sbjct: 195 atcttcaagctgcttaccagcaaa 172



to top

>gb|BT006110.1| Arabidopsis thaliana clone U50103 putative ubiquitin (AtRUB1)
           (At1g31340) mRNA, complete cds
          Length = 502

 Score =  214 bits (108), Expect = 2e-52
 Identities = 269/324 (83%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           ||||||||| || ||||| || ||||| || || || || || || ||||||||||||||
Sbjct: 456 accacccctaagggcaagaaccagatgaagaacagagcctccctctatgttgtagtcctt 397

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
           ||| |||||||||||||| || || || || || ||||| ||||| ||||||||||| ||
Sbjct: 396 tgccgttttgtcatcagctagctgttttccggcgtagattagcctttgttgaacaggagg 337

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
            ||||| ||||||||||||||||||||||| || | ||| || || || || || || ||
Sbjct: 336 gataccttctttctcctcaacacgttccttaatccgatcaatagtatcggttggttcgat 277

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
           ||||||||||||||||||||| |  || ||||||||||| |||||||| |||||||| ||
Sbjct: 276 atcaatctcaatttccttccctgtgagagtcttcaccttaatcatagtcccacccctaag 217

                                                                       
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           |||||  ||||| || || ||| | |||||||||||||||||||| ||||||||||  ||
Sbjct: 216 cctcaataccaagtgaagagtcgattctttctgaatgttgtaatccgctaatgttctacc 157

                                   
Query: 448 atcttncaactgctttncagcaaa 471
           |||||  | ||||||  |||||||
Sbjct: 156 atcttcaagctgcttaccagcaaa 133



to top

>gb|BT005749.1| Arabidopsis thaliana clone RAFL15-38-H20 (R50103) putative
           ubiquitin (AtRUB1) (At1g31340) mRNA, complete cds
          Length = 742

 Score =  214 bits (108), Expect = 2e-52
 Identities = 269/324 (83%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           ||||||||| || ||||| || ||||| || || || || || || ||||||||||||||
Sbjct: 495 accacccctaagggcaagaaccagatgaagaacagagcctccctctatgttgtagtcctt 436

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
           ||| |||||||||||||| || || || || || ||||| ||||| ||||||||||| ||
Sbjct: 435 tgccgttttgtcatcagctagctgttttccggcgtagattagcctttgttgaacaggagg 376

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
            ||||| ||||||||||||||||||||||| || | ||| || || || || || || ||
Sbjct: 375 gataccttctttctcctcaacacgttccttaatccgatcaatagtatcggttggttcgat 316

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
           ||||||||||||||||||||| |  || ||||||||||| |||||||| |||||||| ||
Sbjct: 315 atcaatctcaatttccttccctgtgagagtcttcaccttaatcatagtcccacccctaag 256

                                                                       
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           |||||  ||||| || || ||| | |||||||||||||||||||| ||||||||||  ||
Sbjct: 255 cctcaataccaagtgaagagtcgattctttctgaatgttgtaatccgctaatgttctacc 196

                                   
Query: 448 atcttncaactgctttncagcaaa 471
           |||||  | ||||||  |||||||
Sbjct: 195 atcttcaagctgcttaccagcaaa 172



to top

>gb|AY104764.1| Zea mays PCO108118 mRNA sequence
          Length = 878

 Score =  210 bits (106), Expect = 3e-51
 Identities = 242/288 (84%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           |||||||||||||||||| ||||||||||| || || ||||| |||||||||||||||||
Sbjct: 639 accacccctcagagcaaggacaagatggaggacagatccaccctcgatgttgtagtcctt 580

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
           ||| || ||||||||||| || ||||| ||||||||||||||||| || || || || ||
Sbjct: 579 tgcggtcttgtcatcagcaagctgcttaccagcatagatgagcctttgctgcacgggagg 520

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
           ||| || |||||||| |||||||| |||||||| || || || | ||||||||| |||||
Sbjct: 519 aatgccttctttctcttcaacacgctccttgatcctgtcaatcgagtcagtgggttcaat 460

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
            || ||||| || || |||||||  || || || ||||||||||| ||||||||||| ||
Sbjct: 459 gtcgatctcgatctctttcccagtgagagttttgaccttgatcatggttccacccctaag 400

                                                           
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           ||| ||||||||||| || ||  |||| || || |||||||| |||||
Sbjct: 399 cctgaggaccaaatgaagagttgactccttttggatgttgtagtcagc 352



to top

>ref|NM_129118.3| Arabidopsis thaliana UBQ7 AT2G35635 (UBQ7) mRNA, complete cds
          Length = 688

 Score =  188 bits (95), Expect = 1e-44
 Identities = 220/263 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 gttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtggaata 271
           |||||||||||||| || || || || ||||| |||||||| ||||||||||| || || 
Sbjct: 442 gttttgtcatcagcaagctgttttccggcatatatgagcctttgttgaacaggagggatg 383

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           || |||||||| ||||||||||| ||||| | ||| || ||||| || || || ||||||
Sbjct: 382 ccttctttctcttcaacacgttctttgatccgatcaatagtgtcggttggttcgatatca 323

                                                                       
Query: 332 atctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgagcctc 391
           ||||| ||||| || ||||  |||||||||||||||||||| |||||||| |||||||| 
Sbjct: 322 atctcgatttcttttccagtgagtgtcttcaccttgatcatggttccacctctgagcctg 263

                                                                       
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatct 451
           ||||| | ||| || ||  |||||||||| ||||||||||||||||| || || ||||||
Sbjct: 262 aggacaagatgaagagtagactctttctggatgttgtaatcagctaaggtccggccatct 203

                                  
Query: 452 tncaactgctttncagcaaaaat 474
           | ||| |||||  ||||||||||
Sbjct: 202 tccaattgcttaccagcaaaaat 180



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 229 ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 197 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 142



to top

>gb|AY093802.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, complete cds
          Length = 465

 Score =  188 bits (95), Expect = 1e-44
 Identities = 220/263 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 gttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtggaata 271
           |||||||||||||| || || || || ||||| |||||||| ||||||||||| || || 
Sbjct: 392 gttttgtcatcagcaagctgttttccggcatatatgagcctttgttgaacaggagggatg 333

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           || |||||||| ||||||||||| ||||| | ||| || ||||| || || || ||||||
Sbjct: 332 ccttctttctcttcaacacgttctttgatccgatcaatagtgtcggttggttcgatatca 273

                                                                       
Query: 332 atctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgagcctc 391
           ||||| ||||| || ||||  |||||||||||||||||||| |||||||| |||||||| 
Sbjct: 272 atctcgatttcttttccagtgagtgtcttcaccttgatcatggttccacctctgagcctg 213

                                                                       
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatct 451
           ||||| | ||| || ||  |||||||||| ||||||||||||||||| || || ||||||
Sbjct: 212 aggacaagatgaagagtagactctttctggatgttgtaatcagctaaggtccggccatct 153

                                  
Query: 452 tncaactgctttncagcaaaaat 474
           | ||| |||||  ||||||||||
Sbjct: 152 tccaattgcttaccagcaaaaat 130



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 229 ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 147 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 92



to top

>gb|AY074850.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, complete cds
          Length = 641

 Score =  188 bits (95), Expect = 1e-44
 Identities = 220/263 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 gttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtggaata 271
           |||||||||||||| || || || || ||||| |||||||| ||||||||||| || || 
Sbjct: 442 gttttgtcatcagcaagctgttttccggcatatatgagcctttgttgaacaggagggatg 383

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           || |||||||| ||||||||||| ||||| | ||| || ||||| || || || ||||||
Sbjct: 382 ccttctttctcttcaacacgttctttgatccgatcaatagtgtcggttggttcgatatca 323

                                                                       
Query: 332 atctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgagcctc 391
           ||||| ||||| || ||||  |||||||||||||||||||| |||||||| |||||||| 
Sbjct: 322 atctcgatttcttttccagtgagtgtcttcaccttgatcatggttccacctctgagcctg 263

                                                                       
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatct 451
           ||||| | ||| || ||  |||||||||| ||||||||||||||||| || || ||||||
Sbjct: 262 aggacaagatgaagagtagactctttctggatgttgtaatcagctaaggtccggccatct 203

                                  
Query: 452 tncaactgctttncagcaaaaat 474
           | ||| |||||  ||||||||||
Sbjct: 202 tccaattgcttaccagcaaaaat 180



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 229 ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 197 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 142



to top

>dbj|AK118678.1| Arabidopsis thaliana mRNA for ubiquitin-like protein, complete cds,
           clone: RAFL19-95-A01
          Length = 660

 Score =  188 bits (95), Expect = 1e-44
 Identities = 220/263 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 gttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtggaata 271
           |||||||||||||| || || || || ||||| |||||||| ||||||||||| || || 
Sbjct: 442 gttttgtcatcagcaagctgttttccggcatatatgagcctttgttgaacaggagggatg 383

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           || |||||||| ||||||||||| ||||| | ||| || ||||| || || || ||||||
Sbjct: 382 ccttctttctcttcaacacgttctttgatccgatcaatagtgtcggttggttcgatatca 323

                                                                       
Query: 332 atctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgagcctc 391
           ||||| ||||| || ||||  |||||||||||||||||||| |||||||| |||||||| 
Sbjct: 322 atctcgatttcttttccagtgagtgtcttcaccttgatcatggttccacctctgagcctg 263

                                                                       
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatct 451
           ||||| | ||| || ||  |||||||||| ||||||||||||||||| || || ||||||
Sbjct: 262 aggacaagatgaagagtagactctttctggatgttgtaatcagctaaggtccggccatct 203

                                  
Query: 452 tncaactgctttncagcaaaaat 474
           | ||| |||||  ||||||||||
Sbjct: 202 tccaattgcttaccagcaaaaat 180



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 229 ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 197 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 142



to top

>gb|AC007654.2|AC007654 Genomic sequence for Arabidopsis thaliana BAC T19E23 from chromosome I,
             complete sequence
          Length = 87618

 Score =  163 bits (82), Expect = 6e-37
 Identities = 183/218 (83%)
 Strand = Plus / Plus

                                                                         
Query: 254   tgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcgattgtg 313
             ||||||||||| || ||||| ||||||||||||||||||||||| || | ||| || || 
Sbjct: 59156 tgttgaacaggagggataccttctttctcctcaacacgttccttaatccgatcaatagta 59215

                                                                         
Query: 314   tcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgatcata 373
             || || || || ||||||||||||||||||||||| |  || ||||||||||| ||||||
Sbjct: 59216 tcggttggttcgatatcaatctcaatttccttccctgtgagagtcttcaccttaatcata 59275

                                                                         
Query: 374   gttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatca 433
             || |||||||| |||||||  ||||| || || ||| | |||||||||||||||||||| 
Sbjct: 59276 gtcccacccctaagcctcaataccaagtgaagagtcgattctttctgaatgttgtaatcc 59335

                                                   
Query: 434   gctaatgttcgcccatcttncaactgctttncagcaaa 471
             ||||||||||  |||||||  | ||||||  |||||||
Sbjct: 59336 gctaatgttctaccatcttcaagctgcttaccagcaaa 59373



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                         
Query: 148   accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
             ||||||||| || ||||| || ||||| || || || || || || ||||||||||||||
Sbjct: 58583 accacccctaagggcaagaaccagatgaagaacagagcctccctctatgttgtagtcctt 58642

                               
Query: 208   tgcagttttgtcatcagc 225
             ||| ||||||||||||||
Sbjct: 58643 tgccgttttgtcatcagc 58660



to top

>gb|AC006068.4| Arabidopsis thaliana chromosome 2 clone T20F21 map ve016, complete
             sequence
          Length = 107436

 Score =  161 bits (81), Expect = 3e-36
 Identities = 185/221 (83%)
 Strand = Plus / Plus

                                                                         
Query: 254   tgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcgattgtg 313
             ||||||||||| || || || |||||||| ||||||||||| ||||| | ||| || |||
Sbjct: 62489 tgttgaacaggagggatgccttctttctcttcaacacgttctttgatccgatcaatagtg 62548

                                                                         
Query: 314   tcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgatcata 373
             || || || || ||||||||||| ||||| || ||||  |||||||||||||||||||| 
Sbjct: 62549 tcggttggttcgatatcaatctcgatttcttttccagtgagtgtcttcaccttgatcatg 62608

                                                                         
Query: 374   gttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatca 433
             |||||||| |||||||| ||||| | ||| || ||  |||||||||| ||||||||||||
Sbjct: 62609 gttccacctctgagcctgaggacaagatgaagagtagactctttctggatgttgtaatca 62668

                                                      
Query: 434   gctaatgttcgcccatcttncaactgctttncagcaaaaat 474
             ||||| || || ||||||| ||| |||||  ||||||||||
Sbjct: 62669 gctaaggtccggccatcttccaattgcttaccagcaaaaat 62709



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 229   ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
             |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 62692 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 62747



to top

>gb|L05364.1|ATHUBQ7G Arabidopsis thaliana polyubiquitin (ubq7) gene sequence
          Length = 1585

 Score =  161 bits (81), Expect = 3e-36
 Identities = 185/221 (83%)
 Strand = Plus / Minus

                                                                        
Query: 254  tgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcgattgtg 313
            ||||||||||| || || || |||||||| ||||||||||| ||||| | ||| || |||
Sbjct: 1273 tgttgaacaggagggatgccttctttctcttcaacacgttctttgatccgatcaatagtg 1214

                                                                        
Query: 314  tcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgatcata 373
            || || || || ||||||||||| ||||| || ||||  |||||||||||||||||||| 
Sbjct: 1213 tcggttggttcgatatcaatctcgatttcttttccagtgagtgtcttcaccttgatcatg 1154

                                                                        
Query: 374  gttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatca 433
            |||||||| |||||||| ||||| | ||| || ||  |||||||||| ||||||||||||
Sbjct: 1153 gttccacctctgagcctgaggacaagatgaagagtagactctttctggatgttgtaatca 1094

                                                     
Query: 434  gctaatgttcgcccatcttncaactgctttncagcaaaaat 474
            ||||| || || ||||||| ||| |||||  ||||||||||
Sbjct: 1093 gctaaggtccggccatcttccaattgcttaccagcaaaaat 1053



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 229  ttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
            |||||| |||||| | || |||||||||||| ||||||| || |||||||| ||||
Sbjct: 1070 ttgcttaccagcaaaaatcagcctctgttgatcaggtggtatgccctctttgtcct 1015



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  159 bits (80), Expect = 1e-35
 Identities = 167/197 (84%)
 Strand = Plus / Minus

                                                                            
Query: 266      ggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctca 325
                ||||| || ||||||||||||||||| |||||||| |||||||| ||||| |||||||||
Sbjct: 15107761 ggaatgccttctttctcctcaacacgctccttgatcctatcgatcgtgtcggtgggctca 15107702

                                                                            
Query: 326      atatcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctg 385
                || ||||| ||||| || || ||||  || ||||| |||||||||||||| |||||||||
Sbjct: 15107701 atgtcaatttcaatctcttttccagtgagggtcttaaccttgatcatagtgccacccctg 15107642

                                                                            
Query: 386      agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgc 445
                ||||| |||||||| || || ||  |||| |||||||||||||| || || | ||| |||
Sbjct: 15107641 agcctgaggaccaagtgaagagttgactccttctgaatgttgtagtcggccagtgtgcgc 15107582

                                 
Query: 446      ccatcttncaactgctt 462
                ||||||| || ||||||
Sbjct: 15107581 ccatcttccagctgctt 15107565



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                            
Query: 148      accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
                |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 15108022 accacccctcagagcaaggacaagatggaggacagagccaccttcgatgttatagtcctt 15107963

                                                             
Query: 208      tgcagttttgtcatcagcgagttgcttcccagcatagatgagcct 252
                 ||||| ||||| || || || ||||| ||||||||||| |||||
Sbjct: 15107962 cgcagtcttgtcgtcggcaagctgcttaccagcatagataagcct 15107918



to top

>dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
            clone:OJ1740_D06
          Length = 187410

 Score =  159 bits (80), Expect = 1e-35
 Identities = 167/197 (84%)
 Strand = Plus / Minus

                                                                        
Query: 266  ggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctca 325
            ||||| || ||||||||||||||||| |||||||| |||||||| ||||| |||||||||
Sbjct: 1737 ggaatgccttctttctcctcaacacgctccttgatcctatcgatcgtgtcggtgggctca 1678

                                                                        
Query: 326  atatcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctg 385
            || ||||| ||||| || || ||||  || ||||| |||||||||||||| |||||||||
Sbjct: 1677 atgtcaatttcaatctcttttccagtgagggtcttaaccttgatcatagtgccacccctg 1618

                                                                        
Query: 386  agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgc 445
            ||||| |||||||| || || ||  |||| |||||||||||||| || || | ||| |||
Sbjct: 1617 agcctgaggaccaagtgaagagttgactccttctgaatgttgtagtcggccagtgtgcgc 1558

                             
Query: 446  ccatcttncaactgctt 462
            ||||||| || ||||||
Sbjct: 1557 ccatcttccagctgctt 1541



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                        
Query: 148  accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
            |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 1998 accacccctcagagcaaggacaagatggaggacagagccaccttcgatgttatagtcctt 1939

                                                         
Query: 208  tgcagttttgtcatcagcgagttgcttcccagcatagatgagcct 252
             ||||| ||||| || || || ||||| ||||||||||| |||||
Sbjct: 1938 cgcagtcttgtcgtcggcaagctgcttaccagcatagataagcct 1894



to top

>dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0668D04
          Length = 148848

 Score =  159 bits (80), Expect = 1e-35
 Identities = 167/197 (84%)
 Strand = Plus / Minus

                                                                         
Query: 266   ggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctca 325
             ||||| || ||||||||||||||||| |||||||| |||||||| ||||| |||||||||
Sbjct: 99404 ggaatgccttctttctcctcaacacgctccttgatcctatcgatcgtgtcggtgggctca 99345

                                                                         
Query: 326   atatcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctg 385
             || ||||| ||||| || || ||||  || ||||| |||||||||||||| |||||||||
Sbjct: 99344 atgtcaatttcaatctcttttccagtgagggtcttaaccttgatcatagtgccacccctg 99285

                                                                         
Query: 386   agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgc 445
             ||||| |||||||| || || ||  |||| |||||||||||||| || || | ||| |||
Sbjct: 99284 agcctgaggaccaagtgaagagttgactccttctgaatgttgtagtcggccagtgtgcgc 99225

                              
Query: 446   ccatcttncaactgctt 462
             ||||||| || ||||||
Sbjct: 99224 ccatcttccagctgctt 99208



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 148   accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
             |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 99665 accacccctcagagcaaggacaagatggaggacagagccaccttcgatgttatagtcctt 99606

                                                          
Query: 208   tgcagttttgtcatcagcgagttgcttcccagcatagatgagcct 252
              ||||| ||||| || || || ||||| ||||||||||| |||||
Sbjct: 99605 cgcagtcttgtcgtcggcaagctgcttaccagcatagataagcct 99561



to top

>gb|AF240445.1|AF240445 Populus tremula x Populus tremuloides polyubiquitin (Ubi) mRNA,
           complete cds
          Length = 750

 Score =  147 bits (74), Expect = 4e-32
 Identities = 234/288 (81%)
 Strand = Plus / Minus

                                                                       
Query: 148 accacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtcctt 207
           |||||||||||||||||| |||||||| ||||| || ||||| || || ||||||||   
Sbjct: 547 accacccctcagagcaagaacaagatgaagcacagagccaccctcaatattgtagtcgcg 488

                                                                       
Query: 208 tgcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgg 267
            || || ||||||||  | || ||||| |||||||| || ||||| || || || || ||
Sbjct: 487 agctgtcttgtcatctccaagctgcttgccagcataaataagcctttgctgcactggagg 428

                                                                       
Query: 268 aataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaat 327
           ||| || |||||||||||||| ||||||||||| ||||| || || ||| | || |||||
Sbjct: 427 aattccttctttctcctcaacccgttccttgatcctatcaatggtatcatttggttcaat 368

                                                                       
Query: 328 atcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagttccacccctgag 387
            ||||| |||||||| || ||||  || ||||||||||||||||||||||| ||||| ||
Sbjct: 367 gtcaatttcaatttcttttccagtgagagtcttcaccttgatcatagttcctcccctaag 308

                                                           
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||  ||||  || || ||  |||| ||||| ||||||||||||||
Sbjct: 307 cctcaaaaccaggtgaagagtggactccttctggatgttgtaatcagc 260



to top

>gb|AF297089.1|AF297089 Coffea arabica ubiquitin-like protein UBI9 mRNA, partial cds
          Length = 314

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 ccacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtccttt 208
           ||||| ||||||||||| |||||||| || || |||||||| || ||||||||||| || 
Sbjct: 147 ccacctctcagagcaagaacaagatgaagaacagaaccaccctcaatgttgtagtcttta 88

                                                                       
Query: 209 gcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgga 268
           ||||||||||||||  | || ||||| ||||||||||||||||| || || ||||| |||
Sbjct: 87  gcagttttgtcatccccaagctgcttgccagcatagatgagcctttgctgcacaggggga 28

                            
Query: 269 ataccctctttctcctc 285
           || || |||||||||||
Sbjct: 27  attccttctttctcctc 11



to top

>emb|AJ270957.1|LES270957 Lycopersicon esculentum partial mRNA for ubiquitin-like protein,
           clone mo5-3G12/4
          Length = 345

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 120/147 (81%)
 Strand = Plus / Minus

                                                                       
Query: 149 ccacccctcagagcaagcacaagatggagcactgaaccaccttcgatgttgtagtccttt 208
           |||||||| || ||||| ||||| || || || |||||||||||||| || ||||| || 
Sbjct: 148 ccacccctaagtgcaagaacaaggtgaagaacagaaccaccttcgatattatagtcttta 89

                                                                       
Query: 209 gcagttttgtcatcagcgagttgcttcccagcatagatgagcctctgttgaacaggtgga 268
           || || |||||||| || || || || |||||||| || ||||| || || ||||| || 
Sbjct: 88  gctgtcttgtcatctgctagctgttttccagcataaataagcctttgctgcacaggaggt 29

                                      
Query: 269 ataccctctttctcctcaacacgttcc 295
           || || |||||||||||||||||||||
Sbjct: 28  attccttctttctcctcaacacgttcc 2



to top

>dbj|AB240583.1| Physcomitrella patens ubq1 mRNA for putative polyubiquitin,
           complete cds
          Length = 604

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 248 agcctctgttgaacaggtggaataccctctttctcctcaacacgttccttgattctatcg 307
           ||||| ||||| || || ||||| ||||| || ||||| ||||| |||||||| |  |||
Sbjct: 401 agcctttgttgtacgggaggaatgccctccttttcctccacacgctccttgatgcgctcg 342

                                                                       
Query: 308 attgtgtcagtgggctcaatatcaatctcaatttccttcccagnaagtgtcttcaccttg 367
           || ||||||   |||||||| ||||| ||||||||||| ||||  || |||||||| |||
Sbjct: 341 atggtgtcataaggctcaatgtcaatttcaatttccttgccagtgagggtcttcactttg 282

                   
Query: 368 atcatagt 375
           ||||||||
Sbjct: 281 atcatagt 274



to top

>ref|NM_102190.2| Arabidopsis thaliana protein binding / structural constituent of
           ribosome AT1G23410 mRNA, complete cds
          Length = 608

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           |||||||| |||||| |||||||||| |||||||||||||||| |||||  ||||||| |
Sbjct: 225 accaaatgaagcgtcgactctttctggatgttgtaatcagctagtgttcttccatcttcc 166

             
Query: 455 aa 456
           ||
Sbjct: 165 aa 164



to top

>gb|BT024763.1| Arabidopsis thaliana At1g23410 mRNA, complete cds
          Length = 471

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           |||||||| |||||| |||||||||| |||||||||||||||| |||||  ||||||| |
Sbjct: 209 accaaatgaagcgtcgactctttctggatgttgtaatcagctagtgttcttccatcttcc 150

             
Query: 455 aa 456
           ||
Sbjct: 149 aa 148



to top

>gb|AY085389.1| Arabidopsis thaliana clone 1496 mRNA, complete sequence
          Length = 605

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           |||||||| |||||| |||||||||| |||||||||||||||| |||||  ||||||| |
Sbjct: 225 accaaatgaagcgtcgactctttctggatgttgtaatcagctagtgttcttccatcttcc 166

             
Query: 455 aa 456
           ||
Sbjct: 165 aa 164



to top

>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I,
             complete sequence
          Length = 99053

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 395   accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
             |||||||| |||||| |||||||||| |||||||||||||||| |||||  ||||||| |
Sbjct: 91504 accaaatgaagcgtcgactctttctggatgttgtaatcagctagtgttcttccatcttcc 91445

               
Query: 455   aa 456
             ||
Sbjct: 91444 aa 91443



to top

>gb|AC007945.3|AC007945 Genomic sequence for Arabidopsis thaliana BAC F28C11 from chromosome I,
             complete sequence
          Length = 80472

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 395   accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
             |||||||| |||||| |||||||||| |||||||||||||||| |||||  ||||||| |
Sbjct: 19039 accaaatgaagcgtcgactctttctggatgttgtaatcagctagtgttcttccatcttcc 18980

               
Query: 455   aa 456
             ||
Sbjct: 18979 aa 18978



to top

>dbj|AB240584.1| Physcomitrella patens ubq1 gene for putative polyubiquitin,
           complete cds
          Length = 1100

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 ggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctca 325
           ||||| ||||| || ||||| ||||| |||||||| |  ||||| ||||||   ||||||
Sbjct: 660 ggaatgccctccttttcctccacacgctccttgatgcgctcgatggtgtcataaggctca 601

                                                             
Query: 326 atatcaatctcaatttccttcccagnaagtgtcttcaccttgatcatagt 375
           || ||||| ||||||||||| ||||  || |||||||| |||||||||||
Sbjct: 600 atgtcaatttcaatttccttgccagtgagggtcttcactttgatcatagt 551



to top

>gb|AY389656.1| Hyacinthus orientalis ubiquitin fusion protein UBC mRNA, partial
           cds
          Length = 537

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagct 436
           |||||||| |||||||| |||| ||| || ||  |||| ||||| |||||||||||||||
Sbjct: 198 ccacccctcagcctcagtaccagatgcagagtggactcgttctggatgttgtaatcagct 139

                                              
Query: 437 aatgttcgcccatcttncaactgctttncagcaaa 471
           |  ||||||||||| | || ||||||| | |||||
Sbjct: 138 agggttcgcccatcctccagctgctttccggcaaa 104



to top

>emb|X17020.1|PISUMPUI Pea PU1 gene mRNA for polyubiquitin
          Length = 1241

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 411 actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
           |||| |||||||||||||||||||| || ||||| |||||||  | ||||||| ||||||
Sbjct: 896 actccttctgaatgttgtaatcagccaaagttcggccatcttcaagctgctttccagcaa 837

               
Query: 471 aaat 474
           ||||
Sbjct: 836 aaat 833



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaa 472
           ||||||||||||||||| || || || ||||| |||||||  | ||||||| ||||||||
Sbjct: 666 tctttctgaatgttgtagtcggccaaagttcggccatcttcgagctgctttccagcaaaa 607

             
Query: 473 at 474
           ||
Sbjct: 606 at 605



to top

>gb|L81140.1| Pisum sativum (Alaska) ubiquitin (PUB2) gene, complete cds
          Length = 2482

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                        
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
            |||| |||||||||||||||||||| || ||||| |||||||  | ||||||| ||||||
Sbjct: 1796 actccttctgaatgttgtaatcagccaaagttcggccatcttcaagctgctttccagcaa 1737

                
Query: 471  aaat 474
            ||||
Sbjct: 1736 aaat 1733



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 49/59 (83%)
 Strand = Plus / Minus

                                                                       
Query: 413  tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            |||||||| ||||||||||| || || ||||| |||||||  | ||||||| | |||||
Sbjct: 1338 tctttctggatgttgtaatcggccaaagttcggccatcttcaagctgctttccggcaaa 1280



to top

>gb|L81139.1| Pisum sativum (Alaska) ubiquitin (PUB1) gene, complete cds
          Length = 2536

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
            ||||||||||| ||  |||| ||||| |||||||||||||| |  |||||||| || | |
Sbjct: 1025 accaaatggagtgtggactccttctggatgttgtaatcagcaagggttcgcccgtcctcc 966

                                
Query: 455  aactgctttncagcaaaaat 474
            | ||||||| ||||||||||
Sbjct: 965  agctgctttccagcaaaaat 946



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  |||| ||||| |||||||||||||| || |||| ||| || | |
Sbjct: 797 accaaatggagtgtggactccttctggatgttgtaatcagccaaggttctcccgtcctcc 738

                               
Query: 455 aactgctttncagcaaaaat 474
           | ||||||| ||||||||||
Sbjct: 737 agctgctttccagcaaaaat 718



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatctt 452
            |||||||||||||||||||||| ||||| ||||| |||||||
Sbjct: 1237 actctttctgaatgttgtaatctgctaaagttcggccatctt 1196



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 49/59 (83%)
 Strand = Plus / Minus

                                                                       
Query: 416  ttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaat 474
            ||||| || ||||||||||| || ||||| |||||||  |  |||||| ||||||||||
Sbjct: 1688 ttctggatattgtaatcagccaaagttcggccatcttcgagttgctttccagcaaaaat 1630



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 227  agttgcttcccagcatagatgagcctctgttgaacaggtggaataccctcttt 279
            ||||| || |||||| |||| |||||||| ||| | ||||| |||||||||||
Sbjct: 1421 agttgttttccagcaaagataagcctctgctgatctggtgggataccctcttt 1369



to top

>emb|X66876.1|AOPOLUBI A.officinalis mRNA for poly-ubiquitin
          Length = 743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 386 agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||||| ||||| ||||| ||| |||| ||||||||||||||||||||
Sbjct: 289 agcctcagcaccaagtggagggtcgactccttctgaatgttgtaatcagc 240



to top

>gb|AC170154.2| Phakopsora pachyrhizi clone JGIAFNA-1965K4, complete sequence
          Length = 38852

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                         
Query: 413   tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaa 472
             |||||||| |||||||||||||| ||||| || |||||||  || |||||| | ||||||
Sbjct: 22938 tctttctggatgttgtaatcagccaatgtgcgaccatcttctaattgctttcctgcaaaa 22997

                 
Query: 473   atta 476
             ||||
Sbjct: 22998 atta 23001



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 392   aggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
             |||||||| || || ||| | |||||||||||||| ||||||||
Sbjct: 24365 aggaccaagtgaagggtcgattctttctgaatgttataatcagc 24408



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 411   actctttctgaatgttgtaatcagc 435
             ||||||| |||||||||||||||||
Sbjct: 22649 actctttttgaatgttgtaatcagc 22673



to top

>ref|XM_780079.1| PREDICTED: Strongylocentrotus purpuratus similar to CG10679-PA
           (LOC579994), mRNA
          Length = 237

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 323 tcaatatcaatctcaatttccttcccagnaagtgtcttcaccttgatca 371
           ||||| ||||||||||| || |||||||  |||||||||||||||||||
Sbjct: 53  tcaatgtcaatctcaatctctttcccagtgagtgtcttcaccttgatca 5



to top

>emb|X77456.1|NTUBIU4 N.tabacum Ubi.U4 gene
          Length = 2785

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 416  ttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            ||||| ||||||||||||||||  ||||| ||||||| |||||||||  |||||||
Sbjct: 2003 ttctggatgttgtaatcagctagggttcggccatcttccaactgcttaccagcaaa 1948



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                        
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
            |||| |||||||||||||||||||| |  ||||| ||||||| ||| |||||| | ||||
Sbjct: 2463 actccttctgaatgttgtaatcagcgagggttcgtccatcttccaattgctttcccgcaa 2404

             
Query: 471  a 471
            |
Sbjct: 2403 a 2403



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 407  gtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttnca 466
            ||| |||| ||||| |||||||||||||| |  ||||| ||||||| |||||| ||  ||
Sbjct: 2240 gtcgactccttctggatgttgtaatcagcgagggttcggccatcttccaactgtttacca 2181

                 
Query: 467  gcaaa 471
            |||||
Sbjct: 2180 gcaaa 2176



to top

>emb|AJ841743.1| Plantago major ubi1 gene for ubiquitin
          Length = 231

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||||||||| ||  ||||||||||||||||||||||
Sbjct: 212 aggaccaaatggagagtggactctttctgaatgttgtaatc 172



to top

>emb|AJ844617.1| Plantago major mRNA for polyubiquitin (ubq3 gene)
          Length = 1319

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||||||||| ||  ||||||||||||||||||||||
Sbjct: 200 aggaccaaatggagagtggactctttctgaatgttgtaatc 160



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||||||||||| ||  |||| ||||| |||||||| |||||
Sbjct: 428 aggaccaaatggagggtggactccttctggatgttgtagtcagc 385



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 ttctgaatgttgtaatcagc 435
           ||||||||||||||||||||
Sbjct: 632 ttctgaatgttgtaatcagc 613



to top

>gb|L81142.1| Pisum sativum (Alaska) ubuquitin (PUB4) gene, complete cds
          Length = 2750

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 227  agttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
            ||||| || |||||| ||||||||||||||||  |||||||||| |||||||| ||||
Sbjct: 1495 agttgtttgccagcaaagatgagcctctgttggtcaggtggaatgccctctttatcct 1438



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                        
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
            |||||||||| |||||||||||||| |  ||||  |||||||  | ||||||| ||||||
Sbjct: 1767 actctttctggatgttgtaatcagccagggttcttccatcttcgagctgctttccagcaa 1708

                
Query: 471  aaat 474
            ||||
Sbjct: 1707 aaat 1704



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
            ||||||||||| ||  | || ||||| |||||||||||||| |  || |||||||| | |
Sbjct: 1327 accaaatggagagttgattccttctgtatgttgtaatcagcaagggtacgcccatcctcc 1268

                                
Query: 455  aactgctttncagcaaaaat 474
            | ||||||  ||||||||||
Sbjct: 1267 agctgcttgccagcaaaaat 1248



to top

>gb|L81141.1| Pisum sativum (Alaska) ubiquitin (PUB3) gene, complete cds
          Length = 2544

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
            |||||||||| ||||||||||||||||  ||||  |||||||  | ||||||| ||||||
Sbjct: 1672 actctttctggatgttgtaatcagctagagttctgccatcttcgagctgctttccagcaa 1613

                
Query: 471  aaat 474
            ||||
Sbjct: 1612 aaat 1609



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatctt 452
            |||| ||||||||||| |||||||| |||||||| |||||||
Sbjct: 1900 actccttctgaatgttataatcagccaatgttcggccatctt 1859



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                        
Query: 411  actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
            |||||||||| |||||||||||||| |  ||||| |||||||  | ||| ||| ||||||
Sbjct: 1444 actctttctgtatgttgtaatcagccagggttcggccatcttcaagctgttttccagcaa 1385

             
Query: 471  a 471
            |
Sbjct: 1384 a 1384



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 411  actctttctgaatgttgtaatcagc 435
            |||| ||||||||||||||||||||
Sbjct: 2128 actccttctgaatgttgtaatcagc 2104



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 236  ccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
            |||||| |||| |||||||||||  | |||||||| |||||||| ||||
Sbjct: 1163 ccagcaaagataagcctctgttggtctggtggaatgccctctttatcct 1115



to top

>gb|DQ011576.1| Euphorbia characias polyubiquitin mRNA, partial cds
          Length = 1100

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 416 ttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
           |||||||||||||||||||| || || || ||||||| ||| |||||| |||||||
Sbjct: 830 ttctgaatgttgtaatcagccaaggtccggccatcttccaattgctttccagcaaa 775



to top

>gb|AC158180.2| Selaginella moellendorffii chromosome JGIASXY-5A14, complete sequence
          Length = 36906

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagc 435
            ||||||||||||||| |||| ||||| ||||||||||||||
Sbjct: 5524 accaaatggagcgtcgactccttctggatgttgtaatcagc 5484



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 392  aggaccaaatggagcgtcnactctttctgaatgttgta 429
            |||||||||||||||||| |||| ||||| ||||||||
Sbjct: 5071 aggaccaaatggagcgtcgactccttctggatgttgta 5034



to top

>gb|AC170150.2| Phakopsora pachyrhizi clone JGIAFNA-1237E23, complete sequence
          Length = 35279

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                         
Query: 413   tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaa 472
             |||||||| |||||||||||||| ||||| || |||||||  || |||||| | ||||||
Sbjct: 15789 tctttctggatgttgtaatcagccaatgtgcgaccatcttctaattgctttcctgcaaaa 15848

                 
Query: 473   atta 476
             ||||
Sbjct: 15849 atta 15852



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 392   aggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
             |||||||| || || ||| | |||||||||||||| ||||||||
Sbjct: 17216 aggaccaagtgaagggtcgattctttctgaatgttataatcagc 17259



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 411   actctttctgaatgttgtaatcagc 435
             ||||||| |||||||||||||||||
Sbjct: 15500 actctttttgaatgttgtaatcagc 15524



to top

>gb|BC074652.1| Xenopus tropicalis ubiquitin C, mRNA (cDNA clone MGC:69388
           IMAGE:5335302), complete cds
          Length = 2021

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
           ||||||||||||||||||||||  | ||| || ||||||| || ||||||| |||||||
Sbjct: 713 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccagcaaa 655



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 413  tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            ||||||||||||||||||||||  | ||| || ||||||| || ||||||| | |||||
Sbjct: 1625 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccggcaaa 1567



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 413  tctttctgaatgttgtaatcag 434
            ||||||||||||||||||||||
Sbjct: 1853 tctttctgaatgttgtaatcag 1832



to top

>emb|CT025321.2| Xenopus tropicalis finished cDNA, clone TNeu128o12
          Length = 1953

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
           ||||||||||||||||||||||  | ||| || ||||||| || ||||||| |||||||
Sbjct: 696 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccagcaaa 638



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 413  tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            ||||||||||||||||||||||  | ||| || ||||||| || ||||||| | |||||
Sbjct: 1608 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccggcaaa 1550



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 413  tctttctgaatgttgtaatcag 434
            ||||||||||||||||||||||
Sbjct: 1836 tctttctgaatgttgtaatcag 1815



to top

>gb|AY057500.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, complete cds
          Length = 1319

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 63/75 (84%)
 Strand = Plus / Minus

                                                                       
Query: 389 ctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccca 448
           |||||||||||||| || ||  |||| |||||||||||||| ||||| || ||||  |||
Sbjct: 509 ctcaggaccaaatgaagggtggactccttctgaatgttgtagtcagccaaagttctgcca 450

                          
Query: 449 tcttncaactgcttt 463
           |||| || |||||||
Sbjct: 449 tcttccagctgcttt 435



to top

>ref|NM_001006687.1| Xenopus tropicalis ubiquitin C (ubc), mRNA
          Length = 2021

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
           ||||||||||||||||||||||  | ||| || ||||||| || ||||||| |||||||
Sbjct: 713 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccagcaaa 655



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 413  tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            ||||||||||||||||||||||  | ||| || ||||||| || ||||||| | |||||
Sbjct: 1625 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccggcaaa 1567



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 413  tctttctgaatgttgtaatcag 434
            ||||||||||||||||||||||
Sbjct: 1853 tctttctgaatgttgtaatcag 1832



to top

>emb|CR848533.2| Xenopus tropicalis finished cDNA, clone TEgg052p01
          Length = 1929

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
           ||||||||||||||||||||||  | ||| || ||||||| || ||||||| |||||||
Sbjct: 658 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccagcaaa 600



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 413  tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            ||||||||||||||||||||||  | ||| || ||||||| || ||||||| | |||||
Sbjct: 1570 tctttctgaatgttgtaatcagagagtgtgcggccatcttccagctgctttccggcaaa 1512



to top

>gb|BT012724.1| Lycopersicon esculentum clone 113652F, mRNA sequence
          Length = 1579

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagcta 437
           ||||| ||||| ||  |||||||||||||||||||||||||||
Sbjct: 258 accaagtggagagttgactctttctgaatgttgtaatcagcta 216



to top

>gb|BT012698.1| Lycopersicon esculentum clone 113569R, mRNA sequence
          Length = 1626

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  |||| ||||| |||||||| |||||||  || || ||||||| |
Sbjct: 497 accaaatggagggtggactccttctggatgttgtagtcagctagggtgcggccatcttcc 438

                            
Query: 455 aactgctttncagcaaa 471
           ||||||||| | |||||
Sbjct: 437 aactgctttcctgcaaa 421



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  |||| ||||| ||||||||||||||||  || || || || | |
Sbjct: 269 accaaatggagggtggactccttctggatgttgtaatcagctagagtacgtccgtcctcc 210

                         
Query: 455 aactgctttncagc 468
           ||||||||| ||||
Sbjct: 209 aactgctttccagc 196



to top

>emb|Y10639.1|CCPOLYUBQ C.capitata gene encoding polyubiquitin, partial
          Length = 403

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 394 gaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttn 453
           |||||||||||| ||  |||| || || ||||||||||| | |||||| || ||||||| 
Sbjct: 189 gaccaaatggagggtggactccttttggatgttgtaatcggataatgtacgtccatcttc 130

                                
Query: 454 caactgctttncagcaaaaat 474
           |||||||||  |||| |||||
Sbjct: 129 caactgcttaccagcgaaaat 109



to top

>ref|NM_171868.3| Caenorhabditis elegans UBiQuitin family member (ubq-1) (ubq-1)
           mRNA, complete cds
          Length = 1622

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||| ||||| ||  ||||||||||||| ||||||||||  | ||| || ||||||| |
Sbjct: 442 accaagtggagagtagactctttctgaatattgtaatcagagagtgtgcgtccatcttcc 383

                            
Query: 455 aactgctttncagcaaa 471
           || |||||| |||||||
Sbjct: 382 aattgctttccagcaaa 366



to top

>ref|NM_171139.3| Caenorhabditis elegans UBiQuitin family member (ubq-1) (ubq-1)
           mRNA, complete cds
          Length = 2826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||| ||||| ||  ||||||||||||| ||||||||||  | ||| || ||||||| |
Sbjct: 620 accaagtggagagtagactctttctgaatattgtaatcagagagtgtgcgtccatcttcc 561

                            
Query: 455 aactgctttncagcaaa 471
           || |||||| |||||||
Sbjct: 560 aattgctttccagcaaa 544



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 416  ttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaa 471
            |||||||||||||||||||  |  || |||||||||| ||| |||||| | |||||
Sbjct: 1739 ttctgaatgttgtaatcagagagcgtgcgcccatcttccaattgctttccggcaaa 1684



to top

>gb|AF148448.1|AF148448 Sporobolus stapfianus polyubiquitin mRNA, complete cds
          Length = 1423

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           ||||||||||||||||||||||  ||||| ||  |||| ||||| |||||||| |||||
Sbjct: 520 ccacccctgagcctcaggaccaggtggagggtggactccttctggatgttgtagtcagc 462



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||||||||||| ||||| |  ||||| ||  |||| ||||| ||||||||||||||
Sbjct: 748 ccacccctgagcctgaggacaaggtggagggtggactccttctggatgttgtaatcagc 690



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgta 429
           |||||||||||||||||||| |  ||||| ||  |||| ||||| ||||||||
Sbjct: 976 ccacccctgagcctcaggacgaggtggagggtggactccttctggatgttgta 924



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 380 cccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           ||||||||||| ||||| |  ||||| ||  |||| ||||| ||||||||||||||
Sbjct: 289 cccctgagcctgaggacaaggtggagggtggactccttctggatgttgtaatcagc 234



to top

>gb|AY452186.1| Plasmodiophora brassicae polyubiquitin 5 gene, partial cds
          Length = 295

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 391 caggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||||||| |||||| |||| ||||| |||||||||||
Sbjct: 193 caggaccaaatgcagcgtcgactccttctggatgttgtaatc 152



to top

>gb|AF481059.1| Aplysia californica ubiquitin/ribosomal L40 fusion protein mRNA,
           partial cds
          Length = 372

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| | |||||  |||| |||||| ||  ||||||||||||||||||||||||
Sbjct: 212 ccacccctcaacctcaacaccagatggagagtggactctttctgaatgttgtaatcag 155



to top

>emb|Z28649.1|ACPOLUB Acetabularia cliftonii gene for polyubiquitin
          Length = 3442

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
            ||||||||||| ||  ||||||| || || || |||||||| || ||| | ||||||| |
Sbjct: 2389 accaaatggagagtagactctttttggatattataatcagccaaagttagtccatcttcc 2330

                                
Query: 455  aactgctttncagcaaaaat 474
            ||||||||| | ||||||||
Sbjct: 2329 aactgctttccggcaaaaat 2310



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 62/77 (80%)
 Strand = Plus / Minus

                                                                        
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
            ||||||||||| ||  |||| || |||||||||||||| || || || || || |||| |
Sbjct: 2161 accaaatggagggtggactccttttgaatgttgtaatccgccaaagtccgtccgtcttcc 2102

                             
Query: 455  aactgctttncagcaaa 471
            || |||||| | |||||
Sbjct: 2101 aattgctttccggcaaa 2085



to top

>emb|X67957.1|AMUBIQMRP A.majus mRNA for ubiquitin (partial)
          Length = 1094

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgta 429
           |||||| |||||||| || ||| |||||||||||||||||||
Sbjct: 647 cctcagcaccaaatgcagagtcgactctttctgaatgttgta 606



to top

>gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-62p11, complete
             sequence
          Length = 95165

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                         
Query: 395   accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
             ||||||||||| ||  |||| ||||| ||||| |||||||| |  || |||||||| | |
Sbjct: 64760 accaaatggagggtggactccttctggatgttataatcagcaagggtacgcccatcctcc 64701

                                 
Query: 455   aactgctttncagcaaaaat 474
             | ||||||| ||||||||||
Sbjct: 64700 agctgctttccagcaaaaat 64681



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 411   actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
             |||||||||| |||||||||||||| |  ||||  |||||||  | ||||||| ||||||
Sbjct: 65200 actctttctggatgttgtaatcagcaagagttctgccatcttcaagctgctttccagcaa 65141

                 
Query: 471   aaat 474
             ||||
Sbjct: 65140 aaat 65137



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                         
Query: 411   actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
             |||||||||||||||| |||||||| || || || |||||||  | ||||||  ||||||
Sbjct: 65884 actctttctgaatgttataatcagccaaagtccggccatcttcaagctgcttcccagcaa 65825

              
Query: 471   a 471
             |
Sbjct: 65824 a 65824



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 230   tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
             ||||| |||||| | ||||||||||| ||| | || |||||||||||||| ||||
Sbjct: 65153 tgctttccagcaaaaatgagcctctgctgatctgggggaataccctctttgtcct 65099



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 236   ccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
             |||||| ||||||||||||| ||  | ||||||||||| ||||| ||||
Sbjct: 64919 ccagcaaagatgagcctctgctggtctggtggaataccttctttgtcct 64871



to top

>gb|BC102306.1| Bos taurus neural precursor cell expressed, developmentally
           down-regulated 8, mRNA (cDNA clone MGC:127311
           IMAGE:7948951), complete cds
          Length = 658

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 ggtggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggc 322
           |||||||| |||||||||||||| ||||| ||||| ||||  || |   |||| ||||| 
Sbjct: 182 ggtggaattccctctttctcctccacacgctccttaattcgttccaccttgtccgtgggt 123

                                  
Query: 323 tcaatatcaatctcaatttcctt 345
           ||||| ||||||||||| |||||
Sbjct: 122 tcaatgtcaatctcaatctcctt 100



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 155 ctcagagcaagcacaagatggagcactgaaccacct 190
           |||||||| | ||| |||||||| ||||||||||||
Sbjct: 290 ctcagagccaacaccagatggaggactgaaccacct 255



to top

>gb|AF227256.1|AF227256 Bos taurus NEDD8 mRNA, complete cds
          Length = 317

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 ggtggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggc 322
           |||||||| |||||||||||||| ||||| ||||| ||||  || |   |||| ||||| 
Sbjct: 147 ggtggaattccctctttctcctccacacgctccttaattcgttccaccttgtccgtgggt 88

                                  
Query: 323 tcaatatcaatctcaatttcctt 345
           ||||| ||||||||||| |||||
Sbjct: 87  tcaatgtcaatctcaatctcctt 65



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 155 ctcagagcaagcacaagatggagcactgaaccacct 190
           |||||||| | ||| |||||||| ||||||||||||
Sbjct: 255 ctcagagccaacaccagatggaggactgaaccacct 220



to top

>gb|AF227253.1|AF227253 Bovine viral diarrhea virus-1 strain CP821 polyprotein gene,
           partial cds
          Length = 654

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 ggtggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggc 322
           |||||||| |||||||||||||| ||||| ||||| ||||  || |   |||| ||||| 
Sbjct: 368 ggtggaattccctctttctcctccacacgctccttaattcgttccaccttgtccgtgggt 309

                                  
Query: 323 tcaatatcaatctcaatttcctt 345
           ||||| ||||||||||| |||||
Sbjct: 308 tcaatgtcaatctcaatctcctt 286



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 155 ctcagagcaagcacaagatggagcactgaaccacct 190
           |||||||| | ||| |||||||| ||||||||||||
Sbjct: 476 ctcagagccaacaccagatggaggactgaaccacct 441



to top

>ref|NM_174764.3| Bos taurus neural precursor cell expressed, developmentally
           down-regulated 8 (NEDD8), mRNA
          Length = 658

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 ggtggaataccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggc 322
           |||||||| |||||||||||||| ||||| ||||| ||||  || |   |||| ||||| 
Sbjct: 182 ggtggaattccctctttctcctccacacgctccttaattcgttccaccttgtccgtgggt 123

                                  
Query: 323 tcaatatcaatctcaatttcctt 345
           ||||| ||||||||||| |||||
Sbjct: 122 tcaatgtcaatctcaatctcctt 100



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 155 ctcagagcaagcacaagatggagcactgaaccacct 190
           |||||||| | ||| |||||||| ||||||||||||
Sbjct: 290 ctcagagccaacaccagatggaggactgaaccacct 255



to top

>gb|M74156.1|TOBUBI4A Nicotiana sylvestris (clone 6PU4) pentameric polyubiquitin (ubi4)
           mRNA, complete cds
          Length = 1321

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 411 actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
           |||| ||||| |||||||||||||| |  ||||| ||||||| |||||||||  ||||||
Sbjct: 866 actccttctggatgttgtaatcagcaagggttcggccatcttccaactgcttaccagcaa 807

            
Query: 471 a 471
           |
Sbjct: 806 a 806



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 407 gtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttnca 466
           ||| |||| |||||||| |||||||||||||| || |  ||||||| ||| |||||  ||
Sbjct: 642 gtcgactccttctgaatattgtaatcagctaaggtccttccatcttccaattgcttacca 583

                   
Query: 467 gcaaaaat 474
           ||||||||
Sbjct: 582 gcaaaaat 575



to top

>gb|AY684128.2| Vitis vinifera polyubiquitin mRNA, partial cds
          Length = 118

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||| ||||| ||  ||||||||||||||||||||||
Sbjct: 83  aggaccaagtggagggtggactctttctgaatgttgtaatc 43



to top

>gb|AY496112.1| Capsicum annuum hexameric polyubiquitin 6PU11 (ubi11) mRNA,
           complete cds
          Length = 705

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           ||||||||||| ||  |||||||||| ||||||||||||||
Sbjct: 282 accaaatggagtgtggactctttctggatgttgtaatcagc 242



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaa 472
           |||||||||||||| |||||||| |  || || ||||| | || ||||||  ||||||||
Sbjct: 492 tctttctgaatgttataatcagcaagggtgcgaccatcctccagctgcttaccagcaaaa 433

             
Query: 473 at 474
           ||
Sbjct: 432 at 431



to top

>ref|XM_537389.2| PREDICTED: Canis familiaris similar to neural precursor cell
           expressed, developmentally down-regulated gene 8
           (LOC480265), mRNA
          Length = 589

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           |||||||||||||| ||||| ||||||||||  || |   |||| ||||| ||||| |||
Sbjct: 201 ccctctttctcctccacacgctccttgattcgctccaccttgtctgtgggttcaatgtca 142

                         
Query: 332 atctcaatttcctt 345
           |||||||| |||||
Sbjct: 141 atctcaatctcctt 128



to top

>emb|X64344.1|PCCUBI41 P.crispum mRNA Pcubi4-1 for polyubiquitin
          Length = 1592

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 385 gagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcg 444
           |||||| || ||||||||||| ||  |||| ||||| |||||||| ||||| |  || | 
Sbjct: 245 gagcctgagcaccaaatggagagttgactccttctggatgttgtagtcagcaagagtcct 186

                                      
Query: 445 cccatcttncaactgctttncagcaaa 471
            ||||||| |||||||||| |||||||
Sbjct: 185 gccatcttccaactgctttccagcaaa 159



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           ||||||||||||||  |||| ||||| |||||||| |||||
Sbjct: 463 accaaatggagcgtagactccttctggatgttgtagtcagc 423



to top

>emb|AJ223330.1|NTAJ3330 Nicotiana tabacum TUQG4 gene, complete CDS
          Length = 2096

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 419  tgaatgttgtaatcagctaatgttcgcccatctt 452
            ||||||||||||||||||||||| || |||||||
Sbjct: 1268 tgaatgttgtaatcagctaatgtgcggccatctt 1235



to top

>dbj|D26092.1|SOYSUBI2 Glycine max SUBI-2 gene for ubiquitin, complete cds
          Length = 2075

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 227  agttgcttcccagcatagatgagcctctgttgaacaggtggaataccctc 276
            ||||||||||||||| | || |||||||| ||| |||||||||| |||||
Sbjct: 1570 agttgcttcccagcaaaaataagcctctgctgatcaggtggaatgccctc 1521



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 416  ttctgaatgttgtaatcagc 435
            ||||||||||||||||||||
Sbjct: 1153 ttctgaatgttgtaatcagc 1134



to top

>ref|NM_111814.1| Arabidopsis thaliana UBQ8 AT3G09790 (UBQ8) mRNA, complete cds
          Length = 2331

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||| ||||| ||||| ||  |||||||||| ||||||||||||||
Sbjct: 408 cctcagaaccaagtggagagttgactctttctggatgttgtaatcagc 361



to top

>gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence,
             complete sequence
          Length = 72902

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                             
Query: 388   cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
             |||||| ||||| ||||| ||  |||||||||| ||||||||||||||
Sbjct: 60937 cctcagaaccaagtggagagttgactctttctggatgttgtaatcagc 60890



to top

>emb|AL450063.14| Human DNA sequence from clone RP11-82H13 on chromosome 1 Contains the 3'
              end of the PRKACB gene for cAMP-dependent catalytic protein
              kinase beta and a neural precursor cell expressed
              developmentally down-regulated 8 (NEDD8) pseudogene,
              complete sequence
          Length = 130878

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                          
Query: 272    ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
              |||||||||||||| ||| | ||||||||||  || |   |||| || || |||||||||
Sbjct: 115399 ccctctttctcctccacatgctccttgattcactccaccttgtctgtaggttcaatatca 115340

                                              
Query: 332    atctcaatttccttcccagnaagtgtcttcac 363
              |||||| | ||||| ||||  |||||||||||
Sbjct: 115339 atctcagtctcctttccagttagtgtcttcac 115308



to top

>emb|AJ223329.1|NTAJ3329 Nicotiana tabacum TUQG3 gene, complete CDS
          Length = 1918

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatc 450
            ||||||||||| ||  |||| ||||| ||||||||||||||||  ||||| |||||
Sbjct: 1319 accaaatggagagtggactccttctggatgttgtaatcagctagagttcgaccatc 1264



to top

>ref|XM_936308.1| PREDICTED: Homo sapiens hypothetical protein LOC642156 (LOC642156),
           mRNA
          Length = 583

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           |||||||||||||| ||| | ||||||||||  || |   |||| || || |||||||||
Sbjct: 168 ccctctttctcctccacatgctccttgattcactccaccttgtctgtaggttcaatatca 109

                                           
Query: 332 atctcaatttccttcccagnaagtgtcttcac 363
           |||||| | ||||| ||||  |||||||||||
Sbjct: 108 atctcagtctcctttccagttagtgtcttcac 77



to top

>ref|XM_929535.1| PREDICTED: Homo sapiens hypothetical protein LOC646598 (LOC646598),
           mRNA
          Length = 584

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           |||||||||||||| ||| | ||||||||||  || |   |||| || || |||||||||
Sbjct: 168 ccctctttctcctccacatgctccttgattcactccaccttgtctgtaggttcaatatca 109

                                           
Query: 332 atctcaatttccttcccagnaagtgtcttcac 363
           |||||| | ||||| ||||  |||||||||||
Sbjct: 108 atctcagtctcctttccagttagtgtcttcac 77



to top

>gb|DQ067448.1| Oryctolagus cuniculus nedd8 mRNA, complete cds
          Length = 432

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 272 ccctctttctcctcaacacgttccttgattctatcgattgtgtcagtgggctcaatatca 331
           |||||||||||||| ||||| ||||||||||  || |   |||| ||||| ||||| |||
Sbjct: 137 ccctctttctcctccacacgctccttgattcgctccaccttgtctgtgggttcaatgtca 78

                                           
Query: 332 atctcaatttccttcccagnaagtgtcttcac 363
           || ||||| ||||| ||||  || ||||||||
Sbjct: 77  atttcaatctcctttccagtcagcgtcttcac 46



to top

>gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete
              sequence
          Length = 107603

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                              
Query: 388    cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
              |||||| ||||| ||||| ||  |||||||||| ||||||||||||||
Sbjct: 104158 cctcagaaccaagtggagagttgactctttctggatgttgtaatcagc 104205



to top

>ref|NM_001009202.1| Ovis aries polyubiquitin (LOC443016), mRNA
          Length = 1102

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 407 gtcnactctttctgaatgttgtaatcag 434
           ||| ||||||||||||||||||||||||
Sbjct: 976 gtcgactctttctgaatgttgtaatcag 949



to top

>gb|AF038129.1|AF038129 Ovis aries polyubiquitin mRNA, complete cds
          Length = 1102

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 407 gtcnactctttctgaatgttgtaatcag 434
           ||| ||||||||||||||||||||||||
Sbjct: 976 gtcgactctttctgaatgttgtaatcag 949



to top

>dbj|AB182939.1| Populus nigra PnUB1 mRNA for polyubiquitin, complete cds
          Length = 1146

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatc 450
           ||||| ||||| ||  |||| ||||||||||||||||||||||  || ||||||||
Sbjct: 893 accaagtggagggtagactccttctgaatgttgtaatcagctagagtacgcccatc 838



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 411 actctttctgaatgttgtaatcagcta 437
           |||| ||||||||||||||||||||||
Sbjct: 649 actccttctgaatgttgtaatcagcta 623



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 227 agttgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||| |||||| |||| |||||||||||| | || || || |||||||| ||||
Sbjct: 605 agttgcttgccagcaaagataagcctctgttgatctggggggatgccctctttgtcct 548



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 227 agttgcttcccagcatagatgagcctctgttg 258
           |||||||| |||||| |||| |||||||||||
Sbjct: 833 agttgcttgccagcaaagatcagcctctgttg 802



to top

>gb|AY288520.1| Heterodera schachtii ubiquitin extension protein 2 mRNA, partial
           cds
          Length = 243

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 392 aggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgccc 447
           |||||||| ||||||||  |||| |||||||||||||| || || || ||||||||
Sbjct: 158 aggaccaagtggagcgtggactccttctgaatgttgtagtcggccaacgttcgccc 103



to top

>gb|U84967.1|ATU84967 Arabidopsis thaliana ubiquitin (UBQ11) gene, complete cds
          Length = 912

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           |||||||| || ||  |||| |||||||||||||||||||| || || || ||||| | |
Sbjct: 665 accaaatgaagggtagactccttctgaatgttgtaatcagccaaggtacgaccatcctcc 606

                         
Query: 455 aactgctttncagc 468
           ||||| ||| ||||
Sbjct: 605 aactgttttccagc 592



to top

>gb|L05917.1|ATHUBQ8G Arabidopsis thaliana polyubiquitin (ubq8) gene, complete cds
          Length = 2323

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 388 cctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||| ||||| ||||| ||  |||||||||| ||||||||||||||
Sbjct: 407 cctcagaaccaagtggagagttgactctttctggatgttgtaatcagc 360



to top

>gb|M23433.1|CELUBIA C.elegans polyubiquitin (UbiA) gene, complete cds
          Length = 3797

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                        
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
            ||||| ||||| ||  ||||||||||||| ||||||||||  | ||| || ||||||| |
Sbjct: 1860 accaagtggagagtagactctttctgaatattgtaatcagagagtgtgcgtccatcttcc 1801

                                  
Query: 455  aactgctttncagcaaaaatta 476
            || |||||| | | ||||||||
Sbjct: 1800 aattgctttcctgaaaaaatta 1779



to top

>gb|AY748813.1| Cercomonas agilis polyubiquitin (UBQ) gene, partial cds
          Length = 285

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 416 ttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaat 474
           |||||||||||||||||||| || || || ||||||| ||| |||||  |||| |||||
Sbjct: 188 ttctgaatgttgtaatcagccaaagtacgaccatcttccaattgcttgccagcgaaaat 130



to top

>gb|DQ226839.1| Boechera divaricarpa isolate SLW-C-B11 mRNA sequence
          Length = 684

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 385 gagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagc 435
           |||||| |||||||||||||| ||  | || |||||||| |||||||||||
Sbjct: 628 gagccttaggaccaaatggagggtggattccttctgaatattgtaatcagc 678



to top

>gb|BT012977.1| Lycopersicon esculentum clone 114188F, mRNA sequence
          Length = 653

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                       
Query: 386 agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgc 445
           |||||||| |||||||| |  ||| |||||||||||||||| || ||||| |  || || 
Sbjct: 242 agcctcagcaccaaatgcaaagtcgactctttctgaatgttatagtcagcaagagtgcgg 183

                                        
Query: 446 ccatcttncaactgctttncagcaaaaat 474
           |||||||  | ||||||  ||||||||||
Sbjct: 182 ccatcttctagctgcttaccagcaaaaat 154



to top

>gb|AY456195.1| Helicoverpa armigera ubiquitin mRNA, partial cds
          Length = 228

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 413 tctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgcttt 463
           ||||||||||| ||||||||||  || || |||||||| | ||||||||||
Sbjct: 191 tctttctgaatattgtaatcagacaaggtccgcccatcctccaactgcttt 141



to top

>gb|AC125059.4| Mus musculus BAC clone RP23-404P13 from chromosome 19, complete
             sequence
          Length = 189613

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 411   actctttctgaatgttgtaatcag 434
             ||||||||||||||||||||||||
Sbjct: 49418 actctttctgaatgttgtaatcag 49441



to top

>ref|XM_726244.1| Plasmodium yoelii yoelii str. 17XNL ubiquitin (PY03337) partial
           mRNA
          Length = 489

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                       
Query: 411 actctttctgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaa 470
           ||||||| ||||| || || |||| ||||||||  |||||||  ||||| ||| ||||||
Sbjct: 298 actctttttgaatattatagtcagataatgttctgccatcttctaactgttttccagcaa 239

                 
Query: 471 aaatta 476
           ||||||
Sbjct: 238 aaatta 233



to top

>gb|AF429429.1|AF429429 Olea europaea polyubiquitin OUB1 mRNA, complete cds
          Length = 1184

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 375 ttccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||||| ||||| |||||||| ||||| ||   ||| ||||| ||||||||||| |
Sbjct: 271 ttccacccctcagcctgaggaccaagtggagagtgctctccttctggatgttgtaatcgg 212

              
Query: 435 cta 437
           |||
Sbjct: 211 cta 209



to top

>dbj|AB070526.1| Physarum polycephalum ub2 mRNA for ubiquitin 2, complete cds
          Length = 985

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 411 actctttctgaatgttgtaatcag 434
           ||||||||||||||||||||||||
Sbjct: 621 actctttctgaatgttgtaatcag 598



to top

>gb|AY117058.1| Gossypium barbadense D-subgenome putative polyubiquitin gene,
           partial cds
          Length = 616

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 386 agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||  ||||||||||| ||| |||| ||||| |||||||||||
Sbjct: 371 agcctcaataccaaatggagggtcgactccttctggatgttgtaatc 325



to top

>gb|AY117056.1| Gossypium raimondii putative polyubiquitin gene, partial cds
          Length = 616

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 386 agcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatc 432
           |||||||  ||||||||||| ||| |||| ||||| |||||||||||
Sbjct: 371 agcctcaataccaaatggagggtcgactccttctggatgttgtaatc 325



to top

>gb|AY930681.1| Rhagoletis electromorpha isolate Relect12 locus P309 genomic
           sequence
          Length = 480

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| ||||||||||||| ||| || ||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttccaattgttttcctgcgaaaatta 140



to top

>gb|AY930679.1| Rhagoletis electromorpha isolate Relect8 locus P309 genomic
           sequence
          Length = 480

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| ||||||||||||| ||| || ||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttccaattgttttcctgcgaaaatta 140



to top

>gb|AY930676.1| Rhagoletis electromorpha isolate Relect3 locus P309 genomic
           sequence
          Length = 480

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| ||||||||||||| ||| || ||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttccaattgttttcctgcgaaaatta 140



to top

>gb|AY930674.1| Rhagoletis pomonella isolate TX15 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930673.1| Rhagoletis pomonella isolate TX13 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930672.1| Rhagoletis pomonella isolate MIHaw10 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930671.1| Rhagoletis pomonella isolate MIHaw9 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930670.1| Rhagoletis pomonella isolate MIHaw8 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930669.1| Rhagoletis pomonella isolate MIHaw6 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930668.1| Rhagoletis pomonella isolate MIHaw5 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930667.1| Rhagoletis pomonella isolate MIHaw4 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930666.1| Rhagoletis pomonella isolate MIHaw3 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930658.1| Rhagoletis pomonella isolate NY12 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930657.1| Rhagoletis pomonella isolate NY6 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930656.1| Rhagoletis pomonella isolate NY5 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930655.1| Rhagoletis pomonella isolate NY2 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930654.1| Rhagoletis pomonella isolate CJ8 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930653.1| Rhagoletis pomonella isolate CJ7 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930652.1| Rhagoletis pomonella isolate CJ6 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930651.1| Rhagoletis pomonella isolate CJ5 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930650.1| Rhagoletis pomonella isolate CJ4 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930649.1| Rhagoletis pomonella isolate CJ3 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930648.1| Rhagoletis pomonella isolate CJ2 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930646.1| Rhagoletis pomonella isolate MC8 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930645.1| Rhagoletis pomonella isolate MC7 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930644.1| Rhagoletis pomonella isolate MC6 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930643.1| Rhagoletis pomonella isolate MC5 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930642.1| Rhagoletis pomonella isolate MC4 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930641.1| Rhagoletis pomonella isolate MC3 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930640.1| Rhagoletis pomonella isolate MC2 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|AY930639.1| Rhagoletis pomonella isolate MC1 locus P309 genomic sequence
          Length = 479

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           ||||| |||||||| ||||| |||||||||||||  || |||||| | || |||||||
Sbjct: 197 tgaatattgtaatcggctaaggttcgcccatcttctaattgctttcctgcgaaaatta 140



to top

>gb|U26831.1|STU26831 Solanum tuberosum polyubiquitin gene, promoter and partial cds
          Length = 2083

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 395  accaaatggagcgtcnactctttctgaatgttgtaatcagcta 437
            ||||||||||| ||  |||| ||||| ||||||||||||||||
Sbjct: 1994 accaaatggagggtagactccttctggatgttgtaatcagcta 1952



to top

>gb|U03703.1|ABU03703 Ammonia beccarii ubiquitin gene, partial cds
          Length = 228

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 419 tgaatgttgtaatcagctaatgttcgcccatcttncaactgctttncagcaaaaatta 476
           |||||||| ||||||| ||| ||||| ||||| | |||||| ||  ||||||||||||
Sbjct: 185 tgaatgttataatcagataaagttcggccatcctccaactgtttgccagcaaaaatta 128



to top

>dbj|AB045756.1| Physarum polycephalum ppub2 mRNA for polyubiquitin, complete cds
          Length = 985

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 411 actctttctgaatgttgtaatcag 434
           ||||||||||||||||||||||||
Sbjct: 621 actctttctgaatgttgtaatcag 598



to top

>gb|AF253517.1| Biomphalaria glabrata ubiquitin mRNA, complete cds
          Length = 620

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  ||||||| ||||| ||||| || | |||||| || ||||||| |
Sbjct: 227 accaaatggagtgtagactctttttgaatattgtagtccgataatgtgcgaccatcttcc 168

                               
Query: 455 aactgctttncagcaaaaat 474
           | ||| ||  ||||||||||
Sbjct: 167 agctgtttaccagcaaaaat 148



to top

>gb|AF268491.1| Biomphalaria glabrata strain 13-16-R1 ubiquitin mRNA, complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  ||||||| ||||| ||||| || | |||||| || ||||||| |
Sbjct: 227 accaaatggagtgtagactctttttgaatattgtagtccgataatgtgcgaccatcttcc 168

                               
Query: 455 aactgctttncagcaaaaat 474
           | ||| ||  ||||||||||
Sbjct: 167 agctgtttaccagcaaaaat 148



to top

>gb|AF268492.1| Biomphalaria glabrata strain NMRI ubiquitin mRNA, complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 395 accaaatggagcgtcnactctttctgaatgttgtaatcagctaatgttcgcccatcttnc 454
           ||||||||||| ||  ||||||| ||||| ||||| || | |||||| || ||||||| |
Sbjct: 227 accaaatggagtgtagactctttttgaatattgtagtccgataatgtgcgaccatcttcc 168

                               
Query: 455 aactgctttncagcaaaaat 474
           | ||| ||  ||||||||||
Sbjct: 167 agctgtttaccagcaaaaat 148



to top

>gb|BC104201.1| Homo sapiens neural precursor cell expressed, developmentally
           down-regulated 8, mRNA (cDNA clone MGC:125897
           IMAGE:40031351), complete cds
          Length = 421

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 272 ccctctttctcctcaacacgttccttgattc 302
           |||||||||||||| ||||| ||||||||||
Sbjct: 192 ccctctttctcctccacacgctccttgattc 162



to top

>gb|BC104664.1| Homo sapiens neural precursor cell expressed, developmentally
           down-regulated 8, mRNA (cDNA clone MGC:104393
           IMAGE:6560920), complete cds
          Length = 640

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 272 ccctctttctcctcaacacgttccttgattc 302
           |||||||||||||| ||||| ||||||||||
Sbjct: 208 ccctctttctcctccacacgctccttgattc 178



to top

>gb|BC104200.1| Homo sapiens neural precursor cell expressed, developmentally
           down-regulated 8, mRNA (cDNA clone MGC:125896
           IMAGE:40031350), complete cds
          Length = 421

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 272 ccctctttctcctcaacacgttccttgattc 302
           |||||||||||||| ||||| ||||||||||
Sbjct: 192 ccctctttctcctccacacgctccttgattc 162



to top

>ref|XM_755610.1| Ustilago maydis 521 hypothetical protein (UM04556.1) partial mRNA
          Length = 861

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 404 agcgtcnactctttctgaatgttgta 429
           |||||| |||||||||||||||||||
Sbjct: 374 agcgtcgactctttctgaatgttgta 349



to top

>emb|CR663707.2|CNS0FB35 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR732773.2|CNS0GSCI Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR712162.2|CNS0GCGE Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR720164.2|CNS0GIMI Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR723131.2|CNS0GKWX Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722974.2|CNS0GKSK Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722853.2|CNS0GKP7 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722615.2|CNS0GKIL Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722276.2|CNS0GK96 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722104.2|CNS0GK4E Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR722086.2|CNS0GK3W Tetraodon nigroviridis full-length cDNA
          Length = 451

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR721324.2|CNS0GJIQ Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR720859.2|CNS0GJ5T Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR719571.2|CNS0GI61 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR719270.2|CNS0GHXO Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR719156.2|CNS0GHUI Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR718539.2|CNS0GHDD Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR718156.2|CNS0GH2Q Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR718025.2|CNS0GGZ3 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717822.2|CNS0GGTG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717655.2|CNS0GGOT Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717482.2|CNS0GGK0 Tetraodon nigroviridis full-length cDNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717388.2|CNS0GGHE Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717212.2|CNS0GGCL Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717188.2|CNS0GGBX Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717112.2|CNS0GG9T Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR717034.2|CNS0GG7N Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716741.2|CNS0GFZI Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716666.2|CNS0GFXF Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716451.2|CNS0GFRG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716373.2|CNS0GFPA Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716303.2|CNS0GFNC Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR716061.2|CNS0GFGP Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR715961.2|CNS0GFDX Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR715868.2|CNS0GFBC Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR715716.2|CNS0GF74 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR715670.2|CNS0GF5U Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR714709.2|CNS0GEF5 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR711481.2|CNS0GBXH Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR714625.2|CNS0GECT Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR714267.2|CNS0GE2V Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR712553.2|CNS0GCR9 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR712361.2|CNS0GCLX Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR714032.2|CNS0GDWC Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR713568.2|CNS0GDJG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR713553.2|CNS0GDJ1 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR713492.2|CNS0GDHC Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR713372.2|CNS0GDE0 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR713156.2|CNS0GD80 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR712641.2|CNS0GCTP Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR712106.2|CNS0GCEU Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR711983.2|CNS0GCBF Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR711300.2|CNS0GBSG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR711253.2|CNS0GBR5 Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR711098.2|CNS0GBMU Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR710670.2|CNS0GBAY Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR710588.2|CNS0GB8O Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR710002.2|CNS0GASE Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR709772.2|CNS0GAM0 Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR709398.2|CNS0GABM Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR709287.2|CNS0GA8J Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR709245.2|CNS0GA7D Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR709475.2|CNS0GADR Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR708941.2|CNS0G9YX Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR708744.2|CNS0G9TG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR708483.2|CNS0G9M7 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>ref|XM_858590.1| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 3 (LOC479513), mRNA
          Length = 743

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 554 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 497



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 326 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 269



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 98  ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 41



to top

>ref|XM_536651.2| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 1 (LOC479513), mRNA
          Length = 881

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 692 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 635



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 464 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 407



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 236 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 179



to top

>ref|XM_858547.1| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 2 (LOC479513), mRNA
          Length = 707

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 540 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 483



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 377 ccacccctgagcctcaggaccaaatggagcgtcnactctttctgaatgttgtaatcag 434
           |||||||| || | ||||||||  ||||| ||  |||||||||| |||||||||||||
Sbjct: 228 ccacccctcaggcgcaggaccaggtggagagttgactctttctggatgttgtaatcag 171



to top

>emb|CR708091.2|CNS0G9BB Tetraodon nigroviridis full-length cDNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR708014.2|CNS0G996 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707958.2|CNS0G97M Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707556.2|CNS0G8WG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707464.2|CNS0G8TW Tetraodon nigroviridis full-length cDNA
          Length = 451

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707461.2|CNS0G8TT Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707358.2|CNS0G8QY Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705976.2|CNS0G7OK Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR707014.2|CNS0G8HE Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706909.2|CNS0G8EH Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706806.2|CNS0G8BM Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706732.2|CNS0G89K Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706705.2|CNS0G88T Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706640.2|CNS0G870 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706607.2|CNS0G863 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR706282.2|CNS0G7X2 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705715.2|CNS0G7HB Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705408.2|CNS0G78S Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705348.2|CNS0G774 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705091.2|CNS0G6ZZ Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR705082.2|CNS0G6ZQ Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR704829.2|CNS0G6SP Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR704554.2|CNS0G6L2 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR703692.2|CNS0G5X4 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR703659.2|CNS0G5W7 Tetraodon nigroviridis full-length cDNA
          Length = 427

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 75  tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 21



to top

>emb|CR703300.2|CNS0G5M8 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR703020.2|CNS0G5EG Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR702938.2|CNS0G5C6 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR702722.2|CNS0G566 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR701459.2|CNS0G473 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR701379.2|CNS0G44V Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR700574.2|CNS0G3II Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR700493.2|CNS0G3G9 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR699039.2|CNS0G2BV Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR698685.2|CNS0G221 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR698653.2|CNS0G215 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR698629.2|CNS0G20H Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR698437.2|CNS0G1V5 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR698409.2|CNS0G1UD Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR697948.2|CNS0G1HK Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR697683.2|CNS0G1A7 Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR697335.2|CNS0G10J Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR697273.2|CNS0G0YT Tetraodon nigroviridis full-length cDNA
          Length = 452

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46



to top

>emb|CR696866.2|CNS0G0NI Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 230 tgcttcccagcatagatgagcctctgttgaacaggtggaataccctctttctcct 284
           |||||||||||| |||| |||||||| ||  |||| || ||||||||||| ||||
Sbjct: 100 tgcttcccagcaaagatcagcctctgctggtcaggagggataccctctttatcct 46


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,389,697
Number of Sequences: 3902068
Number of extensions: 3389697
Number of successful extensions: 58256
Number of sequences better than 10.0: 738
Number of HSP's better than 10.0 without gapping: 734
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 56838
Number of HSP's gapped (non-prelim): 1412
length of query: 476
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 454
effective length of database: 17,147,199,772
effective search space: 7784828696488
effective search space used: 7784828696488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top