ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23n14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
2dbj|AK103886.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 167 4e-38
4emb|AL713908.3|CNS07YQ8 Oryza sativa chromosome 12, . BAC OSJNBa... 167 4e-38
5gb|AC121327.3| Oryza sativa (japonica cultivar-group) chromosome... 52 0.001
6dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
7gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 52 0.001
8emb|AL663055.13| Mouse DNA sequence from clone RP23-102H8 on chr... 46 0.091
9gb|AC107033.3| Homo sapiens 12 BAC RP11-669N7 (Roswell Park Canc... 42 1.4
10emb|CT025569.14| Mouse DNA sequence from clone RP24-68J22 on chr... 42 1.4
11gb|AC005608.1| Homo sapiens chromosome 5, PAC clone 53L17 (LBNL ... 40 5.6
12gb|AC008285.7| Drosophila melanogaster clone BACR31P16, complete... 40 5.6
13gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 5.6
14gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosom... 40 5.6
15gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complet... 40 5.6
16ref|XM_502660.1| Yarrowia lipolytica CLIB122, YALI0D10549g predi... 40 5.6
17emb|AJ304877.1|HLU304877 Humulus lupulus chs_H1 gene for chalcon... 40 5.6
18gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold 40 5.6
19gb|AC109448.3| Homo sapiens chromosome 5 clone RP11-141G2, compl... 40 5.6
20gb|AC108121.2| Homo sapiens chromosome 5 clone RP11-553D6, compl... 40 5.6
21dbj|AK083514.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 5.6
22gb|AC009848.9|AC009848 Drosophila melanogaster, chromosome 3R, r... 40 5.6
23gb|AC008135.12|AC008135 Drosophila melanogaster, chromosome 3R, ... 40 5.6
24gb|AC154665.2| Mus musculus BAC clone RP24-284M11 from chromosom... 40 5.6
25emb|BX005478.7| Zebrafish DNA sequence from clone CH211-77G9, co... 40 5.6
26emb|BX005015.5| Zebrafish DNA sequence from clone CH211-66I11 in... 40 5.6
27gb|AC156506.4| Mus musculus 6 BAC RP24-266P6 (Roswell Park Cance... 40 5.6
28emb|AL117193.2|CEY105C5A Caenorhabditis elegans YAC Y105C5A, com... 40 5.6
29gb|AE003760.3| Drosophila melanogaster chromosome 3R, section 98... 40 5.6
30gb|AC122493.4| Mus musculus BAC clone RP24-392M11 from 3, comple... 40 5.6
31emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 5.6

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                            
Query: 226      ttatgcttgaggaactgtcttattgtgttgatgagttgctgctcattccatgcttgattg 285
                |||| ||| ||||| ||||||||||||| |||||| |||||||||| |||||||| ||  
Sbjct: 23203139 ttatccttaaggaattgtcttattgtgtggatgagctgctgctcatcccatgcttcatca 23203198

                                                                            
Query: 286      ctggtgcactcttgccagcagatctgagaaagtatatttctcaaaatcttctttaggtca 345
                ||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||| | ||| 
Sbjct: 23203199 ctgatacactctcgccagcagatctgagagagtatatgtctcagaatcttcttaatgtct 23203258

                                                                            
Query: 346      ggtttttgggacaccgacacaaaagcttgatattcaaattgcccttcgagcttctggtac 405
                |||||||||||||| ||||||||||||||||| | |||||| ||||| |||||| || ||
Sbjct: 23203259 ggtttttgggacactgacacaaaagcttgatacttaaattgtccttcaagcttccggcac 23203318

                    
Query: 406      actt 409
                ||||
Sbjct: 23203319 actt 23203322



to top

>dbj|AK103886.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033150C08, full
            insert sequence
          Length = 3329

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                        
Query: 226  ttatgcttgaggaactgtcttattgtgttgatgagttgctgctcattccatgcttgattg 285
            |||| ||| ||||| ||||||||||||| |||||| |||||||||| |||||||| ||  
Sbjct: 1206 ttatccttaaggaattgtcttattgtgtggatgagctgctgctcatcccatgcttcatca 1147

                                                                        
Query: 286  ctggtgcactcttgccagcagatctgagaaagtatatttctcaaaatcttctttaggtca 345
            ||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||| | ||| 
Sbjct: 1146 ctgatacactctcgccagcagatctgagagagtatatgtctcagaatcttcttaatgtct 1087

                                                                        
Query: 346  ggtttttgggacaccgacacaaaagcttgatattcaaattgcccttcgagcttctggtac 405
            |||||||||||||| ||||||||||||||||| | |||||| ||||| |||||| || ||
Sbjct: 1086 ggtttttgggacactgacacaaaagcttgatacttaaattgtccttcaagcttccggcac 1027

                
Query: 406  actt 409
            ||||
Sbjct: 1026 actt 1023



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                            
Query: 226      ttatgcttgaggaactgtcttattgtgttgatgagttgctgctcattccatgcttgattg 285
                |||| ||| ||||| ||||||||||||| |||||| |||||||||| |||||||| ||  
Sbjct: 23131330 ttatccttaaggaattgtcttattgtgtggatgagctgctgctcatcccatgcttcatca 23131389

                                                                            
Query: 286      ctggtgcactcttgccagcagatctgagaaagtatatttctcaaaatcttctttaggtca 345
                ||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||| | ||| 
Sbjct: 23131390 ctgatacactctcgccagcagatctgagagagtatatgtctcagaatcttcttaatgtct 23131449

                                                                            
Query: 346      ggtttttgggacaccgacacaaaagcttgatattcaaattgcccttcgagcttctggtac 405
                |||||||||||||| ||||||||||||||||| | |||||| ||||| |||||| || ||
Sbjct: 23131450 ggtttttgggacactgacacaaaagcttgatacttaaattgtccttcaagcttccggcac 23131509

                    
Query: 406      actt 409
                ||||
Sbjct: 23131510 actt 23131513



to top

>emb|AL713908.3|CNS07YQ8 Oryza sativa chromosome 12, . BAC OSJNBa0011B18 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 168063

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                         
Query: 226   ttatgcttgaggaactgtcttattgtgttgatgagttgctgctcattccatgcttgattg 285
             |||| ||| ||||| ||||||||||||| |||||| |||||||||| |||||||| ||  
Sbjct: 16257 ttatccttaaggaattgtcttattgtgtggatgagctgctgctcatcccatgcttcatca 16316

                                                                         
Query: 286   ctggtgcactcttgccagcagatctgagaaagtatatttctcaaaatcttctttaggtca 345
             ||| | |||||| |||||||||||||||| ||||||| ||||| ||||||||| | ||| 
Sbjct: 16317 ctgatacactctcgccagcagatctgagagagtatatgtctcagaatcttcttaatgtct 16376

                                                                         
Query: 346   ggtttttgggacaccgacacaaaagcttgatattcaaattgcccttcgagcttctggtac 405
             |||||||||||||| ||||||||||||||||| | |||||| ||||| |||||| || ||
Sbjct: 16377 ggtttttgggacactgacacaaaagcttgatacttaaattgtccttcaagcttccggcac 16436

                 
Query: 406   actt 409
             ||||
Sbjct: 16437 actt 16440



to top

>gb|AC121327.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
            OSJNBa0016O23, complete sequence
          Length = 149400

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 328  aaaatcttctttaggtcaggtttttgggacaccgacacaaaagcttgatattcaaattgc 387
            |||||||||||||  ||||| || ||||| |||||||||||||| ||| | |||||| ||
Sbjct: 3359 aaaatcttctttacatcaggcttctgggagaccgacacaaaagcctgacaatcaaatcgc 3300

              
Query: 388  cc 389
            ||
Sbjct: 3299 cc 3298



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                            
Query: 328      aaaatcttctttaggtcaggtttttgggacaccgacacaaaagcttgatattcaaattgc 387
                |||||||||||||  ||||| || ||||| |||||||||||||| ||| | |||||| ||
Sbjct: 23814544 aaaatcttctttacatcaggcttctgggagaccgacacaaaagcctgacaatcaaatcgc 23814485

                  
Query: 388      cc 389
                ||
Sbjct: 23814484 cc 23814483



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                            
Query: 328      aaaatcttctttaggtcaggtttttgggacaccgacacaaaagcttgatattcaaattgc 387
                |||||||||||||  ||||| || ||||| |||||||||||||| ||| | |||||| ||
Sbjct: 24126213 aaaatcttctttacatcaggcttctgggagaccgacacaaaagcctgacaatcaaatcgc 24126154

                  
Query: 388      cc 389
                ||
Sbjct: 24126153 cc 24126152



to top

>emb|AL663055.13| Mouse DNA sequence from clone RP23-102H8 on chromosome 11 Contains the 5'
              end of the Gria1 gene for glutamate receptor, ionotropic,
              AMPA1 (alpha 1), complete sequence
          Length = 202981

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 56     agaactggaattacaggccatttacgt 82
              ||||||||||||||||||||| |||||
Sbjct: 104009 agaactggaattacaggccatgtacgt 103983



to top

>gb|AC107033.3| Homo sapiens 12 BAC RP11-669N7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 182000

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 300   ccagcagatctgagaaagtat 320
             |||||||||||||||||||||
Sbjct: 35001 ccagcagatctgagaaagtat 35021



to top

>emb|CT025569.14| Mouse DNA sequence from clone RP24-68J22 on chromosome 13, complete
              sequence
          Length = 230723

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     gaactggaattacaggccatt 77
              |||||||||||||||||||||
Sbjct: 218575 gaactggaattacaggccatt 218555



to top

>gb|AC005608.1| Homo sapiens chromosome 5, PAC clone 53L17 (LBNL H152), complete
            sequence
          Length = 119298

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 304  cagatctgagaaagtatatttctc 327
            ||||||||||||||| ||||||||
Sbjct: 2083 cagatctgagaaagtctatttctc 2060



to top

>gb|AC008285.7| Drosophila melanogaster clone BACR31P16, complete sequence
          Length = 177084

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   ccgcagatgtaggagcaacttcca 129
             |||||||||||||||| |||||||
Sbjct: 26294 ccgcagatgtaggagccacttcca 26271



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 267     ctcattccatgcttgattgctggt 290
               |||||||||||||||| |||||||
Sbjct: 1295307 ctcattccatgcttgaatgctggt 1295284



to top

>gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosome 3, complete sequence
          Length = 215395

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     agaactggaattacaggcca 75
              ||||||||||||||||||||
Sbjct: 208832 agaactggaattacaggcca 208813



to top

>gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complete sequence
          Length = 166183

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 315   aagtatatttctcaaaatcttctt 338
             ||||| ||||||||||||||||||
Sbjct: 45250 aagtacatttctcaaaatcttctt 45227



to top

>ref|XM_502660.1| Yarrowia lipolytica CLIB122, YALI0D10549g predicted mRNA
          Length = 2961

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 387  cccttcgagcttctggtaca 406
            ||||||||||||||||||||
Sbjct: 2394 cccttcgagcttctggtaca 2375



to top

>emb|AJ304877.1|HLU304877 Humulus lupulus chs_H1 gene for chalcone synthase
          Length = 2045

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 248 ttgtgttgatgagttgctgc 267
           ||||||||||||||||||||
Sbjct: 68  ttgtgttgatgagttgctgc 87



to top

>gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold
          Length = 444202

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     caaccaaaagaacagaactggaat 66
              |||||||||||| |||||||||||
Sbjct: 122500 caaccaaaagaagagaactggaat 122523



to top

>gb|AC109448.3| Homo sapiens chromosome 5 clone RP11-141G2, complete sequence
          Length = 163817

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 304 cagatctgagaaagtatatttctc 327
           ||||||||||||||| ||||||||
Sbjct: 996 cagatctgagaaagtctatttctc 973



to top

>gb|AC108121.2| Homo sapiens chromosome 5 clone RP11-553D6, complete sequence
          Length = 148288

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 304   cagatctgagaaagtatatttctc 327
             ||||||||||||||| ||||||||
Sbjct: 17594 cagatctgagaaagtctatttctc 17617



to top

>dbj|AK083514.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030038G04 product:inositol
            1,4,5-triphosphate receptor 1, full insert sequence
          Length = 3535

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 276  tgcttgattgctggtgcact 295
            ||||||||||||||||||||
Sbjct: 2175 tgcttgattgctggtgcact 2194



to top

>gb|AC009848.9|AC009848 Drosophila melanogaster, chromosome 3R, region 97E-98A, BAC clone
              BACR02B05, complete sequence
          Length = 189694

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 106    ccgcagatgtaggagcaacttcca 129
              |||||||||||||||| |||||||
Sbjct: 187125 ccgcagatgtaggagccacttcca 187102



to top

>gb|AC008135.12|AC008135 Drosophila melanogaster, chromosome 3R, region 98A-98A, BAC clone
             BACR27H07, complete sequence
          Length = 168306

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   ccgcagatgtaggagcaacttcca 129
             |||||||||||||||| |||||||
Sbjct: 58101 ccgcagatgtaggagccacttcca 58078



to top

>gb|AC154665.2| Mus musculus BAC clone RP24-284M11 from chromosome 13, complete sequence
          Length = 185286

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     aaaagaacagaactggaatt 67
              ||||||||||||||||||||
Sbjct: 140942 aaaagaacagaactggaatt 140923



to top

>emb|BX005478.7| Zebrafish DNA sequence from clone CH211-77G9, complete sequence
          Length = 152152

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 220   acccttttatgcttgaggaa 239
             ||||||||||||||||||||
Sbjct: 76558 acccttttatgcttgaggaa 76539



to top

>emb|BX005015.5| Zebrafish DNA sequence from clone CH211-66I11 in linkage group 9,
             complete sequence
          Length = 172283

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   acccttttatgcttgaggaa 239
             ||||||||||||||||||||
Sbjct: 87287 acccttttatgcttgaggaa 87306



to top

>gb|AC156506.4| Mus musculus 6 BAC RP24-266P6 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 164284

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   tgcttgattgctggtgcact 295
             ||||||||||||||||||||
Sbjct: 73823 tgcttgattgctggtgcact 73842



to top

>emb|AL117193.2|CEY105C5A Caenorhabditis elegans YAC Y105C5A, complete sequence
          Length = 314838

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 311    gagaaagtatatttctcaaa 330
              ||||||||||||||||||||
Sbjct: 239232 gagaaagtatatttctcaaa 239213



to top

>gb|AE003760.3| Drosophila melanogaster chromosome 3R, section 98 of 118 of the complete
              sequence
          Length = 197156

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 106    ccgcagatgtaggagcaacttcca 129
              |||||||||||||||| |||||||
Sbjct: 133913 ccgcagatgtaggagccacttcca 133890



to top

>gb|AC122493.4| Mus musculus BAC clone RP24-392M11 from 3, complete sequence
          Length = 161477

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    agaactggaattacaggcca 75
             ||||||||||||||||||||
Sbjct: 12767 agaactggaattacaggcca 12748



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 387     cccttcgagcttctggtaca 406
               ||||||||||||||||||||
Sbjct: 1317435 cccttcgagcttctggtaca 1317454


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,519,353
Number of Sequences: 3902068
Number of extensions: 3519353
Number of successful extensions: 113959
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113818
Number of HSP's gapped (non-prelim): 141
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top