| Clone Name | rbasd23n12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550191.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1332 Score = 190 bits (96), Expect = 4e-45 Identities = 277/338 (81%), Gaps = 12/338 (3%) Strand = Plus / Minus Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917 Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857 Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471 | ||||| ||||| | | ||||||| | || | || |||||| | |||||||||||| Sbjct: 856 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 797 Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531 |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| |||| Sbjct: 796 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 737 Query: 532 tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582 ||||||| ||||||||||| | ||||||| ||||||||||| || |||| Sbjct: 736 tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 677 Query: 583 ggctgtagctcctactgcgactcctgctgtagctccta 620 ||||||||||||| || || |||||||||||||||||| Sbjct: 676 ggctgtagctcctgctacggctcctgctgtagctccta 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 56/67 (83%) Strand = Plus / Minus Query: 219 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008 Query: 279 ctcatgt 285 ||||||| Sbjct: 1007 ctcatgt 1001
>dbj|AK071635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100L15, full insert sequence Length = 1377 Score = 190 bits (96), Expect = 4e-45 Identities = 277/338 (81%), Gaps = 12/338 (3%) Strand = Plus / Minus Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 1018 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 962 Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 961 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 902 Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471 | ||||| ||||| | | ||||||| | || | || |||||| | |||||||||||| Sbjct: 901 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 842 Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531 |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| |||| Sbjct: 841 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 782 Query: 532 tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582 ||||||| ||||||||||| | ||||||| ||||||||||| || |||| Sbjct: 781 tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 722 Query: 583 ggctgtagctcctactgcgactcctgctgtagctccta 620 ||||||||||||| || || |||||||||||||||||| Sbjct: 721 ggctgtagctcctgctacggctcctgctgtagctccta 684 Score = 46.1 bits (23), Expect = 0.14 Identities = 56/67 (83%) Strand = Plus / Minus Query: 219 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1112 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1053 Query: 279 ctcatgt 285 ||||||| Sbjct: 1052 ctcatgt 1046
>dbj|AK060171.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F07, full insert sequence Length = 1332 Score = 190 bits (96), Expect = 4e-45 Identities = 277/338 (81%), Gaps = 12/338 (3%) Strand = Plus / Minus Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917 Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857 Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471 | ||||| ||||| | | ||||||| | || | || |||||| | |||||||||||| Sbjct: 856 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 797 Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531 |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| |||| Sbjct: 796 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 737 Query: 532 tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582 ||||||| ||||||||||| | ||||||| ||||||||||| || |||| Sbjct: 736 tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 677 Query: 583 ggctgtagctcctactgcgactcctgctgtagctccta 620 ||||||||||||| || || |||||||||||||||||| Sbjct: 676 ggctgtagctcctgctacggctcctgctgtagctccta 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 56/67 (83%) Strand = Plus / Minus Query: 219 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008 Query: 279 ctcatgt 285 ||||||| Sbjct: 1007 ctcatgt 1001
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 182 bits (92), Expect = 1e-42 Identities = 226/270 (83%), Gaps = 3/270 (1%) Strand = Plus / Plus Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 2985688 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 2985744 Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 2985745 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 2985804 Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471 | ||||| ||||| | | ||||||| | || | || |||||| | |||||||||||| Sbjct: 2985805 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 2985864 Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531 |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| |||| Sbjct: 2985865 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 2985924 Query: 532 tgtcacgggggctccttgagcgcctttcat 561 ||||||| ||||||||||| | |||||||| Sbjct: 2985925 tgtcacgagggctccttgatctcctttcat 2985954 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 585 ctgtagctcctactgcgactcctgctgtagctccta 620 ||||||||||| || || |||||||||||||||||| Sbjct: 2986301 ctgtagctcctgctacggctcctgctgtagctccta 2986336 Score = 46.1 bits (23), Expect = 0.14 Identities = 56/67 (83%) Strand = Plus / Plus Query: 219 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 2985594 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 2985653 Query: 279 ctcatgt 285 ||||||| Sbjct: 2985654 ctcatgt 2985660
>dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0011G08 Length = 139490 Score = 182 bits (92), Expect = 1e-42 Identities = 226/270 (83%), Gaps = 3/270 (1%) Strand = Plus / Plus Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351 |||||||||| |||| || |||||||||| ||||||||||||| || |||||| || Sbjct: 67205 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 67261 Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411 |||||| ||||| ||| |||||| |||| ||||||||||| |||||||||||||||| Sbjct: 67262 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 67321 Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471 | ||||| ||||| | | ||||||| | || | || |||||| | |||||||||||| Sbjct: 67322 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 67381 Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531 |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| |||| Sbjct: 67382 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 67441 Query: 532 tgtcacgggggctccttgagcgcctttcat 561 ||||||| ||||||||||| | |||||||| Sbjct: 67442 tgtcacgagggctccttgatctcctttcat 67471 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 585 ctgtagctcctactgcgactcctgctgtagctccta 620 ||||||||||| || || |||||||||||||||||| Sbjct: 67818 ctgtagctcctgctacggctcctgctgtagctccta 67853 Score = 46.1 bits (23), Expect = 0.14 Identities = 56/67 (83%) Strand = Plus / Plus Query: 219 cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278 ||||| |||||||||||||| ||||||||||| ||||| || ||||| ||||||| Sbjct: 67111 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 67170 Query: 279 ctcatgt 285 ||||||| Sbjct: 67171 ctcatgt 67177
>ref|XM_416998.1| PREDICTED: Gallus gallus similar to Cutaneous T-cell lymphoma tumor antigen se70-2 (LOC418804), mRNA Length = 3178 Score = 48.1 bits (24), Expect = 0.036 Identities = 27/28 (96%) Strand = Plus / Minus Query: 589 agctcctactgcgactcctgctgtagct 616 |||||||||| ||||||||||||||||| Sbjct: 677 agctcctactccgactcctgctgtagct 650
>gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome 13, complete sequence Length = 233740 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tgcagggcttctgctgccagga 353 |||||||||||||||||||||| Sbjct: 143566 tgcagggcttctgctgccagga 143545
>gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, complete sequence Length = 215251 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tgcagggcttctgctgccagga 353 |||||||||||||||||||||| Sbjct: 150987 tgcagggcttctgctgccagga 151008
>gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence Length = 141360 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 gtaggaagaatttgatcgac 121 |||||||||||||||||||| Sbjct: 83348 gtaggaagaatttgatcgac 83367
>gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, complete sequence Length = 171788 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 127 actctcaccaggtgatgcac 146 |||||||||||||||||||| Sbjct: 90667 actctcaccaggtgatgcac 90686
>ref|XM_753463.1| Ustilago maydis 521 hypothetical protein (UM02409.1) partial mRNA Length = 759 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 538 gggggctccttgagcgcctt 557 |||||||||||||||||||| Sbjct: 527 gggggctccttgagcgcctt 508
>gb|AC123044.4| Mus musculus BAC clone RP24-548B7 from chromosome 5, complete sequence Length = 184772 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 145 actcccactgggtgaacact 164 |||||||||||||||||||| Sbjct: 99002 actcccactgggtgaacact 99021
>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains the 5' end of a novel gene, a novel gene, a macrophage stimulating 1 (hepatocyte growth factor-like)(MST1) pseudogene and three CpG islands, complete sequence Length = 146141 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 472 tgtctcgggggctcctcctagggc 495 |||||| ||||||||||||||||| Sbjct: 2461 tgtctcaggggctcctcctagggc 2438
>emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 on chromosome 1p35.1-36.21 Contains a novel pseudogene, a eukaryotic translation initiation factor 1A pseudogene 1 (EIF1AP1), part of a novel gene (LOC284729), a macrophage stimulating 1 (hepatocyte growth factor-like)(MST1) pseudogene and five CpG islands, complete sequence Length = 118067 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 472 tgtctcgggggctcctcctagggc 495 |||||| ||||||||||||||||| Sbjct: 28706 tgtctcaggggctcctcctagggc 28729
>gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194589 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 atagaaacacgataaaatca 52 |||||||||||||||||||| Sbjct: 51246 atagaaacacgataaaatca 51265
>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome Length = 1072950 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 331 gtgcagggcttctgctgcca 350 |||||||||||||||||||| Sbjct: 408265 gtgcagggcttctgctgcca 408284
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 162 actggaagaatttgatccacttaa 185 |||||||||||||||||| ||||| Sbjct: 759706 actggaagaatttgatccgcttaa 759683
>gb|AE003562.3| Drosophila melanogaster chromosome 3L, section 23 of 83 of the complete sequence Length = 255329 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 atagaaacacgataaaatca 52 |||||||||||||||||||| Sbjct: 234105 atagaaacacgataaaatca 234124
>gb|AC004251.1|AC004251 Drosophila melanogaster (P1 DS08305 (D253)) DNA sequence, complete sequence Length = 83846 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 atagaaacacgataaaatca 52 |||||||||||||||||||| Sbjct: 62579 atagaaacacgataaaatca 62560 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,670,291 Number of Sequences: 3902068 Number of extensions: 4670291 Number of successful extensions: 81238 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 81104 Number of HSP's gapped (non-prelim): 122 length of query: 644 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 621 effective length of database: 17,143,297,704 effective search space: 10645987874184 effective search space used: 10645987874184 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)