ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23n12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_550191.1| Oryza sativa (japonica cultivar-group), mRNA 190 4e-45
2dbj|AK071635.1| Oryza sativa (japonica cultivar-group) cDNA clon... 190 4e-45
3dbj|AK060171.1| Oryza sativa (japonica cultivar-group) cDNA clon... 190 4e-45
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 182 1e-42
5dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic D... 182 1e-42
6ref|XM_416998.1| PREDICTED: Gallus gallus similar to Cutaneous T... 48 0.036
7gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome... 44 0.56
8gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, compl... 44 0.56
9gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence 40 8.8
10gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, comple... 40 8.8
11ref|XM_753463.1| Ustilago maydis 521 hypothetical protein (UM024... 40 8.8
12gb|AC123044.4| Mus musculus BAC clone RP24-548B7 from chromosome... 40 8.8
13emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chr... 40 8.8
14emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 o... 40 8.8
15gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswel... 40 8.8
16gb|AE002160.2| Chlamydia muridarum Nigg, complete genome 40 8.8
17gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 40 8.8
18gb|AE003562.3| Drosophila melanogaster chromosome 3L, section 23... 40 8.8
19gb|AC004251.1|AC004251 Drosophila melanogaster (P1 DS08305 (D253... 40 8.8

>ref|XM_550191.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1332

 Score =  190 bits (96), Expect = 4e-45
 Identities = 277/338 (81%), Gaps = 12/338 (3%)
 Strand = Plus / Minus

                                                                       
Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351
           ||||||||||  |||| || ||||||||||   ||||||||||||| || |||||| || 
Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917

                                                                       
Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411
            |||||| ||||| |||  |||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857

                                                                       
Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471
           | ||||| ||||| | | |||||||  |  || | || ||||||  | ||||||||||||
Sbjct: 856 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 797

                                                                       
Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531
           |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| ||||
Sbjct: 796 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 737

                                                                       
Query: 532 tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582
           ||||||| ||||||||||| | |||||||         ||||||||||| ||    ||||
Sbjct: 736 tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 677

                                                 
Query: 583 ggctgtagctcctactgcgactcctgctgtagctccta 620
           ||||||||||||| || || ||||||||||||||||||
Sbjct: 676 ggctgtagctcctgctacggctcctgctgtagctccta 639



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 219  cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278
            ||||| ||||||||||||||    ||||||||||| ||||| || ||||| |||||||  
Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008

                   
Query: 279  ctcatgt 285
            |||||||
Sbjct: 1007 ctcatgt 1001



to top

>dbj|AK071635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100L15, full
            insert sequence
          Length = 1377

 Score =  190 bits (96), Expect = 4e-45
 Identities = 277/338 (81%), Gaps = 12/338 (3%)
 Strand = Plus / Minus

                                                                        
Query: 292  ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351
            ||||||||||  |||| || ||||||||||   ||||||||||||| || |||||| || 
Sbjct: 1018 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 962

                                                                        
Query: 352  gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411
             |||||| ||||| |||  |||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 961  taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 902

                                                                        
Query: 412  tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471
            | ||||| ||||| | | |||||||  |  || | || ||||||  | ||||||||||||
Sbjct: 901  tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 842

                                                                        
Query: 472  tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531
            |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| ||||
Sbjct: 841  tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 782

                                                                        
Query: 532  tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582
            ||||||| ||||||||||| | |||||||         ||||||||||| ||    ||||
Sbjct: 781  tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 722

                                                  
Query: 583  ggctgtagctcctactgcgactcctgctgtagctccta 620
            ||||||||||||| || || ||||||||||||||||||
Sbjct: 721  ggctgtagctcctgctacggctcctgctgtagctccta 684



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 219  cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278
            ||||| ||||||||||||||    ||||||||||| ||||| || ||||| |||||||  
Sbjct: 1112 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1053

                   
Query: 279  ctcatgt 285
            |||||||
Sbjct: 1052 ctcatgt 1046



to top

>dbj|AK060171.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F07, full
           insert sequence
          Length = 1332

 Score =  190 bits (96), Expect = 4e-45
 Identities = 277/338 (81%), Gaps = 12/338 (3%)
 Strand = Plus / Minus

                                                                       
Query: 292 ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351
           ||||||||||  |||| || ||||||||||   ||||||||||||| || |||||| || 
Sbjct: 973 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 917

                                                                       
Query: 352 gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411
            |||||| ||||| |||  |||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 916 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 857

                                                                       
Query: 412 tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471
           | ||||| ||||| | | |||||||  |  || | || ||||||  | ||||||||||||
Sbjct: 856 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 797

                                                                       
Query: 472 tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531
           |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| ||||
Sbjct: 796 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 737

                                                                       
Query: 532 tgtcacgggggctccttgagcgcctttca---------tccctccttggggaaacagagc 582
           ||||||| ||||||||||| | |||||||         ||||||||||| ||    ||||
Sbjct: 736 tgtcacgagggctccttgatctcctttcattacggctatccctccttggagactgggagc 677

                                                 
Query: 583 ggctgtagctcctactgcgactcctgctgtagctccta 620
           ||||||||||||| || || ||||||||||||||||||
Sbjct: 676 ggctgtagctcctgctacggctcctgctgtagctccta 639



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 219  cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278
            ||||| ||||||||||||||    ||||||||||| ||||| || ||||| |||||||  
Sbjct: 1067 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 1008

                   
Query: 279  ctcatgt 285
            |||||||
Sbjct: 1007 ctcatgt 1001



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  182 bits (92), Expect = 1e-42
 Identities = 226/270 (83%), Gaps = 3/270 (1%)
 Strand = Plus / Plus

                                                                           
Query: 292     ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351
               ||||||||||  |||| || ||||||||||   ||||||||||||| || |||||| || 
Sbjct: 2985688 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 2985744

                                                                           
Query: 352     gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411
                |||||| ||||| |||  |||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 2985745 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 2985804

                                                                           
Query: 412     tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471
               | ||||| ||||| | | |||||||  |  || | || ||||||  | ||||||||||||
Sbjct: 2985805 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 2985864

                                                                           
Query: 472     tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531
               |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| ||||
Sbjct: 2985865 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 2985924

                                             
Query: 532     tgtcacgggggctccttgagcgcctttcat 561
               ||||||| ||||||||||| | ||||||||
Sbjct: 2985925 tgtcacgagggctccttgatctcctttcat 2985954



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                   
Query: 585     ctgtagctcctactgcgactcctgctgtagctccta 620
               ||||||||||| || || ||||||||||||||||||
Sbjct: 2986301 ctgtagctcctgctacggctcctgctgtagctccta 2986336



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                           
Query: 219     cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278
               ||||| ||||||||||||||    ||||||||||| ||||| || ||||| |||||||  
Sbjct: 2985594 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 2985653

                      
Query: 279     ctcatgt 285
               |||||||
Sbjct: 2985654 ctcatgt 2985660



to top

>dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0011G08
          Length = 139490

 Score =  182 bits (92), Expect = 1e-42
 Identities = 226/270 (83%), Gaps = 3/270 (1%)
 Strand = Plus / Plus

                                                                         
Query: 292   ggctgtcagccttcatcggactcctgctgttctcccttggtgcagggcttctgctgccag 351
             ||||||||||  |||| || ||||||||||   ||||||||||||| || |||||| || 
Sbjct: 67205 ggctgtcagctctcattgggctcctgctgt---cccttggtgcaggactcctgctggcat 67261

                                                                         
Query: 352   gaggggtggggctccgggccctccccttggcaggtgaagcactcctcctagggctgcggc 411
              |||||| ||||| |||  |||||| ||||  ||||||||||| ||||||||||||||||
Sbjct: 67262 taggggtagggctgcggttcctcccgttgggtggtgaagcacttctcctagggctgcggc 67321

                                                                         
Query: 412   tgtcacgggggctcctcatagggctgcgactgccacgggggctcttcatagggctgcgac 471
             | ||||| ||||| | | |||||||  |  || | || ||||||  | ||||||||||||
Sbjct: 67322 tatcacgagggcttcccctagggctctgggtgtcgcgagggctccccttagggctgcgac 67381

                                                                         
Query: 472   tgtctcgggggctcctcctagggctgcgactgtcacgggggctcctccttgggctgcgac 531
             |||| |||||||||| ||||||||||||||||||||||||||| | ||| ||||| ||||
Sbjct: 67382 tgtcacgggggctccccctagggctgcgactgtcacgggggcttcccctagggctccgac 67441

                                           
Query: 532   tgtcacgggggctccttgagcgcctttcat 561
             ||||||| ||||||||||| | ||||||||
Sbjct: 67442 tgtcacgagggctccttgatctcctttcat 67471



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 585   ctgtagctcctactgcgactcctgctgtagctccta 620
             ||||||||||| || || ||||||||||||||||||
Sbjct: 67818 ctgtagctcctgctacggctcctgctgtagctccta 67853



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                         
Query: 219   cgatggttgccattgtcttcgccgtccctggggctcgggctacgaccatttgcagctggg 278
             ||||| ||||||||||||||    ||||||||||| ||||| || ||||| |||||||  
Sbjct: 67111 cgatgattgccattgtcttcataatccctggggcttgggctccggccattggcagctgta 67170

                    
Query: 279   ctcatgt 285
             |||||||
Sbjct: 67171 ctcatgt 67177



to top

>ref|XM_416998.1| PREDICTED: Gallus gallus similar to Cutaneous T-cell lymphoma tumor
           antigen se70-2 (LOC418804), mRNA
          Length = 3178

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 589 agctcctactgcgactcctgctgtagct 616
           |||||||||| |||||||||||||||||
Sbjct: 677 agctcctactccgactcctgctgtagct 650



to top

>gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome 13, complete sequence
          Length = 233740

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 332    tgcagggcttctgctgccagga 353
              ||||||||||||||||||||||
Sbjct: 143566 tgcagggcttctgctgccagga 143545



to top

>gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, complete sequence
          Length = 215251

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 332    tgcagggcttctgctgccagga 353
              ||||||||||||||||||||||
Sbjct: 150987 tgcagggcttctgctgccagga 151008



to top

>gb|DQ415920.1| Cleome spinosa clone BAC Cs3, complete sequence
          Length = 141360

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gtaggaagaatttgatcgac 121
             ||||||||||||||||||||
Sbjct: 83348 gtaggaagaatttgatcgac 83367



to top

>gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, complete sequence
          Length = 171788

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   actctcaccaggtgatgcac 146
             ||||||||||||||||||||
Sbjct: 90667 actctcaccaggtgatgcac 90686



to top

>ref|XM_753463.1| Ustilago maydis 521 hypothetical protein (UM02409.1) partial mRNA
          Length = 759

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 538 gggggctccttgagcgcctt 557
           ||||||||||||||||||||
Sbjct: 527 gggggctccttgagcgcctt 508



to top

>gb|AC123044.4| Mus musculus BAC clone RP24-548B7 from chromosome 5, complete sequence
          Length = 184772

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   actcccactgggtgaacact 164
             ||||||||||||||||||||
Sbjct: 99002 actcccactgggtgaacact 99021



to top

>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains
            the 5' end of a novel gene, a novel gene, a macrophage
            stimulating 1 (hepatocyte growth factor-like)(MST1)
            pseudogene and three CpG islands, complete sequence
          Length = 146141

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 472  tgtctcgggggctcctcctagggc 495
            |||||| |||||||||||||||||
Sbjct: 2461 tgtctcaggggctcctcctagggc 2438



to top

>emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 on chromosome 1p35.1-36.21
             Contains a novel pseudogene, a eukaryotic translation
             initiation factor 1A pseudogene 1 (EIF1AP1), part of a
             novel gene (LOC284729), a macrophage stimulating 1
             (hepatocyte growth factor-like)(MST1) pseudogene and five
             CpG islands, complete sequence
          Length = 118067

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 472   tgtctcgggggctcctcctagggc 495
             |||||| |||||||||||||||||
Sbjct: 28706 tgtctcaggggctcctcctagggc 28729



to top

>gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 194589

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    atagaaacacgataaaatca 52
             ||||||||||||||||||||
Sbjct: 51246 atagaaacacgataaaatca 51265



to top

>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome
          Length = 1072950

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 331    gtgcagggcttctgctgcca 350
              ||||||||||||||||||||
Sbjct: 408265 gtgcagggcttctgctgcca 408284



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 162    actggaagaatttgatccacttaa 185
              |||||||||||||||||| |||||
Sbjct: 759706 actggaagaatttgatccgcttaa 759683



to top

>gb|AE003562.3| Drosophila melanogaster chromosome 3L, section 23 of 83 of the complete
              sequence
          Length = 255329

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     atagaaacacgataaaatca 52
              ||||||||||||||||||||
Sbjct: 234105 atagaaacacgataaaatca 234124



to top

>gb|AC004251.1|AC004251 Drosophila melanogaster (P1 DS08305 (D253)) DNA sequence, complete
             sequence
          Length = 83846

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    atagaaacacgataaaatca 52
             ||||||||||||||||||||
Sbjct: 62579 atagaaacacgataaaatca 62560


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,670,291
Number of Sequences: 3902068
Number of extensions: 4670291
Number of successful extensions: 81238
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81104
Number of HSP's gapped (non-prelim): 122
length of query: 644
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 621
effective length of database: 17,143,297,704
effective search space: 10645987874184
effective search space used: 10645987874184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top