>gb|AC146423.3| Pan troglodytes BAC clone RP43-25L18 from 7, complete sequence
          Length = 158864

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     cctggggctgccgccgaggc 22
             ||||||||||||||||||||
Sbjct: 41181 cctggggctgccgccgaggc 41200

>gb|AC148833.5| Pan troglodytes BAC clone CH251-55M19 from chromosome 7, complete
             sequence
          Length = 206418

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     cctggggctgccgccgaggc 22
             ||||||||||||||||||||
Sbjct: 88254 cctggggctgccgccgaggc 88273

>gb|AE007288.1| Sinorhizobium meliloti 1021 plasmid pSymA section 94 of 121 of the
            complete plasmid sequence
          Length = 10943

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 8    ggctgccgccgaggcgcgtg 27
            ||||||||||||||||||||
Sbjct: 9575 ggctgccgccgaggcgcgtg 9594

>gb|AC005535.2| Homo sapiens PAC clone RP5-1168M19 from 7, complete sequence
          Length = 157813

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      cctggggctgccgccgaggc 22
              ||||||||||||||||||||
Sbjct: 149823 cctggggctgccgccgaggc 149842

>emb|AL158055.12| Human DNA sequence from clone RP11-348F1 on chromosome Xp11.1-11.22
              Contains the NUDT11 gene for nudix (nucleoside diphosphate
              linked moiety X)-type motif 11, two novel genes, the NUDT10
              gene for nudix (nucleoside diphosphate linked moiety
              X)-type motif 10 and three CpG islands, complete sequence
          Length = 184873

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      acctggggctgccgccgaggcgcg 25
              ||||| ||||||||||||||||||
Sbjct: 103047 acctgtggctgccgccgaggcgcg 103024

>gb|AF222338.1|AF222338 Rattus norvegicus voltage gated N-type calcium channel alpha1B gene,
            partial cds, alternatively spliced
          Length = 6340

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 66   gaagccagcatgatgaaaggataa 89
            ||||||||||||| ||||||||||
Sbjct: 2259 gaagccagcatgaggaaaggataa 2282

>ref|NM_031131.1| Rattus norvegicus transforming growth factor, beta 2 (Tgfb2), mRNA
          Length = 2880

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 65   agaagccagcatgatgaaa 83
            |||||||||||||||||||
Sbjct: 2619 agaagccagcatgatgaaa 2637

>gb|AC161467.2| Gallus gallus BAC clone CH261-89H14 from chromosome unknown, complete
             sequence
          Length = 308703

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 78    atgaaaggataatgcagca 96
             |||||||||||||||||||
Sbjct: 65364 atgaaaggataatgcagca 65382

>gb|AF153013.1|AF153013 Rattus norvegicus TGF-beta 2 short form precursor (TGF-beta2) mRNA,
            complete cds
          Length = 2796

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 65   agaagccagcatgatgaaa 83
            |||||||||||||||||||
Sbjct: 2535 agaagccagcatgatgaaa 2553

>gb|AF153012.2|AF153012 Rattus norvegicus TGF-beta 2 long form precursor (TGF-beta2) mRNA,
            complete cds
          Length = 2880

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 65   agaagccagcatgatgaaa 83
            |||||||||||||||||||
Sbjct: 2619 agaagccagcatgatgaaa 2637


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 594,781
Number of Sequences: 3902068
Number of extensions: 594781
Number of successful extensions: 41104
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41089
Number of HSP's gapped (non-prelim): 15
length of query: 111
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 90
effective length of database: 17,151,101,840
effective search space: 1543599165600
effective search space used: 1543599165600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)