ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23m15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U49482.1|HVU49482 Hordeum vulgare low temperature-responsive ... 224 6e-56
2gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... 40 1.8
3gb|AC146174.2| Pan troglodytes BAC clone CH251-549F12 from Y, co... 38 7.0
4gb|AC122091.6| Rattus norvegicus 9 BAC CH230-375L16 (Children's ... 38 7.0
5dbj|BS000614.1| Pan troglodytes chromosome Y clone:PTBY-009K01, ... 38 7.0
6dbj|BS000556.1| Pan troglodytes chromosome Y clone:PTB-461C11, c... 38 7.0
7gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 7.0
8gb|AC009988.12| Homo sapiens chromosome 10 clone RP11-62L18, com... 38 7.0
9gb|AC026395.11| Homo sapiens chromosome 10 clone RP11-45D20, com... 38 7.0
10gb|AC006040.3|AC006040 Homo sapiens BAC clone RP11-400O10 from Y... 38 7.0
11gb|AF041427.1|AF041427 Homo sapiens ribosomal protein s4 Y isofo... 38 7.0
12dbj|AB207971.1| Lolium perenne gene for glycine-rich RNA-binding... 38 7.0

>gb|U49482.1|HVU49482 Hordeum vulgare low temperature-responsive RNA-binding protein
           (blt801) mRNA, complete cds
          Length = 806

 Score =  224 bits (113), Expect = 6e-56
 Identities = 140/149 (93%), Gaps = 2/149 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cctaagcgatggagcgagatctncggttactcgggagcgagcgataacacggta--cagg 58
           ||||||||||||||||||||||  ||||||||||||||||||||||||||||||  ||||
Sbjct: 672 cctaagcgatggagcgagatctagggttactcgggagcgagcgataacacggtagacagg 613

                                                                       
Query: 59  taaacgaaaaggatggatcgataactaggataactggccgacaaggggccccaccattca 118
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 612 taaacgaaaaggatagatcgataactaggataactggccgacaaggggccccaccattca 553

                                        
Query: 119 ctccctccagttgncgtcgncgaagccgc 147
           ||||||||||||| || || || ||||||
Sbjct: 552 ctccctccagttgccgccgccggagccgc 524



to top

>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence
          Length = 203855

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   cccaccattcactccctcca 127
             ||||||||||||||||||||
Sbjct: 86463 cccaccattcactccctcca 86482



to top

>gb|AC146174.2| Pan troglodytes BAC clone CH251-549F12 from Y, complete sequence
          Length = 191823

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 109    ccaccattcactccctcca 127
              |||||||||||||||||||
Sbjct: 109279 ccaccattcactccctcca 109261



to top

>gb|AC122091.6| Rattus norvegicus 9 BAC CH230-375L16 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 231967

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   cattcactccctccagttg 131
             |||||||||||||||||||
Sbjct: 70604 cattcactccctccagttg 70586



to top

>dbj|BS000614.1| Pan troglodytes chromosome Y clone:PTBY-009K01, complete sequences
          Length = 63466

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 109   ccaccattcactccctcca 127
             |||||||||||||||||||
Sbjct: 45685 ccaccattcactccctcca 45703



to top

>dbj|BS000556.1| Pan troglodytes chromosome Y clone:PTB-461C11, complete sequences
          Length = 148964

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    ccaccattcactccctcca 127
              |||||||||||||||||||
Sbjct: 140321 ccaccattcactccctcca 140339



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 109      ccaccattcactccctcca 127
                |||||||||||||||||||
Sbjct: 23744114 ccaccattcactccctcca 23744096



to top

>gb|AC009988.12| Homo sapiens chromosome 10 clone RP11-62L18, complete sequence
          Length = 174398

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 108    cccaccattcactccctcc 126
              |||||||||||||||||||
Sbjct: 160168 cccaccattcactccctcc 160186



to top

>gb|AC026395.11| Homo sapiens chromosome 10 clone RP11-45D20, complete sequence
          Length = 172777

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 108   cccaccattcactccctcc 126
             |||||||||||||||||||
Sbjct: 40879 cccaccattcactccctcc 40897



to top

>gb|AC006040.3|AC006040 Homo sapiens BAC clone RP11-400O10 from Y, complete sequence
          Length = 186504

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    ccaccattcactccctcca 127
              |||||||||||||||||||
Sbjct: 127871 ccaccattcactccctcca 127889



to top

>gb|AF041427.1|AF041427 Homo sapiens ribosomal protein s4 Y isoform gene, complete cds
          Length = 45859

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 109   ccaccattcactccctcca 127
             |||||||||||||||||||
Sbjct: 30146 ccaccattcactccctcca 30164



to top

>dbj|AB207971.1| Lolium perenne gene for glycine-rich RNA-binding protein, complete
            cds
          Length = 2129

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1    cctaagcgatggagcgaga 19
            |||||||||||||||||||
Sbjct: 1884 cctaagcgatggagcgaga 1866


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 523,554
Number of Sequences: 3902068
Number of extensions: 523554
Number of successful extensions: 31281
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31250
Number of HSP's gapped (non-prelim): 30
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top