ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23l19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR752642.5| Zebrafish DNA sequence from clone DKEY-165D23 in... 42 0.93
2emb|BX936403.9| Zebrafish DNA sequence from clone CH211-281A24 i... 42 0.93
3gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold 40 3.7
4gb|AC145509.2| Gasterosteus aculeatus clone CH213-128O17, comple... 40 3.7
5emb|AL590867.10| Human DNA sequence from clone RP11-475C16 on ch... 40 3.7
6emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 i... 40 3.7
7gb|AC146534.3| Otolemur garnettii clone CH256-50E17, complete se... 40 3.7
8gb|CP000225.1| Drosophila melanogaster genomic scaffold 21100002... 40 3.7
9gb|CP000223.1| Drosophila melanogaster genomic scaffold 21100002... 40 3.7
10gb|CP000203.1| Drosophila melanogaster genomic scaffold 21100002... 40 3.7
11gb|CP000191.1| Drosophila melanogaster genomic scaffold 21100002... 40 3.7

>emb|CR752642.5| Zebrafish DNA sequence from clone DKEY-165D23 in linkage group 5,
           complete sequence
          Length = 16751

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 71  gcaaatgaatcagccctcgca 91
           |||||||||||||||||||||
Sbjct: 249 gcaaatgaatcagccctcgca 229



to top

>emb|BX936403.9| Zebrafish DNA sequence from clone CH211-281A24 in linkage group 5,
              complete sequence
          Length = 142908

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 71     gcaaatgaatcagccctcgca 91
              |||||||||||||||||||||
Sbjct: 141157 gcaaatgaatcagccctcgca 141137



to top

>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    tttatacatattaactattt 153
              ||||||||||||||||||||
Sbjct: 322619 tttatacatattaactattt 322600



to top

>gb|AC145509.2| Gasterosteus aculeatus clone CH213-128O17, complete sequence
          Length = 213989

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 99     gcattgctgcacacattgca 118
              ||||||||||||||||||||
Sbjct: 211860 gcattgctgcacacattgca 211841



to top

>emb|AL590867.10| Human DNA sequence from clone RP11-475C16 on chromosome 6 Contains a
             ribosomal protein L27a (60S ribosomal protein L27a)
             (RPL27A) pseudogene and a novel gene, complete sequence
          Length = 63621

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   acttctatttatacatatta 146
             ||||||||||||||||||||
Sbjct: 14745 acttctatttatacatatta 14726



to top

>emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 in linkage group 18,
             complete sequence
          Length = 143863

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   atacatattaactatttaca 156
             ||||||||||||||||||||
Sbjct: 83431 atacatattaactatttaca 83412



to top

>gb|AC146534.3| Otolemur garnettii clone CH256-50E17, complete sequence
          Length = 139631

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    tttatacatattaactattt 153
              ||||||||||||||||||||
Sbjct: 133113 tttatacatattaactattt 133094



to top

>gb|CP000225.1| Drosophila melanogaster genomic scaffold 211000022280724
          Length = 820587

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     tcgcattgctgcacacattg 116
              ||||||||||||||||||||
Sbjct: 430043 tcgcattgctgcacacattg 430062



to top

>gb|CP000223.1| Drosophila melanogaster genomic scaffold 211000022280790
          Length = 626829

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tcttacacttctatttatac 140
              ||||||||||||||||||||
Sbjct: 559851 tcttacacttctatttatac 559832



to top

>gb|CP000203.1| Drosophila melanogaster genomic scaffold 211000022280760
          Length = 90124

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   tcttacacttctatttatac 140
             ||||||||||||||||||||
Sbjct: 36176 tcttacacttctatttatac 36157



to top

>gb|CP000191.1| Drosophila melanogaster genomic scaffold 211000022280172
          Length = 132906

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   tcttacacttctatttatac 140
             ||||||||||||||||||||
Sbjct: 30245 tcttacacttctatttatac 30264


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,053,980
Number of Sequences: 3902068
Number of extensions: 2053980
Number of successful extensions: 41035
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41011
Number of HSP's gapped (non-prelim): 24
length of query: 282
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 260
effective length of database: 17,147,199,772
effective search space: 4458271940720
effective search space used: 4458271940720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top