>gb|AC019043.8| Homo sapiens BAC clone RP11-11B21 from 7, complete sequence
          Length = 211680

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 55     gagcctgggggagccggacgg 75
              |||||||||||||||||||||
Sbjct: 198553 gagcctgggggagccggacgg 198533

>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012
          Length = 2668010

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 15      gtacagattgctttgcagaa 34
               ||||||||||||||||||||
Sbjct: 1215487 gtacagattgctttgcagaa 1215468

>emb|CR718273.2|CNS0GH5Z Tetraodon nigroviridis full-length cDNA
          Length = 1097

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 59  ctgggggagccggacggctcagccggt 85
           |||||| ||||||||||||||| ||||
Sbjct: 621 ctggggcagccggacggctcaggcggt 647

>emb|CR859902.1| Pongo pygmaeus mRNA; cDNA DKFZp469D204 (from clone DKFZp469D204)
          Length = 3883

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 46  ttgggactggagcctgggg 64
           |||||||||||||||||||
Sbjct: 174 ttgggactggagcctgggg 192

>emb|AL731866.8| Mouse DNA sequence from clone RP23-37F22 on chromosome 11 Contains the
             5' end of a variant of the Ccl1 gene for chemokine (C-C
             motif) ligand 1, complete sequence
          Length = 105085

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    attgggactggagcctggg 63
             |||||||||||||||||||
Sbjct: 18288 attgggactggagcctggg 18270

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 32       gaaaggccaacgtattggg 50
                |||||||||||||||||||
Sbjct: 32392125 gaaaggccaacgtattggg 32392107

>gb|AC016903.3| Homo sapiens BAC clone RP11-259I20 from 2, complete sequence
          Length = 172512

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     agattgctttgcagaaagg 37
              |||||||||||||||||||
Sbjct: 107254 agattgctttgcagaaagg 107272

>ref|XM_228270.3| PREDICTED: Rattus norvegicus similar to KIAA1919 protein
           (predicted) (LOC309809), mRNA
          Length = 1680

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  ggagcctgggggagccgga 72
           |||||||||||||||||||
Sbjct: 95  ggagcctgggggagccgga 113

>dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome
          Length = 1669695

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     ggactggagcctgggggag 67
              |||||||||||||||||||
Sbjct: 722231 ggactggagcctgggggag 722249

>dbj|AP004125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1767_D02
          Length = 139145

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    gaaaggccaacgtattggg 50
             |||||||||||||||||||
Sbjct: 53638 gaaaggccaacgtattggg 53620

>emb|AL713840.1|CNS07YOU Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
              clone 425A1 of library Caltech CITB-BAC from chromosome 11
              of Mus musculus (mouse)
          Length = 128620

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     attgggactggagcctggg 63
              |||||||||||||||||||
Sbjct: 119136 attgggactggagcctggg 119154


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 649,520
Number of Sequences: 3902068
Number of extensions: 649520
Number of successful extensions: 44425
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44383
Number of HSP's gapped (non-prelim): 42
length of query: 132
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 111
effective length of database: 17,151,101,840
effective search space: 1903772304240
effective search space used: 1903772304240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)