>emb|X07851.1|TARSBA Wheat mRNA for Rubisco subunit binding-protein alpha subunit
          Length = 1834

 Score =  212 bits (107), Expect = 4e-52
 Identities = 220/257 (85%), Gaps = 14/257 (5%)
 Strand = Plus / Minus

                                                                        
Query: 26   agatcaggcgaggaangncccctttcgattcgcaaaaatggcaatcctactct------a 79
            ||||||||||||||| |   || ||||||||||||||||||||||||||||||      |
Sbjct: 1798 agatcaggcgaggaaggttaccgttcgattcgcaaaaatggcaatcctactcttactcta 1739

                                                                        
Query: 80   gacctttttcactnncaattgatctcaaccaaaattctactgcttggcctgaactgaagc 139
            |||||||  ||||  || |||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 1738 gaccttt--cactttcagttgatctcaaccgaaattctactgcttggcctgaactgaggc 1681

                                                                        
Query: 140  atctaaaaaacacggacgaggcctgaagag--ctttacag---gctcgatcagacggaga 194
            |||||||||| ||||| |||||||||||||  |||||||    |||||||||||||||||
Sbjct: 1680 atctaaaaaa-acggaggaggcctgaagagagctttacatacagctcgatcagacggaga 1622

                                                                        
Query: 195  gctgnccctccgctggctnntttnccttagccttcggcttgggcttctcgacgacgatcg 254
            |||| |||||||||||||      |||| | ||| |||||||||||||||||||||||||
Sbjct: 1621 gctgcccctccgctggctcggcgaccttgggcttgggcttgggcttctcgacgacgatcg 1562

                             
Query: 255  nttgcgtggtgaggacc 271
             ||||||||||||||||
Sbjct: 1561 cttgcgtggtgaggacc 1545

>gb|AC129290.4| Mus musculus BAC clone RP24-489L4 from chromosome 6, complete sequence
          Length = 188132

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cctgaactgaagcatctaaa 146
              ||||||||||||||||||||
Sbjct: 123998 cctgaactgaagcatctaaa 124017

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 229     cggcttgggcttctcgacga 248
               ||||||||||||||||||||
Sbjct: 2275572 cggcttgggcttctcgacga 2275553

>gb|AC138405.6| Mus musculus chromosome 1, clone RP24-280N11, complete sequence
          Length = 151783

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 221    ttagccttcggcttgggctt 240
              ||||||||||||||||||||
Sbjct: 147389 ttagccttcggcttgggctt 147408

>gb|AC147627.6| Mus musculus BAC clone RP24-382F19 from Y, complete sequence
          Length = 226237

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    gaactgaagcatctaaaaaa 149
              ||||||||||||||||||||
Sbjct: 206536 gaactgaagcatctaaaaaa 206517

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 229     cggcttgggcttctcgacga 248
               ||||||||||||||||||||
Sbjct: 2297918 cggcttgggcttctcgacga 2297899

>gb|AC173476.2| Mus musculus BAC clone RP24-335D7 from chromosome 12, complete sequence
          Length = 182245

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    gaactgaagcatctaaaaaa 149
              ||||||||||||||||||||
Sbjct: 115349 gaactgaagcatctaaaaaa 115330


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,445,825
Number of Sequences: 3902068
Number of extensions: 1445825
Number of successful extensions: 20241
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20220
Number of HSP's gapped (non-prelim): 19
length of query: 272
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 250
effective length of database: 17,147,199,772
effective search space: 4286799943000
effective search space used: 4286799943000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)