Clone Name | rbasd22p21 |
---|---|
Clone Library Name | barley_pub |
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor complex, complete cds Length = 1828 Score = 208 bits (105), Expect = 2e-50 Identities = 191/219 (87%), Gaps = 3/219 (1%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactga---cagtgggctgtccttggccgcg 362 |||||||||||||| ||| || |||||||||||| |||||||||||||||| || | Sbjct: 1452 ggcttggccagggttcgcttcgtagccttcactgaaagcagtgggctgtccttgcccatg 1393 Query: 363 aggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtga 422 ||||| ||||||||| || |||||||||||| |||| ||| |||||||||||||||||| Sbjct: 1392 aggcaggttccctgcctgacgttgcagatggggtagtcatgggggcagcagctgtagtga 1333 Query: 423 tcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccg 482 || ||||||||||| || ||||| || ||||| ||||||||||||||||| | ||||||| Sbjct: 1332 tcgtcgcagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgccg 1273 Query: 483 tactcgtagatgcagcagcaggtcgtgctcgcagggcac 521 ||||||||||||||||||||||| ||||| |||||||| Sbjct: 1272 tactcgtagatgcagcagcaggtggtgctgtcagggcac 1234
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence Length = 1878 Score = 198 bits (100), Expect = 2e-47 Identities = 163/184 (88%) Strand = Plus / Minus Query: 338 tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 397 ||||||||||||||||||| || |||||| ||||||||| || |||||||||||| || Sbjct: 1453 tgacagtgggctgtccttgcccatgaggcaggttccctgcctgacgttgcagatggggta 1394 Query: 398 gttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaaca 457 || ||| |||||||||||||||||||| ||||||||||| || ||||| || ||||| || Sbjct: 1393 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1334 Query: 458 gccccaggcgaagcactccttgccgtactcgtagatgcagcagcaggtcgtgctcgcagg 517 ||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |||| Sbjct: 1333 gccccaggcgaagcagtacttgccgtactcgtagatgcagcagcaggtggtgctgtcagg 1274 Query: 518 gcac 521 |||| Sbjct: 1273 gcac 1270
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1377 Score = 192 bits (97), Expect = 9e-46 Identities = 251/301 (83%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 365 ||||| |||||||||||| || |||||||||||| |||||| |||||||| ||| |||| Sbjct: 1331 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1272 Query: 366 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 425 || |||||||||| ||||||||||| || | |||||||||||||||||||||||| Sbjct: 1271 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1212 Query: 426 tcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccgtac 485 ||||||||||| || ||||| |||||||| |||||||||||| |||| | ||||| ||| Sbjct: 1211 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgccatac 1152 Query: 486 tcgtagatgcagcagcaggtcgtgctcgcagggcactcgttgtagctgtcacagacggaa 545 |||||||||||||||||||| ||||| | ||||| || |||| |||| ||||||| Sbjct: 1151 tcgtagatgcagcagcaggtggtgctatcggggcaagtgtagtagttgtcgcagacggtg 1092 Query: 546 gacggtggggcgggagacggtggagttgggcccggggttaggggggttctcgcccgtctt 605 | || |||| || ||||| ||||| ||| |||||||| ||||||||||||||| |||| Sbjct: 1091 ggaggcggggttggggacggcggagtaggg-ccggggttcggggggttctcgcccttctt 1033 Query: 606 c 606 | Sbjct: 1032 c 1032
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full insert sequence Length = 1753 Score = 192 bits (97), Expect = 9e-46 Identities = 251/301 (83%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 365 ||||| |||||||||||| || |||||||||||| |||||| |||||||| ||| |||| Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337 Query: 366 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 425 || |||||||||| ||||||||||| || | |||||||||||||||||||||||| Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277 Query: 426 tcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccgtac 485 ||||||||||| || ||||| |||||||| |||||||||||| |||| | ||||| ||| Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgccatac 1217 Query: 486 tcgtagatgcagcagcaggtcgtgctcgcagggcactcgttgtagctgtcacagacggaa 545 |||||||||||||||||||| ||||| | ||||| || |||| |||| ||||||| Sbjct: 1216 tcgtagatgcagcagcaggtggtgctatcggggcaagtgtagtagttgtcgcagacggtg 1157 Query: 546 gacggtggggcgggagacggtggagttgggcccggggttaggggggttctcgcccgtctt 605 | || |||| || ||||| ||||| ||| |||||||| ||||||||||||||| |||| Sbjct: 1156 ggaggcggggttggggacggcggagtaggg-ccggggttcggggggttctcgcccttctt 1098 Query: 606 c 606 | Sbjct: 1097 c 1097 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Minus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||| || || |||||||||||| ||||||||| | || |||| Sbjct: 1667 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1610 Query: 96 ccgatttt 103 ||| |||| Sbjct: 1609 ccgttttt 1602
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full insert sequence Length = 1774 Score = 192 bits (97), Expect = 9e-46 Identities = 251/301 (83%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 365 ||||| |||||||||||| || |||||||||||| |||||| |||||||| ||| |||| Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337 Query: 366 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 425 || |||||||||| ||||||||||| || | |||||||||||||||||||||||| Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277 Query: 426 tcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccgtac 485 ||||||||||| || ||||| |||||||| |||||||||||| |||| | ||||| ||| Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgccatac 1217 Query: 486 tcgtagatgcagcagcaggtcgtgctcgcagggcactcgttgtagctgtcacagacggaa 545 |||||||||||||||||||| ||||| | ||||| || |||| |||| ||||||| Sbjct: 1216 tcgtagatgcagcagcaggtggtgctatcggggcaagtgtagtagttgtcgcagacggtg 1157 Query: 546 gacggtggggcgggagacggtggagttgggcccggggttaggggggttctcgcccgtctt 605 | || |||| || ||||| ||||| ||| |||||||| ||||||||||||||| |||| Sbjct: 1156 ggaggcggggttggggacggcggagtaggg-ccggggttcggggggttctcgcccttctt 1098 Query: 606 c 606 | Sbjct: 1097 c 1097
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full insert sequence Length = 976 Score = 192 bits (97), Expect = 9e-46 Identities = 251/301 (83%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 365 ||||| |||||||||||| || |||||||||||| |||||| |||||||| ||| |||| Sbjct: 598 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 539 Query: 366 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 425 || |||||||||| ||||||||||| || | |||||||||||||||||||||||| Sbjct: 538 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 479 Query: 426 tcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccgtac 485 ||||||||||| || ||||| |||||||| |||||||||||| |||| | ||||| ||| Sbjct: 478 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgccatac 419 Query: 486 tcgtagatgcagcagcaggtcgtgctcgcagggcactcgttgtagctgtcacagacggaa 545 |||||||||||||||||||| ||||| | ||||| || |||| |||| ||||||| Sbjct: 418 tcgtagatgcagcagcaggtggtgctatcggggcaagtgtagtagttgtcgcagacggtg 359 Query: 546 gacggtggggcgggagacggtggagttgggcccggggttaggggggttctcgcccgtctt 605 | || |||| || ||||| ||||| ||| |||||||| ||||||||||||||| |||| Sbjct: 358 ggaggcggggttggggacggcggagtaggg-ccggggttcggggggttctcgcccttctt 300 Query: 606 c 606 | Sbjct: 299 c 299 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Minus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||| || || |||||||||||| ||||||||| | || |||| Sbjct: 869 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 812 Query: 96 ccgatttt 103 ||| |||| Sbjct: 811 ccgttttt 804
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha, complete cds Length = 1929 Score = 192 bits (97), Expect = 9e-46 Identities = 251/301 (83%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 365 ||||| |||||||||||| || |||||||||||| |||||| |||||||| ||| |||| Sbjct: 1376 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1317 Query: 366 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 425 || |||||||||| ||||||||||| || | |||||||||||||||||||||||| Sbjct: 1316 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1257 Query: 426 tcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgccgtac 485 ||||||||||| || ||||| |||||||| |||||||||||| |||| | ||||| ||| Sbjct: 1256 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgccatac 1197 Query: 486 tcgtagatgcagcagcaggtcgtgctcgcagggcactcgttgtagctgtcacagacggaa 545 |||||||||||||||||||| ||||| | ||||| || |||| |||| ||||||| Sbjct: 1196 tcgtagatgcagcagcaggtggtgctatcggggcaagtgtagtagttgtcgcagacggtg 1137 Query: 546 gacggtggggcgggagacggtggagttgggcccggggttaggggggttctcgcccgtctt 605 | || |||| || ||||| ||||| ||| |||||||| ||||||||||||||| |||| Sbjct: 1136 ggaggcggggttggggacggcggagtaggg-ccggggttcggggggttctcgcccttctt 1078 Query: 606 c 606 | Sbjct: 1077 c 1077 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Minus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||| || || |||||||||||| ||||||||| | || |||| Sbjct: 1647 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1590 Query: 96 ccgatttt 103 ||| |||| Sbjct: 1589 ccgttttt 1582
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds Length = 1830 Score = 182 bits (92), Expect = 9e-43 Identities = 161/184 (87%) Strand = Plus / Minus Query: 338 tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 397 ||||||||||||||||||| || ||| | ||||||||| || |||||||||||| || Sbjct: 1418 tgacagtgggctgtccttgcccatgagcgaggttccctgcctgacgttgcagatggggta 1359 Query: 398 gttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaaca 457 || ||| |||||||||||||||||||| ||||||||||| || ||||| || ||||| || Sbjct: 1358 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1299 Query: 458 gccccaggcgaagcactccttgccgtactcgtagatgcagcagcaggtcgtgctcgcagg 517 ||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |||| Sbjct: 1298 gccccaggcgaagcagtacttgccgtactcgtagatgcagcagcaggtggtgctgtcagg 1239 Query: 518 gcac 521 |||| Sbjct: 1238 gcac 1235
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 149 bits (75), Expect = 1e-32 Identities = 187/223 (83%), Gaps = 1/223 (0%) Strand = Plus / Plus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 ||||||||||| || | ||||||||||||||||||||||||||||||||||| || ||| Sbjct: 33157777 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 33157836 Query: 444 tcaagtgggcaacagccccaggcgaagcactccttgccgtactcgtagatgcagcagcag 503 || |||||||| |||||||||||| |||| | ||||| ||||||||||||||||||||| Sbjct: 33157837 tcgagtgggcagcagccccaggcgtagcagtatttgccatactcgtagatgcagcagcag 33157896 Query: 504 gtcgtgctcgcagggcactcgttgtagctgtcacagacggaagacggtggggcgggagac 563 || ||||| | ||||| || |||| |||| ||||||| | || |||| || ||| Sbjct: 33157897 gtggtgctatcggggcaagtgtagtagttgtcgcagacggtgggaggcggggttggggac 33157956 Query: 564 ggtggagttgggcccggggttaggggggttctcgcccgtcttc 606 || ||||| ||| |||||||| ||||||||||||||| ||||| Sbjct: 33157957 ggcggagtaggg-ccggggttcggggggttctcgcccttcttc 33157998 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 355 ||||| |||||||||||| || |||||||||||| |||||| |||||||| Sbjct: 33157603 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 33157652 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 34207822 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 34207881 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 34207882 accttcaactgggcaacagcccca 34207905 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Plus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||||| || |||||||||||| ||||||||| | || |||| Sbjct: 33157332 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 33157389 Query: 96 ccgatttt 103 ||| |||| Sbjct: 33157390 ccgttttt 33157397
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete sequence Length = 118971 Score = 149 bits (75), Expect = 1e-32 Identities = 187/223 (83%), Gaps = 1/223 (0%) Strand = Plus / Plus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 ||||||||||| || | ||||||||||||||||||||||||||||||||||| || ||| Sbjct: 48170 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 48229 Query: 444 tcaagtgggcaacagccccaggcgaagcactccttgccgtactcgtagatgcagcagcag 503 || |||||||| |||||||||||| |||| | ||||| ||||||||||||||||||||| Sbjct: 48230 tcgagtgggcagcagccccaggcgtagcagtatttgccatactcgtagatgcagcagcag 48289 Query: 504 gtcgtgctcgcagggcactcgttgtagctgtcacagacggaagacggtggggcgggagac 563 || ||||| | ||||| || |||| |||| ||||||| | || |||| || ||| Sbjct: 48290 gtggtgctatcggggcaagtgtagtagttgtcgcagacggtgggaggcggggttggggac 48349 Query: 564 ggtggagttgggcccggggttaggggggttctcgcccgtcttc 606 || ||||| ||| |||||||| ||||||||||||||| ||||| Sbjct: 48350 ggcggagtaggg-ccggggttcggggggttctcgcccttcttc 48391 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 355 ||||| |||||||||||| || |||||||||||| |||||| |||||||| Sbjct: 47996 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 48045 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Plus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||||| || |||||||||||| ||||||||| | || |||| Sbjct: 47725 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 47782 Query: 96 ccgatttt 103 ||| |||| Sbjct: 47783 ccgttttt 47790
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02, complete sequence Length = 165745 Score = 149 bits (75), Expect = 1e-32 Identities = 187/223 (83%), Gaps = 1/223 (0%) Strand = Plus / Plus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 ||||||||||| || | ||||||||||||||||||||||||||||||||||| || ||| Sbjct: 40427 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 40486 Query: 444 tcaagtgggcaacagccccaggcgaagcactccttgccgtactcgtagatgcagcagcag 503 || |||||||| |||||||||||| |||| | ||||| ||||||||||||||||||||| Sbjct: 40487 tcgagtgggcagcagccccaggcgtagcagtatttgccatactcgtagatgcagcagcag 40546 Query: 504 gtcgtgctcgcagggcactcgttgtagctgtcacagacggaagacggtggggcgggagac 563 || ||||| | ||||| || |||| |||| ||||||| | || |||| || ||| Sbjct: 40547 gtggtgctatcggggcaagtgtagtagttgtcgcagacggtgggaggcggggttggggac 40606 Query: 564 ggtggagttgggcccggggttaggggggttctcgcccgtcttc 606 || ||||| ||| |||||||| ||||||||||||||| ||||| Sbjct: 40607 ggcggagtaggg-ccggggttcggggggttctcgcccttcttc 40648 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 355 ||||| |||||||||||| || |||||||||||| |||||| |||||||| Sbjct: 40253 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 40302 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/68 (83%), Gaps = 2/68 (2%) Strand = Plus / Plus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 95 |||||| |||||||||||||| || |||||||||||| ||||||||| | || |||| Sbjct: 39982 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 40039 Query: 96 ccgatttt 103 ||| |||| Sbjct: 40040 ccgttttt 40047
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence Length = 718 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 46.1 bits (23), Expect = 0.14 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Minus Query: 36 agctgagttttacatatacatatgcaaaagcaaatttgg 74 |||||| |||||||| || |||||||||||||||||||| Sbjct: 561 agctgaattttacat-tatatatgcaaaagcaaatttgg 524
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence Length = 715 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 362 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 421 |||||| |||||||||| | |||||||||||| |||| ||| ||||||||||||||||| Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65 Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcgaagcactccttgcc 481 ||| || |||||||| || ||||| || ||||| ||||||||||||||||| | |||||| Sbjct: 64 atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5 Score = 69.9 bits (35), Expect = 9e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 306 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 356 |||||||||||||| ||| || |||||||||||||||||||||||||||| Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atatgcaaaagcaaatttgg 74 |||||||||||||||||||| Sbjct: 543 atatgcaaaagcaaatttgg 524
>gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, complete cds Length = 1831 Score = 93.7 bits (47), Expect = 6e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 369 gttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcg 428 |||||||| || |||||||||||||||||| ||| ||||||||||| || || || || Sbjct: 1336 gttccctggttaatgttgcagatgggatagtcatgtgggcagcagctataatggtcttca 1277 Query: 429 cagcaggtagcaccctcaagtgggcaacagcccca 463 |||||||||||||||||||||||||| || ||||| Sbjct: 1276 cagcaggtagcaccctcaagtgggcagcatcccca 1242
>emb|AJ844007.1| Plantago major partial mRNA for cysteine protease 3 (cpr3 gene) Length = 648 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Minus Query: 408 cagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagccccaggcg 467 ||||| ||||| || || || |||||||| |||||||||||||| ||||| ||||| ||| Sbjct: 153 cagcaactgtaatggtcctcacagcaggtggcaccctcaagtggacaacatccccatgcg 94 Query: 468 aagcactccttgccgtactcgtagatgcagcagcaggtcgtgctcgcagggca 520 |||||||| | |||||| ||||||||||||||||| |||||| ||||||| Sbjct: 93 aagcactcaccccagtactcatagatgcagcagcaggtagtgctctcagggca 41
>emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor (clone cp71) Length = 1680 Score = 87.7 bits (44), Expect = 4e-14 Identities = 62/68 (91%) Strand = Plus / Minus Query: 381 gtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagca 440 ||||||||||||||||||| ||| |||||||| |||||||| ||||| |||||||||||| Sbjct: 1260 gtgttgcagatgggatagtcatgggggcagcaactgtagtggtcatcacagcaggtagca 1201 Query: 441 ccctcaag 448 || ||||| Sbjct: 1200 ccttcaag 1193
>emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine proteinase, partial Length = 995 Score = 67.9 bits (34), Expect = 4e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 383 gttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcacc 442 ||||||||||||||| | ||| |||||||| ||||| || ||||| ||||| || ||| | Sbjct: 599 gttgcagatgggatactcatgtgggcagcaactgtaatggtcatcacagcaagtggcagc 540 Query: 443 ctcaagtgggcaacagccccaggcgaagca 472 ||| ||||||||||| ||||| ||||||| Sbjct: 539 ctcgagtgggcaacatccccactcgaagca 510
>gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine protease (PRT15) mRNA, partial cds Length = 1456 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 |||||||| ||| ||| ||| ||||||||||| |||||||||| |||||||| ||||| Sbjct: 989 ttgcagataggaaagtcatgggggcagcagctagagtgatcatcacagcaggtggcacct 930 Query: 444 tcaagtgggcaacagccccaggcgaagca 472 ||||| || || || ||||| |||||||| Sbjct: 929 tcaagaggacagcacccccatgcgaagca 901
>gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseudotzain (PM33cysP) mRNA, complete cds Length = 1882 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 404 agggcagcagctgtagtgatcatcgcagcaggt 436 ||||||||||||||||||||| ||||||||||| Sbjct: 1398 agggcagcagctgtagtgatcgtcgcagcaggt 1366
>ref|XM_474291.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1401 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 1314 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1255 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 1254 accttcaactgggcaacagcccca 1231
>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12, complete sequence Length = 190432 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 119204 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 119263 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 119264 accttcaactgggcaacagcccca 119287
>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence Length = 97953 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagca 440 |||||||||||| |||||||||||||| ||||| |||||| Sbjct: 70783 atgagggcagcaactgtagtgatcatcacagcaagtagca 70822
>gb|AF366556.1| Oryza sativa saline responsive OSSRIII protein mRNA, partial cds Length = 368 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 287 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 228 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 227 accttcaactgggcaacagcccca 204
>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence Length = 124676 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagca 440 |||||||||||| |||||||||||||| ||||| |||||| Sbjct: 82072 atgagggcagcaactgtagtgatcatcacagcaagtagca 82111
>dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease, complete cds Length = 1668 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggt 436 |||||||||||| ||||||||||||||||||| Sbjct: 1252 gggcagcagctggagtgatcatcgcagcaggt 1221
>dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease, complete cds Length = 1768 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggt 436 ||||||||||||||||||||||| |||||||| Sbjct: 1395 gggcagcagctgtagtgatcatcacagcaggt 1364
>dbj|AK109371.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E09, full insert sequence Length = 1766 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 1418 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1359 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 1358 accttcaactgggcaacagcccca 1335
>dbj|AK073373.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033027D09, full insert sequence Length = 1753 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 1419 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1360 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 1359 accttcaactgggcaacagcccca 1336
>emb|AL732346.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818H01, complete sequence Length = 101125 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Plus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 58524 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 58583 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 58584 accttcaactgggcaacagcccca 58607
>dbj|D90407.1|RICOZB Oryza sativa (japonica cultivar-group) mRNA for oryzain beta, complete cds Length = 1675 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 1330 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1271 Query: 440 accctcaagtgggcaacagcccca 463 ||| |||| ||||||||||||||| Sbjct: 1270 accttcaactgggcaacagcccca 1247
>dbj|AB252653.1| Platycodon grandiflorus PgCP1 mRNA for cysteine proteinase, complete cds Length = 1676 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcccca 463 |||||||| || || |||||||| |||||||| ||||| ||||||||||| || ||||| Sbjct: 1273 gggcagcaactataatgatcatcacagcaggtggcaccgtcaagtgggcagcatcccca 1215
>dbj|AK099358.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044I21, full insert sequence Length = 1742 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Minus Query: 380 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 439 ||||||||||| || |||| | | |||||||||||| ||||| | ||||||||| || Sbjct: 1394 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1335 Query: 440 accctcaagtgggcaacagccc 461 ||| |||| ||||||||||||| Sbjct: 1334 accttcaactgggcaacagccc 1313
>emb|AJ003137.1|LEAJ3137 Lycopersicon esculentum mRNA for cysteine protease CYP1, complete CDS Length = 1756 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 |||||||| ||||||| || |||||||| |||||||| || || ||||| || || || Sbjct: 1308 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 1249 Query: 444 tcaagtgggcaacagccccaggcgaagca 472 ||||||||||| || ||||| | |||||| Sbjct: 1248 tcaagtgggcagcatccccaagagaagca 1220
>gb|AF172856.1|AF172856 Lycopersicon esculentum cysteine protease TDI-65 (tdi-65) mRNA, complete cds Length = 1779 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 |||||||| ||||||| || |||||||| |||||||| || || ||||| || || || Sbjct: 1327 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 1268 Query: 444 tcaagtgggcaacagccccaggcgaagca 472 ||||||||||| || ||||| | |||||| Sbjct: 1267 tcaagtgggcagcatccccaagagaagca 1239
>dbj|AB098631.1| Daucus carota DcCysP8 mRNA for cysteine protease, complete cds Length = 1884 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 422 atcatcgcagcaggtagcaccctcaagtgggcaacagccccaggc 466 ||||||||| |||| ||| |||||||| ||||| ||||||||||| Sbjct: 1364 atcatcgcaacaggaagcgccctcaagagggcagcagccccaggc 1320
>dbj|AB109186.1| Helianthus annuus scp1 mRNA for cysteine protease-1, complete cds Length = 1589 Score = 50.1 bits (25), Expect = 0.009 Identities = 109/137 (79%) Strand = Plus / Minus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 |||||||| ||||| | ||| |||||||| ||||| |||||||| ||||| | ||||||| Sbjct: 1320 ttgcagattggataatcatgtgggcagcaactgtaatgatcatcacagcaagaagcaccc 1261 Query: 444 tcaagtgggcaacagccccaggcgaagcactccttgccgtactcgtagatgcagcagcag 503 || | || ||||| ||||| ||||| || | |||||| ||||||||||||||| Sbjct: 1260 tctaacggacaacatccccaagcgaaacagtagccatagtactcatagatgcagcagcag 1201 Query: 504 gtcgtgctcgcagggca 520 || ||||| ||||||| Sbjct: 1200 gttgtgctttcagggca 1184
>gb|M21444.1|TOMLTITP Lycopersicon esculentum low-temperature-induced thiol protease mRNA, complete cds Length = 1353 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 384 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 443 |||||||| ||||||| || |||||||| |||||||| || || ||||| || || || Sbjct: 920 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 861 Query: 444 tcaagtgggcaacagccccaggcgaagca 472 ||||||||||| || ||||| | |||||| Sbjct: 860 tcaagtgggcagcatccccaagagaagca 832
>dbj|AB098628.1| Daucus carota DcCysP5 mRNA for cysteine protease, complete cds Length = 1928 Score = 46.1 bits (23), Expect = 0.14 Identities = 59/71 (83%) Strand = Plus / Minus Query: 393 ggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtggg 452 ||||||| ||| || ||||| || ||| |||||||||||||| |||| ||||||| ||| Sbjct: 1454 ggatagtcatgtggacagcaactatagccatcatcgcagcaggaagcagcctcaagcggg 1395 Query: 453 caacagcccca 463 || || ||||| Sbjct: 1394 cagcaacccca 1384
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence Length = 202981 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 aacccgattttaggattatgtacaggagcat 123 |||||||||||||||||| | |||||||||| Sbjct: 65968 aacccgattttaggattaggaacaggagcat 65998
>emb|X66061.1|PSTHIOL P.sativum mRNA for thiolprotease Length = 1820 Score = 44.1 bits (22), Expect = 0.54 Identities = 52/62 (83%) Strand = Plus / Minus Query: 402 tgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagccc 461 ||||||||||| ||||| ||||| || ||||| |||||| ||| || |||||||| ||| Sbjct: 1264 tgagggcagcaactgtaatgatcgtcacagcaagtagcagactctagagggcaacatccc 1205 Query: 462 ca 463 || Sbjct: 1204 ca 1203
>gb|AF454957.1| Brassica oleracea senescence-associated cysteine protease (CP2) mRNA, complete cds Length = 1699 Score = 44.1 bits (22), Expect = 0.54 Identities = 70/86 (81%) Strand = Plus / Minus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcc 460 |||||| |||||||| || |||||||||||| |||||| | || || |||||||| || Sbjct: 1284 atgaggacagcagctagtgttatcatcgcagcaagtagcagcttcgagagggcaacatcc 1225 Query: 461 ccaggcgaagcactccttgccgtact 486 ||| ||||||| | ||| ||||||| Sbjct: 1224 ccaaccgaagcagtacttaccgtact 1199
>gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, complete cds Length = 1575 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggtagcaccctc 445 ||||||||||||||||| || | ||||||||| || ||||| Sbjct: 1286 gggcagcagctgtagtggtccttgcagcaggtcgccccctc 1246
>gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, complete cds Length = 1597 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggtagcaccctc 445 ||||||||||||||||| || | ||||||||| || ||||| Sbjct: 1315 gggcagcagctgtagtggtctttgcagcaggtcgccccctc 1275
>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21, complete sequence Length = 129478 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 43 ttttacatatacatatgcaaaagca 67 |||||||| |||||||||||||||| Sbjct: 119390 ttttacatttacatatgcaaaagca 119414
>emb|AL596164.1| Listeria innocua Clip11262 complete genome, segment 2/12 Length = 224650 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 402 tgagggcagcagctgtagtgatcatcgcagcag 434 |||| ||||||| |||||| ||||||||||||| Sbjct: 200315 tgagcgcagcagatgtagttatcatcgcagcag 200347
>gb|AC114899.5| Ustilago hordei strain 4875-4 clone uhobac-1n1, complete sequence Length = 100185 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 501 caggtcgtgctcgcagggcac 521 ||||||||||||||||||||| Sbjct: 89349 caggtcgtgctcgcagggcac 89329
>emb|AM118080.1| Ustilago hordei mating type region MAT-1, strain 364 Length = 526707 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 501 caggtcgtgctcgcagggcac 521 ||||||||||||||||||||| Sbjct: 363354 caggtcgtgctcgcagggcac 363334
>ref|NM_123672.2| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type peptidase AT5G43060 mRNA, complete cds Length = 1675 Score = 40.1 bits (20), Expect = 8.4 Identities = 59/72 (81%) Strand = Plus / Minus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcc 460 |||||| ||||| || ||| |||||||||||| |||||| | || || |||||||| || Sbjct: 1306 atgaggacagcaacttgagttatcatcgcagcaagtagcagcttcgagcgggcaacatcc 1247 Query: 461 ccaggcgaagca 472 ||| ||||||| Sbjct: 1246 ccatccgaagca 1235
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence Length = 235813 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 118 gagcatctattataaagaagatac 141 ||||||||||||||||| |||||| Sbjct: 211168 gagcatctattataaaggagatac 211191
>ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen 11/4 precursor - chicken (LOC426939), mRNA Length = 1599 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 tatgagggcagcagctgtag 419 |||||||||||||||||||| Sbjct: 159 tatgagggcagcagctgtag 140
>ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen 11/4 precursor - chicken (LOC425214), partial mRNA Length = 1648 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 tatgagggcagcagctgtag 419 |||||||||||||||||||| Sbjct: 706 tatgagggcagcagctgtag 687
>ref|XM_608030.2| PREDICTED: Bos taurus aminopeptidase N, transcript variant 1 (APN), mRNA Length = 2610 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 552 ggggcgggagacggtggagttggg 575 |||||||| ||||||||||||||| Sbjct: 1803 ggggcgggtgacggtggagttggg 1780
>ref|XM_875495.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 4 (APN), mRNA Length = 3504 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 552 ggggcgggagacggtggagttggg 575 |||||||| ||||||||||||||| Sbjct: 1878 ggggcgggtgacggtggagttggg 1855
>ref|XM_875424.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 3 (APN), mRNA Length = 3495 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 552 ggggcgggagacggtggagttggg 575 |||||||| ||||||||||||||| Sbjct: 1869 ggggcgggtgacggtggagttggg 1846
>ref|XM_865178.1| PREDICTED: Bos taurus aminopeptidase N, transcript variant 2 (APN), mRNA Length = 3495 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 552 ggggcgggagacggtggagttggg 575 |||||||| ||||||||||||||| Sbjct: 1869 ggggcgggtgacggtggagttggg 1846
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds Length = 3146 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 107 attatgtacaggagcatctattat 130 |||| ||||||||||||||||||| Sbjct: 1972 attaggtacaggagcatctattat 1995
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence Length = 170236 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 47 acatatacatatgcaaaagcaaat 70 ||||||||||||||||||| |||| Sbjct: 96777 acatatacatatgcaaaagtaaat 96754
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome Length = 85779 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 aaatttggtggttctgtaaa 86 |||||||||||||||||||| Sbjct: 41670 aaatttggtggttctgtaaa 41689
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete sequence Length = 250743 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 atacatatgcaaaagcaaat 70 |||||||||||||||||||| Sbjct: 171275 atacatatgcaaaagcaaat 171294
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5' end of the RORB gene for RAR-related orphan receptor B protein (RZRB, ROR-BETA), two novel genes and two CpG islands, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 191 gtgatcatttgcagaagttaatca 214 |||||||||| ||||||||||||| Sbjct: 81873 gtgatcattttcagaagttaatca 81896
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains pseudogene similar to part of a novel gene (KIAA1688), a solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6) (ANT3) pseudogene and a CpG island, complete sequence Length = 169550 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 43 ttttacatatacatatgcaa 62 |||||||||||||||||||| Sbjct: 22532 ttttacatatacatatgcaa 22513
>gb|AC079313.35| Homo sapiens 12q BAC RP11-753H16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160232 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 542 ggaagacggtggggcgggagacgg 565 |||||||| ||||||||||||||| Sbjct: 23023 ggaagacgctggggcgggagacgg 23046
>emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for cytochrome B extending from map position 71.3 to 80.2. (Strain D273-10B.) Length = 6264 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 aaatttggtggttctgtaaa 86 |||||||||||||||||||| Sbjct: 1475 aaatttggtggttctgtaaa 1494
>gb|AY114661.1| Arabidopsis thaliana cysteine protease component of protease-inhibitor complex (At5g43060) mRNA, complete cds Length = 1485 Score = 40.1 bits (20), Expect = 8.4 Identities = 59/72 (81%) Strand = Plus / Minus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcc 460 |||||| ||||| || ||| |||||||||||| |||||| | || || |||||||| || Sbjct: 1263 atgaggacagcaacttgagttatcatcgcagcaagtagcagcttcgagcgggcaacatcc 1204 Query: 461 ccaggcgaagca 472 ||| ||||||| Sbjct: 1203 ccatccgaagca 1192
>gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion origin of replication (ori6) and oli1 gene, complete cds Length = 8316 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 aaatttggtggttctgtaaa 86 |||||||||||||||||||| Sbjct: 2631 aaatttggtggttctgtaaa 2650
>gb|BC105142.1| Bos taurus cDNA clone MGC:126949 IMAGE:7929135, complete cds Length = 3412 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 552 ggggcgggagacggtggagttggg 575 |||||||| ||||||||||||||| Sbjct: 1768 ggggcgggtgacggtggagttggg 1745
>gb|AY062608.1| Arabidopsis thaliana cysteine protease component of protease-inhibitor complex (At5g43060; MMG4.7) mRNA, complete cds Length = 1628 Score = 40.1 bits (20), Expect = 8.4 Identities = 59/72 (81%) Strand = Plus / Minus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcc 460 |||||| ||||| || ||| |||||||||||| |||||| | || || |||||||| || Sbjct: 1307 atgaggacagcaacttgagttatcatcgcagcaagtagcagcttcgagcgggcaacatcc 1248 Query: 461 ccaggcgaagca 472 ||| ||||||| Sbjct: 1247 ccatccgaagca 1236
>gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, complete cds Length = 765 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 aaatttggtggttctgtaaa 86 |||||||||||||||||||| Sbjct: 184 aaatttggtggttctgtaaa 203
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence Length = 220673 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 118 gagcatctattataaagaagatac 141 ||||||||||||||||| |||||| Sbjct: 75779 gagcatctattataaaggagatac 75802
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 558 ggagacggtggagttgggcc 577 |||||||||||||||||||| Sbjct: 16228174 ggagacggtggagttgggcc 16228155
>gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor, precursor RNA, complete cds Length = 1940 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 tatgagggcagcagctgtag 419 |||||||||||||||||||| Sbjct: 41 tatgagggcagcagctgtag 22
>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence Length = 179835 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 47 acatatacatatgcaaaagcaaat 70 ||||||||||||||||||| |||| Sbjct: 171309 acatatacatatgcaaaagtaaat 171286
>gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:6639837, complete cds Length = 5263 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 tttacatatacatatgcaaa 63 |||||||||||||||||||| Sbjct: 3028 tttacatatacatatgcaaa 3009
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 497 gcagcaggtcgtgctcgcag 516 |||||||||||||||||||| Sbjct: 904232 gcagcaggtcgtgctcgcag 904251
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence Length = 167358 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 ttacatatacatatgcaaaa 64 |||||||||||||||||||| Sbjct: 66744 ttacatatacatatgcaaaa 66763
>gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complete sequence Length = 203428 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 47 acatatacatatgcaaaagcaaat 70 |||||||||||| ||||||||||| Sbjct: 152020 acatatacatattcaaaagcaaat 151997
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence Length = 151453 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 372 ccctgcttggtgttgcagat 391 |||||||||||||||||||| Sbjct: 20107 ccctgcttggtgttgcagat 20126
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 495 cagcagcaggtcgtgctcgc 514 |||||||||||||||||||| Sbjct: 2208310 cagcagcaggtcgtgctcgc 2208329
>dbj|AP005570.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1344_B01 Length = 170912 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 558 ggagacggtggagttgggcc 577 |||||||||||||||||||| Sbjct: 44690 ggagacggtggagttgggcc 44671
>dbj|AP005424.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0556H01 Length = 149800 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 558 ggagacggtggagttgggcc 577 |||||||||||||||||||| Sbjct: 132775 ggagacggtggagttgggcc 132756
>dbj|AB008267.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMG4 Length = 79046 Score = 40.1 bits (20), Expect = 8.4 Identities = 59/72 (81%) Strand = Plus / Plus Query: 401 atgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcc 460 |||||| ||||| || ||| |||||||||||| |||||| | || || |||||||| || Sbjct: 15936 atgaggacagcaacttgagttatcatcgcagcaagtagcagcttcgagcgggcaacatcc 15995 Query: 461 ccaggcgaagca 472 ||| ||||||| Sbjct: 15996 ccatccgaagca 16007
>emb|AJ339394.1|HSA339394 Homo sapiens genomic sequence surrounding NotI site, clone NR5-FF21C Length = 640 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 542 ggaagacggtggggcgggagacgg 565 |||||||| ||||||||||||||| Sbjct: 294 ggaagacgctggggcgggagacgg 271
>emb|AJ342112.1|HSA342112 Homo sapiens genomic sequence surrounding NotI site, clone NL4-CL21C Length = 722 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 542 ggaagacggtggggcgggagacgg 565 |||||||| ||||||||||||||| Sbjct: 294 ggaagacgctggggcgggagacgg 271
>emb|AJ340172.1|HSA340172 Homo sapiens genomic sequence surrounding NotI site, clone NR5-GG20C Length = 722 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 542 ggaagacggtggggcgggagacgg 565 |||||||| ||||||||||||||| Sbjct: 294 ggaagacgctggggcgggagacgg 271
>emb|AJ339912.1|HSA339912 Homo sapiens genomic sequence surrounding NotI site, clone NR5-FG5C Length = 844 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 542 ggaagacggtggggcgggagacgg 565 |||||||| ||||||||||||||| Sbjct: 294 ggaagacgctggggcgggagacgg 271
>gb|AY106278.1| Zea mays PCO137999 mRNA sequence Length = 1382 Score = 40.1 bits (20), Expect = 8.4 Identities = 50/60 (83%) Strand = Plus / Minus Query: 405 gggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagccccag 464 |||||||||||| |||||| | ||||||||| || ||||| | ||||| ||||||||| Sbjct: 1043 gggcagcagctggcgtgatccttgcagcaggtggcgccctcgaccgggcagcagccccag 984 Score = 40.1 bits (20), Expect = 8.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 589 gggttctcgcccgtcttcgtcgggtagg 616 |||||| ||||| ||||||||||||||| Sbjct: 857 gggttcgcgcccttcttcgtcgggtagg 830
>gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds Length = 2080 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 tatgagggcagcagctgtag 419 |||||||||||||||||||| Sbjct: 41 tatgagggcagcagctgtag 22
>gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene, intron 4 Length = 1453 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 aaatttggtggttctgtaaa 86 |||||||||||||||||||| Sbjct: 598 aaatttggtggttctgtaaa 617 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,870,585 Number of Sequences: 3902068 Number of extensions: 4870585 Number of successful extensions: 94627 Number of sequences better than 10.0: 106 Number of HSP's better than 10.0 without gapping: 106 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94220 Number of HSP's gapped (non-prelim): 393 length of query: 616 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 593 effective length of database: 17,143,297,704 effective search space: 10165975538472 effective search space used: 10165975538472 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)