ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23e24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predic... 50 0.009
2gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence 50 0.009
3gb|BT016816.1| Zea mays clone Contig649 mRNA sequence 50 0.009
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.009
5gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.009
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.009
7dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
8dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
9dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
10dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
11dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
12emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-... 46 0.13
13emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-... 44 0.53
14emb|BX058217.1|CNS09H31 Single read from an extremity of a full-... 44 0.53
15emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-... 44 0.53
16emb|BX050629.1|CNS09B89 Single read from an extremity of a full-... 44 0.53
17emb|BX048891.1|CNS099VZ Single read from an extremity of a full-... 44 0.53
18emb|BX048575.1|CNS099N7 Single read from an extremity of a full-... 44 0.53
19emb|BX047759.1|CNS0990J Single read from an extremity of a full-... 44 0.53
20emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-... 44 0.53
21emb|BX039669.1|CNS092RT Single read from an extremity of a full-... 44 0.53
22emb|BX037240.1|CNS090WC Single read from an extremity of a full-... 44 0.53
23emb|BX036580.1|CNS090E0 Single read from an extremity of a full-... 44 0.53
24emb|BX036124.1|CNS0901C Single read from an extremity of a full-... 44 0.53
25emb|BX029509.1|CNS08UXL Single read from an extremity of a full-... 44 0.53
26emb|BX028945.1|CNS08UHX Single read from an extremity of a full-... 44 0.53
27emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-... 44 0.53
28emb|BX027649.1|CNS08THX Single read from an extremity of a full-... 44 0.53
29emb|BX027278.1|CNS08T7M Single read from an extremity of a full-... 44 0.53
30emb|BX026134.1|CNS08SBU Single read from an extremity of a full-... 44 0.53
31emb|BX020909.1|CNS08OAP Single read from an extremity of a full-... 44 0.53
32emb|BX019905.1|CNS08NIT Single read from an extremity of a full-... 44 0.53
33emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-... 44 0.53
34emb|BX016863.1|CNS08L6B Single read from an extremity of a full-... 44 0.53
35emb|BX010707.1|CNS08GFB Single read from an extremity of a full-... 44 0.53
36emb|BX010159.1|CNS08G03 Single read from an extremity of a full-... 44 0.53
37emb|BX010158.1|CNS08G02 Single read from an extremity of a full-... 44 0.53
38emb|BX009177.1|CNS08F8T Single read from an extremity of a full-... 44 0.53
39emb|BX007586.1|CNS08E0M Single read from an extremity of a full-... 44 0.53
40gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, comple... 42 2.1
41gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 42 2.1
42emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 42 2.1
43ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diph... 42 2.1
44gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.1
45ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA 42 2.1
46gb|AY007505.3| Streptococcus mitis phage SM1,complete genome 40 8.2
47gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete... 40 8.2
48gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom... 40 8.2
49gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosom... 40 8.2
50gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, comple... 40 8.2
51gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, comple... 40 8.2
52emb|BX013132.1|CNS08IAO Single read from an extremity of a full-... 40 8.2
53gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, comp... 40 8.2
54gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 8.2
55gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, comp... 40 8.2
56gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
57gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
58gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complet... 40 8.2
59gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromo... 40 8.2
60gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, compl... 40 8.2
61dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 8.2
62dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complet... 40 8.2
63emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-2... 40 8.2
64dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 8.2
65dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.2
66gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, co... 40 8.2
67dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 40 8.2 
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 384  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
to top
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 396  tgctgtttgggccacctttgccgcgtagg 424
            ||||| |||||||||||||||||||||||
Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
to top
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 396  tgctgtttgggccacctttgccgcgtagg 424
            ||||| |||||||||||||||||||||||
Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 384     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 447     aggggcggctttctctgccg 466
               ||||||||||||||||||||
Sbjct: 8815955 aggggcggctttctctgccg 8815974
to top
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05,
             complete sequence
          Length = 101799

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 384   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
             |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 384     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 447     aggggcggctttctctgccg 466
               ||||||||||||||||||||
Sbjct: 8813790 aggggcggctttctctgccg 8813809
to top
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full
            insert sequence
          Length = 2166

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 384  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
to top
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full
            insert sequence
          Length = 2862

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 384  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
to top
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full
            insert sequence
          Length = 2762

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 384  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
to top
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full
           insert sequence
          Length = 1271

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 384 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
           |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
to top
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full
            insert sequence
          Length = 1771

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 384  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 436
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
to top
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 374 ccgcaggcttcttctcggccgctgctg 400
           |||| ||||||||||||||||||||||
Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
to top
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 701 ggcttcttctcggccgctgctg 722
to top
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 349 ggcttcttctcggccgctgctg 370
to top
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 366 ggcttcttctcggccgctgctg 387
to top
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 343 ggcttcttctcggccgctgctg 364
to top
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 352 ggcttcttctcggccgctgctg 373
to top
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 692 ggcttcttctcggccgctgctg 671
to top
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 333

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 154 ggcttcttctcggccgctgctg 175
to top
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 354 ggcttcttctcggccgctgctg 375
to top
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 199 ggcttcttctcggccgctgctg 220
to top
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 367 ggcttcttctcggccgctgctg 388
to top
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 356 ggcttcttctcggccgctgctg 377
to top
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 289 ggcttcttctcggccgctgctg 310
to top
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 281 ggcttcttctcggccgctgctg 302
to top
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 332 ggcttcttctcggccgctgctg 353
to top
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 370 ggcttcttctcggccgctgctg 391
to top
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 353 ggcttcttctcggccgctgctg 374
to top
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 304 ggcttcttctcggccgctgctg 325
to top
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 350 ggcttcttctcggccgctgctg 371
to top
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 369 ggcttcttctcggccgctgctg 390
to top
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 669 ggcttcttctcggccgctgctg 648
to top
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 379 ggcttcttctcggccgctgctg 400
           ||||||||||||||||||||||
Sbjct: 362 ggcttcttctcggccgctgctg 383
to top
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence
          Length = 2129

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 396  tgctgtttgggccacctttgc 416
            |||||||||||||||||||||
Sbjct: 1655 tgctgtttgggccacctttgc 1635
to top
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 455    ctttctctgccggaaccttca 475
              |||||||||||||||||||||
Sbjct: 107700 ctttctctgccggaaccttca 107720
to top
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
             Contains the 5' end of the CHD5 gene for  chromodomain
             helicase DNA binding protein 5, the RPL22 gene for
             ribosomal protein L22, eight novel genes, the ICMT gene
             for isoprenylcysteine carboxyl methyltransferase, possible
             ortholog of rodent transcription factor HES-3, the 3' end
             of the gene for brain acyl-CoA hydrolase (BACH) and seven
             CpG islands, complete sequence
          Length = 166518

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 520   ttgatggcatcctgttgtttc 540
             |||||||||||||||||||||
Sbjct: 94318 ttgatggcatcctgttgtttc 94298
to top
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate
           farnesyltransferase (Squalene synthetase) (SQS) (SS)
           (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA
          Length = 752

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 431 ctggaggaccagcagcagggg 451
           |||||||||||||||||||||
Sbjct: 292 ctggaggaccagcagcagggg 312
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 428    cggctggaggaccagcagcag 448
              |||||||||||||||||||||
Sbjct: 616609 cggctggaggaccagcagcag 616629
to top
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 428 cggctggaggaccagcagcag 448
           |||||||||||||||||||||
Sbjct: 265 cggctggaggaccagcagcag 285
to top
>gb|AY007505.3| Streptococcus mitis phage SM1,complete genome
          Length = 34692

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 502   ggagacttcggcttcccatt 521
             ||||||||||||||||||||
Sbjct: 12036 ggagacttcggcttcccatt 12017
to top
>gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete genome
          Length = 86462

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   cattacgtttgttcctcatg 288
             ||||||||||||||||||||
Sbjct: 10531 cattacgtttgttcctcatg 10550
to top
>gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosome Y, complete sequence
          Length = 149994

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    acaagagaaaaaggaggagc 175
              ||||||||||||||||||||
Sbjct: 104706 acaagagaaaaaggaggagc 104725
to top
>gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosome 6, complete sequence
          Length = 185099

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    catggctagctgggaggatc 304
              ||||||||||||||||||||
Sbjct: 129909 catggctagctgggaggatc 129928
to top
>gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, complete sequence
          Length = 44380

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   aaacagggatgatgatagta 147
             ||||||||||||||||||||
Sbjct: 33833 aaacagggatgatgatagta 33814
to top
>gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, complete sequence
          Length = 102918

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 157    caagagaaaaaggaggagctaggggaac 184
              ||||| |||||||||||| |||||||||
Sbjct: 100575 caagaaaaaaaggaggaggtaggggaac 100548
to top
>emb|BX013132.1|CNS08IAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 379 ggcttcttctcggccgctgc 398
           ||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgc 396
to top
>gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, complete sequence
          Length = 179246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    aaacagggatgatgatagta 147
              ||||||||||||||||||||
Sbjct: 164637 aaacagggatgatgatagta 164656
to top
>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete
            sequence
          Length = 155247

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 156  acaagagaaaaaggaggagc 175
            ||||||||||||||||||||
Sbjct: 6323 acaagagaaaaaggaggagc 6342
to top
>gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, complete sequence
          Length = 164479

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 128    aaacagggatgatgatagta 147
              ||||||||||||||||||||
Sbjct: 115439 aaacagggatgatgatagta 115420
to top
>gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1364E02,
            complete sequence
          Length = 126027

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 447  aggggcggctttctctgccg 466
            ||||||||||||||||||||
Sbjct: 6843 aggggcggctttctctgccg 6862
to top
>gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1364E02,
             complete sequence
          Length = 112265

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 447   aggggcggctttctctgccg 466
             ||||||||||||||||||||
Sbjct: 59108 aggggcggctttctctgccg 59127
to top
>gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complete sequence
          Length = 159991

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    agagaaaaaggaggagctag 178
              ||||||||||||||||||||
Sbjct: 124092 agagaaaaaggaggagctag 124073
to top
>gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromosome 7, complete
              sequence
          Length = 180623

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 157    caagagaaaaaggaggagctaggggaac 184
              ||||| |||||||||||| |||||||||
Sbjct: 140763 caagaaaaaaaggaggaggtaggggaac 140790
to top
>gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, complete sequence
          Length = 169834

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   aaacagggatgatgatagta 147
             ||||||||||||||||||||
Sbjct: 17593 aaacagggatgatgatagta 17612
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 358     ggcttcttctcggtcaccgc 377
               ||||||||||||||||||||
Sbjct: 1176320 ggcttcttctcggtcaccgc 1176339
to top
>dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complete sequence
          Length = 150613

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    tttctctttttctgccgatt 81
             ||||||||||||||||||||
Sbjct: 74780 tttctctttttctgccgatt 74761
to top
>emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-299L17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167344

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 155   aacaagagaaaaaggaggag 174
             ||||||||||||||||||||
Sbjct: 65335 aacaagagaaaaaggaggag 65354
to top
>dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-956A8, complete
             sequence
          Length = 114109

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   tttagagctaagcaaactga 128
             ||||||||||||||||||||
Sbjct: 94632 tttagagctaagcaaactga 94651
to top
>dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-640N11, complete
             sequence
          Length = 161547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   tttagagctaagcaaactga 128
             ||||||||||||||||||||
Sbjct: 31460 tttagagctaagcaaactga 31479
to top
>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence
          Length = 177014

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   agagaaaaaggaggagctag 178
             ||||||||||||||||||||
Sbjct: 59532 agagaaaaaggaggagctag 59513
to top
>dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2060O22, complete
             sequence
          Length = 111557

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   agagaaaaaggaggagctag 178
             ||||||||||||||||||||
Sbjct: 78153 agagaaaaaggaggagctag 78134


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,583,298
Number of Sequences: 3902068
Number of extensions: 4583298
Number of successful extensions: 91569
Number of sequences better than 10.0: 67
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91285
Number of HSP's gapped (non-prelim): 284
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top