ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23e23
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predic... 84 8e-13
2gb|DQ083235.1| Oryza sativa (indica cultivar-group) clone 7B8H91... 84 8e-13
3dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 8e-13
4dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 8e-13
5dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 8e-13
6dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 8e-13
7dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 8e-13
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 56 2e-04
9gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome... 56 2e-04
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
11gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, comple... 54 7e-04
12gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence 50 0.011
13gb|BT016816.1| Zea mays clone Contig649 mRNA sequence 50 0.011
14gb|BT016473.1| Zea mays clone Contig306 mRNA sequence 46 0.17
15emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-... 46 0.17
16gb|AY103907.1| Zea mays PCO122604 mRNA sequence 46 0.17
17emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-... 44 0.66
18emb|BX058217.1|CNS09H31 Single read from an extremity of a full-... 44 0.66
19emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-... 44 0.66
20emb|BX050629.1|CNS09B89 Single read from an extremity of a full-... 44 0.66
21emb|BX048891.1|CNS099VZ Single read from an extremity of a full-... 44 0.66
22emb|BX048575.1|CNS099N7 Single read from an extremity of a full-... 44 0.66
23emb|BX047759.1|CNS0990J Single read from an extremity of a full-... 44 0.66
24emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-... 44 0.66
25emb|BX039669.1|CNS092RT Single read from an extremity of a full-... 44 0.66
26emb|BX037240.1|CNS090WC Single read from an extremity of a full-... 44 0.66
27emb|BX036580.1|CNS090E0 Single read from an extremity of a full-... 44 0.66
28emb|BX036124.1|CNS0901C Single read from an extremity of a full-... 44 0.66
29emb|BX029509.1|CNS08UXL Single read from an extremity of a full-... 44 0.66
30emb|BX028945.1|CNS08UHX Single read from an extremity of a full-... 44 0.66
31emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-... 44 0.66
32emb|BX027649.1|CNS08THX Single read from an extremity of a full-... 44 0.66
33emb|BX027278.1|CNS08T7M Single read from an extremity of a full-... 44 0.66
34emb|BX026134.1|CNS08SBU Single read from an extremity of a full-... 44 0.66
35emb|BX020909.1|CNS08OAP Single read from an extremity of a full-... 44 0.66
36emb|BX019905.1|CNS08NIT Single read from an extremity of a full-... 44 0.66
37emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-... 44 0.66
38emb|BX016863.1|CNS08L6B Single read from an extremity of a full-... 44 0.66
39emb|BX010707.1|CNS08GFB Single read from an extremity of a full-... 44 0.66
40emb|BX010159.1|CNS08G03 Single read from an extremity of a full-... 44 0.66
41emb|BX010158.1|CNS08G02 Single read from an extremity of a full-... 44 0.66
42emb|BX009177.1|CNS08F8T Single read from an extremity of a full-... 44 0.66
43emb|BX007586.1|CNS08E0M Single read from an extremity of a full-... 44 0.66
44gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 42 2.6
45emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 42 2.6
46ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diph... 42 2.6
47gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.6
48ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA 42 2.6 
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 679  ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
            ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 1958 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 1899

                         
Query: 739  atcaatttctgac 751
            ||||| |||||||
Sbjct: 1898 atcaacttctgac 1886



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 456  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
to top
>gb|DQ083235.1| Oryza sativa (indica cultivar-group) clone 7B8H91 mRNA sequence
          Length = 863

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                       
Query: 679 ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
           ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 307 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 248

                        
Query: 739 atcaatttctgac 751
           ||||| |||||||
Sbjct: 247 atcaacttctgac 235
to top
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full
            insert sequence
          Length = 2166

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 679  ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
            ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 1606 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 1547

                         
Query: 739  atcaatttctgac 751
            ||||| |||||||
Sbjct: 1546 atcaacttctgac 1534



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 456  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
to top
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full
            insert sequence
          Length = 2862

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 679  ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
            ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 2195 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 2136

                         
Query: 739  atcaatttctgac 751
            ||||| |||||||
Sbjct: 2135 atcaacttctgac 2123



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 456  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
to top
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full
            insert sequence
          Length = 2762

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 679  ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
            ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 2143 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 2084

                         
Query: 739  atcaatttctgac 751
            ||||| |||||||
Sbjct: 2083 atcaacttctgac 2071



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 456  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
to top
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full
           insert sequence
          Length = 1271

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                       
Query: 679 ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
           ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 771 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 712

                        
Query: 739 atcaatttctgac 751
           ||||| |||||||
Sbjct: 711 atcaacttctgac 699



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 456 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
           |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
to top
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full
            insert sequence
          Length = 1771

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 679  ggagccctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgc 738
            ||||||||||||||||| |||||||||||||||||||| || || |  ||||| ||||||
Sbjct: 1107 ggagccctactgtcccagacctgcttttggatctgctgttgtttcaccctcttttcctgc 1048

                         
Query: 739  atcaatttctgac 751
            ||||| |||||||
Sbjct: 1047 atcaacttctgac 1035



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 456  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                      
Query: 697     acctgcttttggatctgctgntggtttattctcttctcctgcatcaatttctgac 751
               |||||||||||||||||||| || || |  ||||| ||||||||||| |||||||
Sbjct: 3108674 acctgcttttggatctgctgttgtttcaccctcttttcctgcatcaacttctgac 3108728



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 456     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454
to top
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05,
             complete sequence
          Length = 101799

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                    
Query: 697   acctgcttttggatctgctgntggtttattctcttctcctgcatcaatttctgac 751
             |||||||||||||||||||| || || |  ||||| ||||||||||| |||||||
Sbjct: 31687 acctgcttttggatctgctgttgtttcaccctcttttcctgcatcaacttctgac 31741



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 456   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
             |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                      
Query: 697     acctgcttttggatctgctgntggtttattctcttctcctgcatcaatttctgac 751
               |||||||||||||||||||| || || |  ||||| ||||||||||| |||||||
Sbjct: 3108785 acctgcttttggatctgctgttgtttcaccctcttttcctgcatcaacttctgac 3108839



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 456     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 508
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565
to top
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence
          Length = 2129

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 684  cctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgcatcaa 743
            |||||||||||| ||||||||||||| |||||| || ||    ||||| |||||||||||
Sbjct: 1466 cctactgtcccagacctgcttttggacctgctgctgtttcgacctcttatcctgcatcaa 1407

                  
Query: 744  tttctg 749
             |||||
Sbjct: 1406 cttctg 1401



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 468  tgctgtttgggccacctttgc 488
            |||||||||||||||||||||
Sbjct: 1655 tgctgtttgggccacctttgc 1635
to top
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 468  tgctgtttgggccacctttgccgcgtagg 496
            ||||| |||||||||||||||||||||||
Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
to top
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 468  tgctgtttgggccacctttgccgcgtagg 496
            ||||| |||||||||||||||||||||||
Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 684  cctactgtcccacacctgcttttggatctgctg 716
            |||||||||||| ||||||||||||| ||||||
Sbjct: 1146 cctactgtcccagacctgcttttggacctgctg 1114
to top
>gb|BT016473.1| Zea mays clone Contig306 mRNA sequence
          Length = 1105

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 684 cctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgcatcaa 743
           |||| ||||||| ||||||||||||| |||||| || ||    ||||| |||||||||||
Sbjct: 584 cctagtgtcccagacctgcttttggagctgctgctgtttcgacctcttatcctgcatcaa 643

                 
Query: 744 tttctg 749
            |||||
Sbjct: 644 cttctg 649
to top
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 446 ccgcaggcttcttctcggccgctgctg 472
           |||| ||||||||||||||||||||||
Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
to top
>gb|AY103907.1| Zea mays PCO122604 mRNA sequence
          Length = 2408

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                        
Query: 684  cctactgtcccacacctgcttttggatctgctgntggtttattctcttctcctgcatcaa 743
            |||| ||||||| ||||||||||||| |||||| || ||    ||||| |||||||||||
Sbjct: 1789 cctagtgtcccagacctgcttttggagctgctgctgtttcgacctcttatcctgcatcaa 1730

                  
Query: 744  tttctg 749
             |||||
Sbjct: 1729 cttctg 1724
to top
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 701 ggcttcttctcggccgctgctg 722
to top
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 349 ggcttcttctcggccgctgctg 370
to top
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 366 ggcttcttctcggccgctgctg 387
to top
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 343 ggcttcttctcggccgctgctg 364
to top
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 352 ggcttcttctcggccgctgctg 373
to top
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 692 ggcttcttctcggccgctgctg 671
to top
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 333

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 154 ggcttcttctcggccgctgctg 175
to top
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 354 ggcttcttctcggccgctgctg 375
to top
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 199 ggcttcttctcggccgctgctg 220
to top
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 367 ggcttcttctcggccgctgctg 388
to top
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 356 ggcttcttctcggccgctgctg 377
to top
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 289 ggcttcttctcggccgctgctg 310
to top
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 281 ggcttcttctcggccgctgctg 302
to top
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 332 ggcttcttctcggccgctgctg 353
to top
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 370 ggcttcttctcggccgctgctg 391
to top
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 353 ggcttcttctcggccgctgctg 374
to top
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 304 ggcttcttctcggccgctgctg 325
to top
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 350 ggcttcttctcggccgctgctg 371
to top
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 369 ggcttcttctcggccgctgctg 390
to top
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 669 ggcttcttctcggccgctgctg 648
to top
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 451 ggcttcttctcggccgctgctg 472
           ||||||||||||||||||||||
Sbjct: 362 ggcttcttctcggccgctgctg 383
to top
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 527    ctttctctgccggaaccttca 547
              |||||||||||||||||||||
Sbjct: 107700 ctttctctgccggaaccttca 107720
to top
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
             Contains the 5' end of the CHD5 gene for  chromodomain
             helicase DNA binding protein 5, the RPL22 gene for
             ribosomal protein L22, eight novel genes, the ICMT gene
             for isoprenylcysteine carboxyl methyltransferase, possible
             ortholog of rodent transcription factor HES-3, the 3' end
             of the gene for brain acyl-CoA hydrolase (BACH) and seven
             CpG islands, complete sequence
          Length = 166518

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 592   ttgatggcatcctgttgtttc 612
             |||||||||||||||||||||
Sbjct: 94318 ttgatggcatcctgttgtttc 94298
to top
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate
           farnesyltransferase (Squalene synthetase) (SQS) (SS)
           (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA
          Length = 752

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 503 ctggaggaccagcagcagggg 523
           |||||||||||||||||||||
Sbjct: 292 ctggaggaccagcagcagggg 312
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 500    cggctggaggaccagcagcag 520
              |||||||||||||||||||||
Sbjct: 616609 cggctggaggaccagcagcag 616629
to top
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 500 cggctggaggaccagcagcag 520
           |||||||||||||||||||||
Sbjct: 265 cggctggaggaccagcagcag 285


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,891,717
Number of Sequences: 3902068
Number of extensions: 5891717
Number of successful extensions: 125149
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124929
Number of HSP's gapped (non-prelim): 217
length of query: 751
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 728
effective length of database: 17,143,297,704
effective search space: 12480320728512
effective search space used: 12480320728512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top