>gb|AC115022.11| Mus musculus chromosome 7, clone RP24-233J11, complete sequence
          Length = 150060

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 130 ctcctgggagaaggctttgga 150
           |||||||||||||||||||||
Sbjct: 260 ctcctgggagaaggctttgga 280

>gb|AC119880.11| Mus musculus chromosome 7, clone RP24-428H4, complete sequence
          Length = 187158

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 130    ctcctgggagaaggctttgga 150
              |||||||||||||||||||||
Sbjct: 164170 ctcctgggagaaggctttgga 164190

>gb|AF384559.1|AF384559 Mus musculus myosin VIIa gene, promoter and partial cds
          Length = 3845

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 130  ctcctgggagaaggctttgga 150
            |||||||||||||||||||||
Sbjct: 2046 ctcctgggagaaggctttgga 2066

>gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map 10, complete sequence
          Length = 183491

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 120   caacagggggctcctggga 138
             |||||||||||||||||||
Sbjct: 76747 caacagggggctcctggga 76729

>gb|AC068607.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-392C14, complete
             sequence
          Length = 218081

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 133   ctgggagaaggctttggaaggac 155
             |||||||| ||||||||||||||
Sbjct: 22725 ctgggagagggctttggaaggac 22747

>gb|AC172242.3| Gallus gallus BAC clone CH261-162M6 from chromosome ul, complete sequence
          Length = 252782

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     ttgatgcttaaccatatcc 49
              |||||||||||||||||||
Sbjct: 158530 ttgatgcttaaccatatcc 158512

>ref|XM_978382.1| PREDICTED: Mus musculus myosin, light polypeptide 6B (Myl6b), mRNA
          Length = 782

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 120 caacagggggctcctggga 138
           |||||||||||||||||||
Sbjct: 188 caacagggggctcctggga 170

>gb|AC115733.14| Mus musculus chromosome 16, clone RP23-466L17, complete sequence
          Length = 203973

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 95     gcattctcaagcttgtgag 113
              |||||||||||||||||||
Sbjct: 148342 gcattctcaagcttgtgag 148324

>gb|AC107703.10| Mus musculus, clone RP23-472H1, complete sequence
          Length = 215019

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 91    aggtgcattctcaagcttg 109
             |||||||||||||||||||
Sbjct: 61579 aggtgcattctcaagcttg 61597

>gb|BC037527.1| Mus musculus myosin, light polypeptide 6B, mRNA (cDNA clone
           MGC:41229 IMAGE:3468485), complete cds
          Length = 1053

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 120 caacagggggctcctggga 138
           |||||||||||||||||||
Sbjct: 258 caacagggggctcctggga 240

>emb|AL158822.19| Human DNA sequence from clone RP11-100C15 on chromosome 9q34.2-34.3
            Contains the 3' end of a novel gene containing
            DKFZp434G2311, the KCNT1 gene for member 1 of the
            potassium channel subfamily T, the 3' end of a novel
            gene,  part of the gene for a novel protein similar to
            mouse RIKEN 9230102I19 (9230102I19RIK) and nine CpG
            islands, complete sequence
          Length = 187336

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 128  ggctcctgggagaaggctt 146
            |||||||||||||||||||
Sbjct: 7682 ggctcctgggagaaggctt 7664

>emb|CR931728.1| Medicago truncatula chromosome 5 clone mth2-175g3, COMPLETE SEQUENCE
          Length = 115300

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 136   ggagaaggctttggaagga 154
             |||||||||||||||||||
Sbjct: 56174 ggagaaggctttggaagga 56156

>gb|AC011195.14| Homo sapiens chromosome 17, clone CTD-2200P10, complete sequence
          Length = 152574

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 110    tgagaggacacaacagggg 128
              |||||||||||||||||||
Sbjct: 139105 tgagaggacacaacagggg 139123

>ref|NM_172259.1| Mus musculus myosin, light polypeptide 6B (Myl6b), mRNA
          Length = 1053

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 120 caacagggggctcctggga 138
           |||||||||||||||||||
Sbjct: 258 caacagggggctcctggga 240

>dbj|AK142897.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930041O15 product:unclassifiable, full
            insert sequence
          Length = 5280

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 133  ctgggagaaggctttggaa 151
            |||||||||||||||||||
Sbjct: 2958 ctgggagaaggctttggaa 2940

>gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosome 9, complete sequence
          Length = 213468

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 136   ggagaaggctttggaagga 154
             |||||||||||||||||||
Sbjct: 74911 ggagaaggctttggaagga 74929

>gb|AC159823.2| Mus musculus BAC clone RP23-113F14 from chromosome 12, complete sequence
          Length = 212532

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 133    ctgggagaaggctttggaa 151
              |||||||||||||||||||
Sbjct: 169741 ctgggagaaggctttggaa 169759

>gb|AC159274.2| Mus musculus BAC clone RP23-405C6 from chromosome 12, complete sequence
          Length = 200974

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 133   ctgggagaaggctttggaa 151
             |||||||||||||||||||
Sbjct: 29818 ctgggagaaggctttggaa 29836

>dbj|AK051386.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130045D15
            product:unclassifiable, full insert sequence
          Length = 1733

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 133  ctgggagaaggctttggaa 151
            |||||||||||||||||||
Sbjct: 1015 ctgggagaaggctttggaa 997

>gb|AC079044.21| Mus musculus strain C57BL/6J chromosome 16 clone rp23-51l7, complete
             sequence
          Length = 228349

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 95    gcattctcaagcttgtgag 113
             |||||||||||||||||||
Sbjct: 33816 gcattctcaagcttgtgag 33798

>gb|AC005666.1|AC005666 Homo sapiens chromosome 17, clone hRPK.112_H_10, complete sequence
          Length = 158905

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 110    tgagaggacacaacagggg 128
              |||||||||||||||||||
Sbjct: 156633 tgagaggacacaacagggg 156615

>dbj|AP000841.4| Homo sapiens genomic DNA, chromosome 11q clone:CMB9-89J9, complete
             sequence
          Length = 103177

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    gagacctaagcagtaggtg 95
             |||||||||||||||||||
Sbjct: 14524 gagacctaagcagtaggtg 14542

>gb|AC113075.9| Mus musculus chromosome 19, clone RP23-278F24, complete sequence
          Length = 171837

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 130   ctcctgggagaaggctttg 148
             |||||||||||||||||||
Sbjct: 59964 ctcctgggagaaggctttg 59946

>gb|AC087802.13| Mus musculus strain C57BL/6J chromosome 16 clone rp23-472f15, complete
             sequence
          Length = 187260

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 95    gcattctcaagcttgtgag 113
             |||||||||||||||||||
Sbjct: 19616 gcattctcaagcttgtgag 19598

>gb|AC170752.2| Mus musculus BAC clone RP23-116B8 from chromosome 10, complete sequence
          Length = 194054

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 120    caacagggggctcctggga 138
              |||||||||||||||||||
Sbjct: 153827 caacagggggctcctggga 153845


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,070,887
Number of Sequences: 3902068
Number of extensions: 1070887
Number of successful extensions: 69046
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68996
Number of HSP's gapped (non-prelim): 50
length of query: 174
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 152
effective length of database: 17,147,199,772
effective search space: 2606374365344
effective search space used: 2606374365344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)