ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd23d13 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 359 bits (181), Expect = 5e-96 Identities = 218/230 (94%), Gaps = 1/230 (0%) Strand = Plus / Minus Query: 182 gcttagtagtcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 241 |||||||||||| ||| |||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741 Query: 242 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 301 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681 Query: 302 aagtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccgga 361 |||||||||| ||||||||||||||||||| ||||||||| |||||||||| |||||||| Sbjct: 680 aagtcgccgc-tggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgga 622 Query: 362 gaaggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||||||||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 621 gaaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcga 572
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 355 bits (179), Expect = 7e-95 Identities = 319/366 (87%), Gaps = 18/366 (4%) Strand = Plus / Minus Query: 53 gcttagatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 105 |||| |||||||||||||||||| || ||||||||||||||||| |||||| || Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873 Query: 106 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 165 |||||||| ||||||||||| |||||||||||||||| ||||| ||||||| Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823 Query: 166 acccttcacatggatggcttagtagtcgntgctggcgacgggggtgtggttgtcgcacat 225 || |||| ||||| |||||||||||||| ||| |||||||||| |||||| ||| ||||| Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763 Query: 226 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||| ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703 Query: 286 gatccagatgttggtgaagtcgccgcatggcaacggcggggccgaatgagcgtgcanggt 345 | ||| ||||||||||||||||||| ||||||||||||||||||| ||||||||| ||| Sbjct: 702 aacccaaatgttggtgaagtcgccgc-tggcaacggcggggccgaaggagcgtgcagggt 644 Query: 346 tcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagccga 405 ||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||||| Sbjct: 643 tcatggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccga 584 Query: 406 tggcga 411 |||||| Sbjct: 583 tggcga 578
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 347 bits (175), Expect = 2e-92 Identities = 215/228 (94%), Gaps = 1/228 (0%) Strand = Plus / Minus Query: 184 ttagtagtcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 243 |||||||||| ||| |||||||| | |||||| |||||||||||||| |||||||||||| Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742 Query: 244 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 303 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682 Query: 304 gtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggaga 363 |||||||| ||||||||||||||||||| ||||||||| |||||||||| |||||||||| Sbjct: 681 gtcgccgc-tggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggaga 623 Query: 364 aggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 622 aggggccggcaacgaggatgttggcgccgacgatgaagccgatggcga 575
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 331 bits (167), Expect = 1e-87 Identities = 216/232 (93%), Gaps = 1/232 (0%) Strand = Plus / Minus Query: 180 tggcttagtagtcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 239 |||||||||||||| ||| |||||||| | |||||| |||||||||||| ||||| |||| Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747 Query: 240 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 299 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687 Query: 300 tgaagtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccg 359 |||||||||||| ||||||||||||||||||| ||||||||| |||||||||| |||||| Sbjct: 686 tgaagtcgccgc-tggcaacggcggggccgaaggagcgtgcagggttcatggacccgccg 628 Query: 360 gagaaggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||||||||||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 627 gagaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcga 576
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 13251129 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 13251070 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 13251069 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 13251010 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 13251009 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 13250910
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 12939 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 12880 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 12879 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 12820 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 12819 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 12720
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 168317 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 168258 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 168257 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 168198 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 168197 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 168098
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 829 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 770 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 769 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 710 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 709 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 610
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 831 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 772 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 771 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 712 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 711 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 612
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 832 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 773 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 772 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 713 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 712 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 613
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 830 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 771 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 770 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 711 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 710 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 611
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 832 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 773 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 772 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 713 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 712 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 613
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 254 bits (128), Expect = 2e-64 Identities = 198/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 830 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 771 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 770 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 711 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 710 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 611
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 246 bits (124), Expect = 5e-62 Identities = 197/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||| Sbjct: 831 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccg 772 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 771 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 712 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||| ||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 711 c-tggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 612
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 246 bits (124), Expect = 5e-62 Identities = 197/221 (89%), Gaps = 1/221 (0%) Strand = Plus / Minus Query: 191 tcgntgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccg 250 ||| ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| |||| Sbjct: 709 tcgctgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccg 650 Query: 251 gcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccg 310 |||||||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||| Sbjct: 649 gcgaggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccg 590 Query: 311 catggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggcc 370 | |||| |||||||||||||| ||||| || |||||||||| ||||||||||||||||| Sbjct: 589 c-tggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531 Query: 371 ggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||||||||||| ||||| |||||||||||||||| Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcga 490
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 123 bits (62), Expect = 5e-25 Identities = 148/175 (84%), Gaps = 3/175 (1%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 297 |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| || Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704 Query: 298 ggtgaagtcg-ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccg 356 || ||||||| |||| ||| |||||||||||||| ||||| || |||||||||| ||| Sbjct: 703 ggcgaagtcggccgc--ggcgacggcggggccgaaggagcgggcggggttcatggagccg 646 Query: 357 ccggagaaggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 ||| |||||| || || ||||||||||||| ||||| |||||||||||||||| Sbjct: 645 ccgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcga 591
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 119 bits (60), Expect = 7e-24 Identities = 146/174 (83%), Gaps = 1/174 (0%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 297 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861 Query: 298 ggtgaagtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgc 357 || ||||||||| | ||| |||||||||||||| ||||| || |||||||||| |||| Sbjct: 860 ggcgaagtcgcc-cgcggcgacggcggggccgaaggagcgggcggggttcatggagccgc 802 Query: 358 cggagaaggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 || |||||| || || ||||||||||||| ||||| |||||||||||||||| Sbjct: 801 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcga 748
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 119 bits (60), Expect = 7e-24 Identities = 146/174 (83%), Gaps = 1/174 (0%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 297 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860 Query: 298 ggtgaagtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgc 357 || ||||||||| | ||| |||||||||||||| ||||| || |||||||||| |||| Sbjct: 859 ggcgaagtcgcc-cgcggcgacggcggggccgaaggagcgggcggggttcatggagccgc 801 Query: 358 cggagaaggggccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 || |||||| || || ||||||||||||| ||||| |||||||||||||||| Sbjct: 800 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcga 747
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 623 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 565 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 564 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 521
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Plus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 26627243 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 26627301 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 26627302 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 26627345
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Plus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 169624 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 169682 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 169683 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 169726
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Plus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 61404 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 61462 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 61463 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 61506
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 696 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 638 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 637 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 594
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 498 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 440 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 439 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 396
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 107 bits (54), Expect = 3e-20 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 307 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592 Query: 308 ccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||| ||| |||||||||||||| ||||| || |||||||||| |||||| ||| || Sbjct: 250591 ccggc-ggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgg 250533 Query: 368 gccggcaacgaggatgttggccccgacnatgaagccgatggcga 411 |||||| ||||||||||||| ||||| ||||||||||| |||| Sbjct: 250532 gccggcggcgaggatgttggcgccgacgatgaagccgatcgcga 250489 Score = 60.0 bits (30), Expect = 6e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 347 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagccgat 406 |||||| |||||| ||| |||||||| ||||||||||||| ||||| ||||||||||| Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154 Query: 407 ggcga 411 |||| Sbjct: 332155 cgcga 332159
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 91.7 bits (46), Expect = 2e-15 Identities = 80/92 (86%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||||| || |||||||||| |||||| |||||||||||| | Sbjct: 617 acggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggcc 558 Query: 378 aggatgttggccccgacnatgaagccgatggc 409 ||||||||||| ||||| |||||||||||||| Sbjct: 557 aggatgttggcgccgacgatgaagccgatggc 526
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 91.7 bits (46), Expect = 2e-15 Identities = 80/92 (86%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||||| || |||||||||| |||||| |||||||||||| | Sbjct: 685 acggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggcc 626 Query: 378 aggatgttggccccgacnatgaagccgatggc 409 ||||||||||| ||||| |||||||||||||| Sbjct: 625 aggatgttggcgccgacgatgaagccgatggc 594
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 91.7 bits (46), Expect = 2e-15 Identities = 129/156 (82%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 254 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgcat 313 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccg-gc 699 Query: 314 ggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggc 373 || |||||||||||||| ||||| || |||||||||| |||||| |||||||||||| Sbjct: 698 cgccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggc 639 Query: 374 aacgaggatgttggccccgacnatgaagccgatggc 409 | ||||||||||| ||||| |||||||||||||| Sbjct: 638 ggccaggatgttggcgccgacgatgaagccgatggc 603
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 91.7 bits (46), Expect = 2e-15 Identities = 129/156 (82%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 254 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgcat 313 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccg-gc 681 Query: 314 ggcaacggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggc 373 || |||||||||||||| ||||| || |||||||||| |||||| |||||||||||| Sbjct: 680 cgccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggc 621 Query: 374 aacgaggatgttggccccgacnatgaagccgatggc 409 | ||||||||||| ||||| |||||||||||||| Sbjct: 620 ggccaggatgttggcgccgacgatgaagccgatggc 585
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 83.8 bits (42), Expect = 4e-13 Identities = 62/69 (89%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| |||||||||||| |||| | |||||||||||||| ||||| ||||||| Sbjct: 658 ggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagc 599 Query: 403 cgatggcga 411 ||||||||| Sbjct: 598 cgatggcga 590 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 83.8 bits (42), Expect = 4e-13 Identities = 137/168 (81%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 236 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 295 ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| || Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716 Query: 296 ttggtgaagtcgccgcatggcaacggcggggccgaatgagcgtgcanggttcatggaacc 355 | ||||||||| |||| | |||| || ||| |||| ||||| || |||||||||| || Sbjct: 715 tcggtgaagtctccgc-tcacaacagcagggtcgaaggagcgggcggggttcatggagcc 657 Query: 356 gccggagaaggggccggcaacgaggatgttggccccgacnatgaagcc 403 ||| ||||||||||| || | | ||||||||| || || |||||||| Sbjct: 656 gccagagaaggggcccgcggccaagatgttggcgcccacgatgaagcc 609
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/107 (84%), Gaps = 1/107 (0%) Strand = Plus / Minus Query: 279 cccagtagatccagatgttggtgaagtcgccgcatggcaacggcggggccgaatgagcgt 338 |||||||||||||| ||| |||||||||||| || | |||||||||||||| ||||| Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgc-tgacgacggcggggccgaaggagcgg 639 Query: 339 gcanggttcatggaaccgccggagaaggggccggcaacgaggatgtt 385 || ||||||| || || |||||||| ||||||||| | |||||||| Sbjct: 638 gcggggttcattgatccaccggagaatgggccggcagccaggatgtt 592
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 69.9 bits (35), Expect = 6e-09 Identities = 75/89 (84%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 ||||| || ||||| ||||| || |||||||||| |||||| |||||| ||||| || Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784 Query: 378 aggatgttggccccgacnatgaagccgat 406 ||||||||||| ||||| ||||||||||| Sbjct: 44783 aggatgttggcgccgacgatgaagccgat 44755
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 67.9 bits (34), Expect = 2e-08 Identities = 77/92 (83%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 ||||| |||||||| ||||| ||| |||||||||||| |||| ||||| || || | Sbjct: 617 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccgcc 558 Query: 378 aggatgttggccccgacnatgaagccgatggc 409 ||||||||||| ||||| |||||||||||||| Sbjct: 557 aggatgttggcaccgacgatgaagccgatggc 526
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 67.9 bits (34), Expect = 2e-08 Identities = 77/92 (83%) Strand = Plus / Plus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 ||||| |||||||| ||||| ||| |||||||||||| |||| ||||| || || | Sbjct: 92562 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccgcc 92621 Query: 378 aggatgttggccccgacnatgaagccgatggc 409 ||||||||||| ||||| |||||||||||||| Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggc 92653
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 67.9 bits (34), Expect = 2e-08 Identities = 77/92 (83%) Strand = Plus / Plus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 ||||| |||||||| ||||| ||| |||||||||||| |||| ||||| || || | Sbjct: 27568586 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccgcc 27568645 Query: 378 aggatgttggccccgacnatgaagccgatggc 409 ||||||||||| ||||| |||||||||||||| Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggc 27568677 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 25620210 agatgttggtgaagtcgccgc 25620230
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 67.9 bits (34), Expect = 2e-08 Identities = 60/69 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| |||||||||||| |||| | || ||||||||||| || || ||||||| Sbjct: 689 ggttcatggacgcgccggagaaggcgccgcccaccaggatgttggcgcccacgatgaagc 630 Query: 403 cgatggcga 411 ||||||||| Sbjct: 629 cgatggcga 621 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcga 530
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 63.9 bits (32), Expect = 4e-07 Identities = 89/107 (83%), Gaps = 1/107 (0%) Strand = Plus / Minus Query: 279 cccagtagatccagatgttggtgaagtcgccgcatggcaacggcggggccgaatgagcgt 338 |||||||||||||| ||| |||||||||||| || | |||||||||||||| ||||| Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgc-tgacgacggcggggccgaaggagcgg 597 Query: 339 gcanggttcatggaaccgccggagaaggggccggcaacgaggatgtt 385 || ||||||| || || |||||||| ||||| ||| | |||||||| Sbjct: 596 gcggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Plus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcga 43108897 Score = 48.1 bits (24), Expect = 0.023 Identities = 59/71 (83%) Strand = Plus / Minus Query: 324 gggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacgaggatg 383 |||||||| ||||| || |||||||||| |||||||| |||| ||| | |||||||| Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412 Query: 384 ttggccccgac 394 ||||| ||||| Sbjct: 7297411 ttggcgccgac 7297401
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Plus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcga 105926
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcga 554
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcga 603
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 63.9 bits (32), Expect = 4e-07 Identities = 78/94 (82%) Strand = Plus / Minus Query: 318 acggcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacg 377 |||||||||||||| ||| || |||||||||| ||||| ||||| |||| | || Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574 Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcga 540
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 60.0 bits (30), Expect = 6e-06 Identities = 59/69 (85%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| ||||| ||||| |||| | |||||||||||||| || || ||||||| Sbjct: 674 ggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaagc 615 Query: 403 cgatggcga 411 ||||||||| Sbjct: 614 cgatggcga 606
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 60.0 bits (30), Expect = 6e-06 Identities = 59/69 (85%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| ||||| ||||| |||| | || |||||||||||||| || ||||||| Sbjct: 596 ggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaagc 537 Query: 403 cgatggcga 411 ||||||||| Sbjct: 536 cgatggcga 528 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 563 acgaggatgttcgcgccgacgatgaagccgatggcga 527
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Plus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 2544919 acgaggatgttcgcgccgacgatgaagccgatggcga 2544955 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 15990586 agatgttggtgaagtcgccgc 15990566
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 125175 acgaggatgttcgcgccgacgatgaagccgatggcga 125139
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Plus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 2545029 acgaggatgttcgcgccgacgatgaagccgatggcga 2545065 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 15985120 agatgttggtgaagtcgccgc 15985100
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 641 acgaggatgttcgcgccgacgatgaagccgatggcga 605
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 650 acgaggatgttcgcgccgacgatgaagccgatggcga 614
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 652 acgaggatgttcgcgccgacgatgaagccgatggcga 616
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 176 acgaggatgttcgcgccgacgatgaagccgatggcga 140
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Minus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 648 acgaggatgttcgcgccgacgatgaagccgatggcga 612
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748 Score = 56.0 bits (28), Expect = 9e-05 Identities = 57/67 (85%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| ||||| ||||| |||| | || |||||||||||||| || ||||||| Sbjct: 691 ggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaagc 632 Query: 403 cgatggc 409 ||||||| Sbjct: 631 cgatggc 625
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 56.0 bits (28), Expect = 9e-05 Identities = 57/67 (85%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| ||||| ||||| |||| | || |||||||||||||| || ||||||| Sbjct: 688 ggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaagc 629 Query: 403 cgatggc 409 ||||||| Sbjct: 628 cgatggc 622 Score = 48.1 bits (24), Expect = 0.023 Identities = 42/48 (87%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 56.0 bits (28), Expect = 9e-05 Identities = 34/36 (94%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 ||||| |||||||| ||||||||||||||||||||| Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 54.0 bits (27), Expect = 4e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcga 544
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 54.0 bits (27), Expect = 4e-04 Identities = 32/34 (94%) Strand = Plus / Plus Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| ||||| |||||||||||||||| Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcga 467
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 52.0 bits (26), Expect = 0.001 Identities = 58/69 (84%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatgaagc 402 |||||||||| ||||| ||||| |||| | || ||||||||||| || || ||||||| Sbjct: 692 ggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaagc 633 Query: 403 cgatggcga 411 ||||||||| Sbjct: 632 cgatggcga 624 Score = 48.1 bits (24), Expect = 0.023 Identities = 42/48 (87%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 285 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 52.0 bits (26), Expect = 0.001 Identities = 34/37 (91%) Strand = Plus / Plus Query: 375 acgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||| || ||||| |||||||||||||||| Sbjct: 328 acgaggatgttcgcgccgacgatgaagccgatggcga 364
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 50.1 bits (25), Expect = 0.006 Identities = 33/36 (91%) Strand = Plus / Minus Query: 376 cgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||||| || || |||||||||||||||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcga 562
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 50.1 bits (25), Expect = 0.006 Identities = 33/36 (91%) Strand = Plus / Minus Query: 376 cgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||||| || || |||||||||||||||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcga 524
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 50.1 bits (25), Expect = 0.006 Identities = 33/36 (91%) Strand = Plus / Minus Query: 376 cgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||||| || || |||||||||||||||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcga 552
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 50.1 bits (25), Expect = 0.006 Identities = 33/36 (91%) Strand = Plus / Plus Query: 376 cgaggatgttggccccgacnatgaagccgatggcga 411 ||||||||||||| || || |||||||||||||||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcga 8682
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 48.1 bits (24), Expect = 0.023 Identities = 59/71 (83%) Strand = Plus / Minus Query: 324 gggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacgaggatg 383 |||||||| ||||| || |||||||||| |||||||| |||| ||| | |||||||| Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549 Query: 384 ttggccccgac 394 ||||| ||||| Sbjct: 548 ttggcgccgac 538
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 ||||| ||||| || ||||||||||||||||||||| Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 48.1 bits (24), Expect = 0.023 Identities = 41/47 (87%) Strand = Plus / Minus Query: 321 gcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggg 367 ||||||||||| ||||| || |||||||||| ||||||||||||| Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaaggg 662
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 48.1 bits (24), Expect = 0.023 Identities = 59/71 (83%) Strand = Plus / Minus Query: 324 gggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacgaggatg 383 |||||||| ||||| || |||||||||| |||||||| |||| ||| | |||||||| Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842 Query: 384 ttggccccgac 394 ||||| ||||| Sbjct: 98841 ttggcgccgac 98831
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 48.1 bits (24), Expect = 0.023 Identities = 59/71 (83%) Strand = Plus / Minus Query: 324 gggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggcaacgaggatg 383 |||||||| ||||| || |||||||||| |||||||| |||| ||| | |||||||| Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552 Query: 384 ttggccccgac 394 ||||| ||||| Sbjct: 551 ttggcgccgac 541
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 46.1 bits (23), Expect = 0.089 Identities = 31/34 (91%) Strand = Plus / Minus Query: 378 aggatgttggccccgacnatgaagccgatggcga 411 |||||||||||||| || ||||||||||| |||| Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcga 523
>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds Length = 1072 Score = 46.1 bits (23), Expect = 0.089 Identities = 32/35 (91%) Strand = Plus / Minus Query: 275 ccggcccagtagatccagatgttggtgaagtcgcc 309 ||||||||||| |||||| |||| ||||||||||| Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgcc 685
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Minus Query: 247 gccggcgaggccaccgccgatga 269 ||||||||||||||||||||||| Sbjct: 505313 gccggcgaggccaccgccgatga 505291 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 gccggcgaggccaccgccga 266 |||||||||||||||||||| Sbjct: 1274146 gccggcgaggccaccgccga 1274165
>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1, complete cds Length = 1001 Score = 46.1 bits (23), Expect = 0.089 Identities = 100/125 (80%), Gaps = 1/125 (0%) Strand = Plus / Minus Query: 279 cccagtagatccagatgttggtgaagtcgccgcatggcaacggcggggccgaatgagcgt 338 |||||||||||||| |||||||||||| ||| || | |||| ||||||||||| || Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggat-acggcggctgggccgaatgaacgg 649 Query: 339 gcanggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacnatg 398 || ||||||| |||||||| || ||||||||| | | ||||||||| || || ||| Sbjct: 648 gccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatg 589 Query: 399 aagcc 403 ||||| Sbjct: 588 aagcc 584
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 46.1 bits (23), Expect = 0.089 Identities = 29/31 (93%) Strand = Plus / Minus Query: 238 gtagacgatgccggcgaggccaccgccgatg 268 ||||| || |||||||||||||||||||||| Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 46.1 bits (23), Expect = 0.089 Identities = 28/30 (93%) Strand = Plus / Minus Query: 380 gatgttggccccgacnatgaagccgatggc 409 ||||||||| ||||| |||||||||||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggc 292
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 702 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 657
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Plus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 1173 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 1218
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 592 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 547
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 663 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 618
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 640 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 595
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 645 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 600
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 642 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 597
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 664 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 619
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 44.1 bits (22), Expect = 0.35 Identities = 45/53 (84%) Strand = Plus / Minus Query: 321 gcggggccgaatgagcgtgcanggttcatggaaccgccggagaaggggccggc 373 ||||| ||||||||||| || |||||||||| || || ||||| |||||||| Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggc 644
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 19491 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 19446
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 44.1 bits (22), Expect = 0.35 Identities = 40/46 (86%) Strand = Plus / Minus Query: 343 ggttcatggaaccgccggagaaggggccggcaacgaggatgttggc 388 |||||||||| || |||||||| || ||||| ||||||||||||| Sbjct: 609 ggttcatggatccaccggagaatggaccggcggcgaggatgttggc 564
>ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1812 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 877 agatgttggtgaagtcgccgc 857
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11, complete sequence Length = 169728 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 59831 agatgttggtgaagtcgccgc 59851
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 42.1 bits (21), Expect = 1.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 248 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 292 ||||||| |||||||||| ||| || ||||||||||||| |||| Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661
>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein Length = 991 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 272 gggccggcccagtagatccag 292 ||||||||||||||||||||| Sbjct: 655 gggccggcccagtagatccag 635
>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05, complete sequence Length = 158601 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 106408 agatgttggtgaagtcgccgc 106428
>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full insert sequence Length = 1679 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 agatgttggtgaagtcgccgc 311 ||||||||||||||||||||| Sbjct: 794 agatgttggtgaagtcgccgc 814
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 42.1 bits (21), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 380 gatgttggccccgacnatgaagccgatggcga 411 ||||||||| ||||| || ||||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcga 290
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 139 ggcatcatggaaaccaaaca 158 |||||||||||||||||||| Sbjct: 113843 ggcatcatggaaaccaaaca 113824
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete cds Length = 787 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma, aquaporin (At2g36830) mRNA, complete cds Length = 1030 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706
>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene Length = 993 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 40.1 bits (20), Expect = 5.5 Identities = 47/56 (83%) Strand = Plus / Minus Query: 237 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||||||||||| | | | |||| || |||||| |||||||||||||| Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 gccggcgaggccaccgccga 266 |||||||||||||||||||| Sbjct: 4535021 gccggcgaggccaccgccga 4535040
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence Length = 134151 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete sequence Length = 222430 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 tctgaaccaaacaacatgac 79 |||||||||||||||||||| Sbjct: 111593 tctgaaccaaacaacatgac 111574
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 cggcgaggccaccgccgatg 268 |||||||||||||||||||| Sbjct: 1656225 cggcgaggccaccgccgatg 1656206
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1009 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZD11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 975 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB5ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB18ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS84ZH08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence Length = 1042 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete sequence Length = 90348 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 ccgccgatgagcgggccggc 279 |||||||||||||||||||| Sbjct: 7090 ccgccgatgagcgggccggc 7109
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 ||||||||||| | || |||||||||||||||||| Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 258 caccgccgatgagcgggccg 277 |||||||||||||||||||| Sbjct: 557849 caccgccgatgagcgggccg 557868
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 tctgaaccaaacaacatgac 79 |||||||||||||||||||| Sbjct: 1893522 tctgaaccaaacaacatgac 1893503
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene, complete cds Length = 1398 Score = 40.1 bits (20), Expect = 5.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 257 ccaccgccgatgagcgggccggcccagtagatccag 292 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,620,939 Number of Sequences: 3902068 Number of extensions: 2620939 Number of successful extensions: 46288 Number of sequences better than 10.0: 121 Number of HSP's better than 10.0 without gapping: 123 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 45703 Number of HSP's gapped (non-prelim): 556 length of query: 411 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 389 effective length of database: 17,147,199,772 effective search space: 6670260711308 effective search space used: 6670260711308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
