ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23d05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB020961.1| Zea mays mRNA for cysteine protease component of... 135 1e-28
2gb|AY103676.1| Zea mays PCO102242 mRNA sequence 125 1e-25
3ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predic... 123 6e-25
4dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 6e-25
5dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 6e-25
6dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 6e-25
7dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA ... 123 6e-25
8gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) ... 109 8e-21
9gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence 92 2e-15
10gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4... 92 2e-15
11gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4... 92 2e-15
12gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4... 92 2e-15
13gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4... 92 2e-15
14gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4... 92 2e-15
15gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4... 92 2e-15
16gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.... 92 2e-15
17gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.... 92 2e-15
18gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.... 92 2e-15
19gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.... 92 2e-15
20gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4... 92 2e-15
21gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4... 92 2e-15
22gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4... 92 2e-15
23gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4... 92 2e-15
24gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4... 92 2e-15
25gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4... 92 2e-15
26gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4... 92 2e-15
27gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4... 92 2e-15
28gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 g... 92 2e-15
29dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 80 7e-12
30emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 80 7e-12
31emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 80 7e-12
32gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, com... 66 1e-07
33emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cyst... 64 4e-07
34gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome... 46 0.10
35dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease... 44 0.41
36emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine p... 42 1.6
37emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 42 1.6
38gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosom... 40 6.4
39gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds 40 6.4
40gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 40 6.4
41emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitoc... 40 6.4
42gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1... 40 6.4
43emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 6.4
44emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chro... 40 6.4
45emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for... 40 6.4
46gb|AC091202.3| Drosophila melanogaster 3L BAC RP98-30A3 (Roswell... 40 6.4
47gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion ori... 40 6.4
48gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, com... 40 6.4
49gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome... 40 6.4
50gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, com... 40 6.4
51gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:663983... 40 6.4
52gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete... 40 6.4
53gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complet... 40 6.4
54gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, compl... 40 6.4
55gb|AE003563.4| Drosophila melanogaster chromosome 3L, section 22... 40 6.4
56gb|AC004767.1|AC004767 Drosophila melanogaster DNA sequence (P1s... 40 6.4
57gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene... 40 6.4 
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor
            complex, complete cds
          Length = 1828

 Score =  135 bits (68), Expect = 1e-28
 Identities = 152/180 (84%), Gaps = 3/180 (1%)
 Strand = Plus / Minus

                                                                        
Query: 296  ggcttggccagggtacgcctctgagccttcactga---cagtgggctgtccttggccgcg 352
            |||||||||||||| ||| ||  ||||||||||||   |||||||||||||||| ||  |
Sbjct: 1452 ggcttggccagggttcgcttcgtagccttcactgaaagcagtgggctgtccttgcccatg 1393

                                                                        
Query: 353  aggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtga 412
            ||||| ||||||||| ||  |||||||||||| |||| ||| |||||| ||||| |||||
Sbjct: 1392 aggcaggttccctgcctgacgttgcagatggggtagtcatgggggcagcagctgtagtga 1333

                                                                        
Query: 413  tcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgccg 472
            || |||||| |||| || ||||  || ||||| ||||||||||||||||| |||||||||
Sbjct: 1332 tcgtcgcagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgccg 1273
to top
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence
          Length = 1878

 Score =  125 bits (63), Expect = 1e-25
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                        
Query: 328  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 387
            ||||||||||||||||||| ||  |||||| ||||||||| ||  |||||||||||| ||
Sbjct: 1453 tgacagtgggctgtccttgcccatgaggcaggttccctgcctgacgttgcagatggggta 1394

                                                                        
Query: 388  gttatgagggcagtagctgnagtgatcatcgcagnaggtagcacccttaagtgggcaaca 447
            || ||| |||||| ||||| ||||||| |||||| |||| || ||||  || ||||| ||
Sbjct: 1393 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1334

                                     
Query: 448  gccccaggcgaagcactacttgccg 472
            ||||||||||||||| |||||||||
Sbjct: 1333 gccccaggcgaagcagtacttgccg 1309
to top
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1377

 Score =  123 bits (62), Expect = 6e-25
 Identities = 147/176 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 355
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1331 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1272

                                                                        
Query: 356  cacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatca 415
            || ||||||||||     ||||||||||| || |  ||||||||| ||||| ||||||||
Sbjct: 1271 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1212

                                                                    
Query: 416  tcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
            |||||| |||| || ||||  |||||||| |||||||||||| |||| || |||||
Sbjct: 1211 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgcc 1156
to top
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full
            insert sequence
          Length = 1753

 Score =  123 bits (62), Expect = 6e-25
 Identities = 147/176 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 355
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 356  cacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatca 415
            || ||||||||||     ||||||||||| || |  ||||||||| ||||| ||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

                                                                    
Query: 416  tcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
            |||||| |||| || ||||  |||||||| |||||||||||| |||| || |||||
Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgcc 1221



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 26   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1667 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1610

                    
Query: 86   ccgatttt 93
            ||| ||||
Sbjct: 1609 ccgttttt 1602
to top
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full
            insert sequence
          Length = 1774

 Score =  123 bits (62), Expect = 6e-25
 Identities = 147/176 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 355
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 356  cacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatca 415
            || ||||||||||     ||||||||||| || |  ||||||||| ||||| ||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

                                                                    
Query: 416  tcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
            |||||| |||| || ||||  |||||||| |||||||||||| |||| || |||||
Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgcc 1221
to top
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full
           insert sequence
          Length = 976

 Score =  123 bits (62), Expect = 6e-25
 Identities = 147/176 (83%)
 Strand = Plus / Minus

                                                                       
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 355
           ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 598 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 539

                                                                       
Query: 356 cacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatca 415
           || ||||||||||     ||||||||||| || |  ||||||||| ||||| ||||||||
Sbjct: 538 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 479

                                                                   
Query: 416 tcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           |||||| |||| || ||||  |||||||| |||||||||||| |||| || |||||
Sbjct: 478 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgcc 423



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                       
Query: 26  agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
           |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 869 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 812

                   
Query: 86  ccgatttt 93
           ||| ||||
Sbjct: 811 ccgttttt 804
to top
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha,
            complete cds
          Length = 1929

 Score =  123 bits (62), Expect = 6e-25
 Identities = 147/176 (83%)
 Strand = Plus / Minus

                                                                        
Query: 296  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 355
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1376 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1317

                                                                        
Query: 356  cacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatca 415
            || ||||||||||     ||||||||||| || |  ||||||||| ||||| ||||||||
Sbjct: 1316 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1257

                                                                    
Query: 416  tcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
            |||||| |||| || ||||  |||||||| |||||||||||| |||| || |||||
Sbjct: 1256 tcgcagcaggtggcgccctcgagtgggcagcagccccaggcgtagcagtatttgcc 1201



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 26   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1647 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1590

                    
Query: 86   ccgatttt 93
            ||| ||||
Sbjct: 1589 ccgttttt 1582
to top
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds
          Length = 1830

 Score =  109 bits (55), Expect = 8e-21
 Identities = 122/145 (84%)
 Strand = Plus / Minus

                                                                        
Query: 328  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 387
            ||||||||||||||||||| ||  |||  | ||||||||| ||  |||||||||||| ||
Sbjct: 1418 tgacagtgggctgtccttgcccatgagcgaggttccctgcctgacgttgcagatggggta 1359

                                                                        
Query: 388  gttatgagggcagtagctgnagtgatcatcgcagnaggtagcacccttaagtgggcaaca 447
            || ||| |||||| ||||| ||||||| |||||| |||| || ||||  || ||||| ||
Sbjct: 1358 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1299

                                     
Query: 448  gccccaggcgaagcactacttgccg 472
            ||||||||||||||| |||||||||
Sbjct: 1298 gccccaggcgaagcagtacttgccg 1274
to top
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence
          Length = 718

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 36/39 (92%), Gaps = 1/39 (2%)
 Strand = Plus / Minus

                                                  
Query: 26  agctgagttttacatatacatatgcaaaagcaaatttgg 64
           |||||| |||||||| || ||||||||||||||||||||
Sbjct: 561 agctgaattttacat-tatatatgcaaaagcaaatttgg 524
to top
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtg 411
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                                       
Query: 412 atcatcgcagnaggtagcacccttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||| || ||| |||| || ||||  || ||||| ||||||||||||||||| ||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccaggcgaagcagtacttgcc 5



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 296 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 346
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 45  atatgcaaaagcaaatttgg 64
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                            
Query: 374      ttgcagatgggatagttatgagggcagtagctgnagtgatcatcgcagnaggtagcaccc 433
                ||||||||||| || |  ||||||||| ||||| |||||||||||||| |||| || |||
Sbjct: 33157777 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 33157836

                                                      
Query: 434      ttaagtgggcaacagccccaggcgaagcactacttgcc 471
                |  |||||||| |||||||||||| |||| || |||||
Sbjct: 33157837 tcgagtgggcagcagccccaggcgtagcagtatttgcc 33157874



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 296      ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 345
                ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 33157603 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 33157652



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                            
Query: 26       agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
                |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 33157332 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 33157389

                        
Query: 86       ccgatttt 93
                ||| ||||
Sbjct: 33157390 ccgttttt 33157397
to top
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                         
Query: 374   ttgcagatgggatagttatgagggcagtagctgnagtgatcatcgcagnaggtagcaccc 433
             ||||||||||| || |  ||||||||| ||||| |||||||||||||| |||| || |||
Sbjct: 48170 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 48229

                                                   
Query: 434   ttaagtgggcaacagccccaggcgaagcactacttgcc 471
             |  |||||||| |||||||||||| |||| || |||||
Sbjct: 48230 tcgagtgggcagcagccccaggcgtagcagtatttgcc 48267



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 296   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 345
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 47996 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 48045



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 26    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 47725 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 47782

                     
Query: 86    ccgatttt 93
             ||| ||||
Sbjct: 47783 ccgttttt 47790
to top
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                         
Query: 374   ttgcagatgggatagttatgagggcagtagctgnagtgatcatcgcagnaggtagcaccc 433
             ||||||||||| || |  ||||||||| ||||| |||||||||||||| |||| || |||
Sbjct: 40427 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 40486

                                                   
Query: 434   ttaagtgggcaacagccccaggcgaagcactacttgcc 471
             |  |||||||| |||||||||||| |||| || |||||
Sbjct: 40487 tcgagtgggcagcagccccaggcgtagcagtatttgcc 40524



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 296   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 345
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 40253 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 40302



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 26    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 85
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 39982 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 40039

                     
Query: 86    ccgatttt 93
             ||| ||||
Sbjct: 40040 ccgttttt 40047
to top
>gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, complete cds
          Length = 1831

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                        
Query: 359  gttccctgcttggtgttgcagatgggatagttatgagggcagtagctgnagtgatcatcg 418
            |||||||| ||  |||||||||||||||||| ||| |||||| ||||  | || || || 
Sbjct: 1336 gttccctggttaatgttgcagatgggatagtcatgtgggcagcagctataatggtcttca 1277

                                               
Query: 419  cagnaggtagcacccttaagtgggcaacagcccca 453
            ||| |||||||||||| ||||||||| || |||||
Sbjct: 1276 cagcaggtagcaccctcaagtgggcagcatcccca 1242
to top
>emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp71)
          Length = 1680

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 371  gtgttgcagatgggatagttatgagggcagtagctgnagtgatcatcgcagnaggtagca 430
            ||||||||||||||||||| ||| |||||| | ||| |||| ||||| ||| ||||||||
Sbjct: 1260 gtgttgcagatgggatagtcatgggggcagcaactgtagtggtcatcacagcaggtagca 1201

              
Query: 431  cc 432
            ||
Sbjct: 1200 cc 1199
to top
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence
          Length = 202981

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 83    aacccgattttaggattatgtacaggagcat 113
             |||||||||||||||||| | ||||||||||
Sbjct: 65968 aacccgattttaggattaggaacaggagcat 65998
to top
>dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease, complete cds
          Length = 1668

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 395  gggcagtagctgnagtgatcatcgcagnaggt 426
            |||||| ||||| |||||||||||||| ||||
Sbjct: 1252 gggcagcagctggagtgatcatcgcagcaggt 1221
to top
>emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine proteinase, partial
          Length = 995

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 79/99 (79%)
 Strand = Plus / Minus

                                                                       
Query: 373 gttgcagatgggatagttatgagggcagtagctgnagtgatcatcgcagnaggtagcacc 432
           ||||||||||||||| | ||| |||||| | ||| | || ||||| ||| | || ||| |
Sbjct: 599 gttgcagatgggatactcatgtgggcagcaactgtaatggtcatcacagcaagtggcagc 540

                                                  
Query: 433 cttaagtgggcaacagccccaggcgaagcactacttgcc 471
           ||  ||||||||||| |||||  ||||||| ||| ||||
Sbjct: 539 ctcgagtgggcaacatccccactcgaagcaatacctgcc 501
to top
>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
              complete sequence
          Length = 129478

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 33     ttttacatatacatatgcaaaagca 57
              |||||||| ||||||||||||||||
Sbjct: 119390 ttttacatttacatatgcaaaagca 119414
to top
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence
          Length = 235813

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 108    gagcatctattataaagaagatac 131
              ||||||||||||||||| ||||||
Sbjct: 211168 gagcatctattataaaggagatac 211191
to top
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds
          Length = 3146

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 97   attatgtacaggagcatctattat 120
            |||| |||||||||||||||||||
Sbjct: 1972 attaggtacaggagcatctattat 1995
to top
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    acatatacatatgcaaaagcaaat 60
             ||||||||||||||||||| ||||
Sbjct: 96777 acatatacatatgcaaaagtaaat 96754
to top
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome
          Length = 85779

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aaatttggtggttctgtaaa 76
             ||||||||||||||||||||
Sbjct: 41670 aaatttggtggttctgtaaa 41689
to top
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete
              sequence
          Length = 250743

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     atacatatgcaaaagcaaat 60
              ||||||||||||||||||||
Sbjct: 171275 atacatatgcaaaagcaaat 171294
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the
             5' end of the RORB gene for RAR-related orphan receptor B
             protein (RZRB, ROR-BETA), two novel genes and two CpG
             islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 181   gtgatcatttgcagaagttaatca 204
             |||||||||| |||||||||||||
Sbjct: 81873 gtgatcattttcagaagttaatca 81896
to top
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains
             pseudogene similar to part of a novel gene (KIAA1688), a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 6 (SLC25A6) (ANT3)
             pseudogene and a CpG island, complete sequence
          Length = 169550

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    ttttacatatacatatgcaa 52
             ||||||||||||||||||||
Sbjct: 22532 ttttacatatacatatgcaa 22513
to top
>emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for cytochrome B extending
            from map position 71.3 to 80.2. (Strain D273-10B.)
          Length = 6264

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 57   aaatttggtggttctgtaaa 76
            ||||||||||||||||||||
Sbjct: 1475 aaatttggtggttctgtaaa 1494
to top
>gb|AC091202.3| Drosophila melanogaster 3L BAC RP98-30A3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 171209

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 3     gcagctccaactgcgtgggaatgagctg 30
             |||||||||||||| |||||||| ||||
Sbjct: 62447 gcagctccaactgcatgggaatgcgctg 62420
to top
>gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion origin of replication (ori6)
            and oli1 gene, complete cds
          Length = 8316

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 57   aaatttggtggttctgtaaa 76
            ||||||||||||||||||||
Sbjct: 2631 aaatttggtggttctgtaaa 2650
to top
>gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, complete cds
          Length = 765

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  aaatttggtggttctgtaaa 76
           ||||||||||||||||||||
Sbjct: 184 aaatttggtggttctgtaaa 203
to top
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence
          Length = 220673

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 108   gagcatctattataaagaagatac 131
             ||||||||||||||||| ||||||
Sbjct: 75779 gagcatctattataaaggagatac 75802
to top
>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence
          Length = 179835

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 37     acatatacatatgcaaaagcaaat 60
              ||||||||||||||||||| ||||
Sbjct: 171309 acatatacatatgcaaaagtaaat 171286
to top
>gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:6639837, complete cds
          Length = 5263

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 34   tttacatatacatatgcaaa 53
            ||||||||||||||||||||
Sbjct: 3028 tttacatatacatatgcaaa 3009
to top
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    ttacatatacatatgcaaaa 54
             ||||||||||||||||||||
Sbjct: 66744 ttacatatacatatgcaaaa 66763
to top
>gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complete sequence
          Length = 203428

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 37     acatatacatatgcaaaagcaaat 60
              |||||||||||| |||||||||||
Sbjct: 152020 acatatacatattcaaaagcaaat 151997
to top
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence
          Length = 151453

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 362   ccctgcttggtgttgcagat 381
             ||||||||||||||||||||
Sbjct: 20107 ccctgcttggtgttgcagat 20126
to top
>gb|AE003563.4| Drosophila melanogaster chromosome 3L, section 22 of 83 of the complete
              sequence
          Length = 264966

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 3      gcagctccaactgcgtgggaatgagctg 30
              |||||||||||||| |||||||| ||||
Sbjct: 175383 gcagctccaactgcatgggaatgcgctg 175356
to top
>gb|AC004767.1|AC004767 Drosophila melanogaster DNA sequence (P1s DS01986 (D261), DS01814
             (D252), and DS08881 (D260)), complete sequence
          Length = 196672

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 3     gcagctccaactgcgtgggaatgagctg 30
             |||||||||||||| |||||||| ||||
Sbjct: 13752 gcagctccaactgcatgggaatgcgctg 13779
to top
>gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene, intron 4
          Length = 1453

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 57  aaatttggtggttctgtaaa 76
           ||||||||||||||||||||
Sbjct: 598 aaatttggtggttctgtaaa 617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,705,432
Number of Sequences: 3902068
Number of extensions: 3705432
Number of successful extensions: 72630
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72437
Number of HSP's gapped (non-prelim): 180
length of query: 472
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 450
effective length of database: 17,147,199,772
effective search space: 7716239897400
effective search space used: 7716239897400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top