ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23d04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF271636.1|AF271636 Zea mays lysine ketoglutarate reductase/s... 111 1e-21
2gb|BT019240.1| Zea mays clone Contig913.F mRNA sequence 103 3e-19
3ref|XM_468146.1| Oryza sativa (japonica cultivar-group), mRNA 96 7e-17
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 96 7e-17
5dbj|AP004849.3| Oryza sativa (japonica cultivar-group) genomic D... 96 7e-17
6dbj|AP004095.3| Oryza sativa (japonica cultivar-group) genomic D... 96 7e-17
7gb|AY104186.1| Zea mays PCO090008 mRNA sequence 96 7e-17
8dbj|AB070252.1| Oryza sativa (japonica cultivar-group) OsRPT1b m... 96 7e-17
9dbj|AK061876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
10dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
11dbj|AP004738.3| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
12dbj|AP003514.3| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
13dbj|AK103801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
14dbj|AK100060.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
15dbj|AK070538.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
16dbj|AB033535.1| Oryza sativa (japonica cultivar-group) OsRPT1 mR... 94 3e-16
17gb|DQ306749.1| Hevea brasiliensis isolate SSH20 mRNA sequence 74 2e-10
18gb|AF041258.1|AF041258 Prunus persica 26S proteasome subunit 7 m... 74 2e-10
19gb|AC135796.25| Medicago truncatula clone mth2-28b18, complete s... 58 1e-05
20ref|XM_959037.1| Neurospora crassa OR74A probable 26S proteasome... 48 0.014
21ref|XM_330027.1| Neurospora crassa OR74A probable 26S proteasome... 48 0.014
22emb|BX069371.1|CNS09POV Single read from an extremity of a full-... 48 0.014
23emb|BX065166.1|CNS09MG2 Single read from an extremity of a full-... 48 0.014
24emb|BX065165.1|CNS09MG1 Single read from an extremity of a full-... 48 0.014
25emb|BX060321.1|CNS09IPH Single read from an extremity of a full-... 48 0.014
26emb|BX041702.1|CNS094CA Single read from an extremity of a full-... 48 0.014
27emb|BX842624.1| Neurospora crassa DNA linkage group I BAC clone ... 48 0.014
28ref|XM_309476.2| Anopheles gambiae str. PEST ENSANGP00000021987 ... 48 0.014
29ref|XM_380735.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 46 0.054
30ref|XM_805956.1| Trypanosoma cruzi strain CL Brener proteasome r... 46 0.054
31ref|XM_808626.1| Trypanosoma cruzi strain CL Brener proteasome r... 46 0.054
32dbj|BS000061.1| Pan troglodytes chromosome 22 clone:PTB-027C13, ... 44 0.21
33ref|NM_008950.1| Mus musculus protease (prosome, macropain) 26S ... 42 0.85
34gb|BC004052.1| Mus musculus protease (prosome, macropain) 26S su... 42 0.85
35emb|CR847808.6| Zebrafish DNA sequence from clone CH211-151I8 in... 42 0.85
36gb|BC030840.1| Mus musculus protease (prosome, macropain) 26S su... 42 0.85
37dbj|AK135451.1| Mus musculus 12 days embryo female mullerian duc... 42 0.85
38dbj|AK145703.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 42 0.85
39dbj|AK010505.1| Mus musculus ES cells cDNA, RIKEN full-length en... 42 0.85
40emb|BX321898.29| Zebrafish DNA sequence from clone DKEYP-34C12 i... 42 0.85
41emb|Z54219.1|MMSUG1MR M.musculus mRNA for mSUG1 42 0.85
42emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chr... 42 0.85
43gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, co... 40 3.4
44gb|BC050253.1| Mus musculus single-strand selective monofunction... 40 3.4
45gb|AC162693.5| Mus musculus chromosome 15, clone RP24-89G21, com... 40 3.4
46gb|BC054071.1| Mus musculus single-strand selective monofunction... 40 3.4
47gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 3.4
48ref|NM_058125.3| Drosophila melanogaster Rpt1 CG1341-RA (Rpt1), ... 40 3.4
49gb|AY061606.1| Drosophila melanogaster SD07148 full length cDNA 40 3.4
50gb|AC093046.1| Drosophila melanogaster, chromosome 2R, region 43... 40 3.4
51gb|AC008259.4|AC008259 Drosophila melanogaster, chromosome 2R, r... 40 3.4
52dbj|AK020817.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 3.4
53gb|AC019216.9|AC019216 Homo sapiens BAC clone RP11-484N11 from 4... 40 3.4
54gb|AC084462.1|AC084462 Caenorhabditis briggsae cosmid CB034G23, ... 40 3.4
55gb|AF145307.1|AF145307 Drosophila melanogaster 26S proteasome re... 40 3.4
56emb|BX649262.4| Zebrafish DNA sequence from clone DKEY-174I8 in ... 40 3.4
57emb|BX324180.4| Zebrafish DNA sequence from clone CH211-134O13 i... 40 3.4
58emb|AL953867.18| Zebrafish DNA sequence from clone CH211-258L4 i... 40 3.4
59gb|AE003840.3| Drosophila melanogaster chromosome 2R, section 10... 40 3.4
60gb|AC005447.1|AC005447 Drosophila melanogaster, chromosome 2R, r... 40 3.4 
>gb|AF271636.1|AF271636 Zea mays lysine ketoglutarate reductase/saccharopine dehydrogenase
             (LKRSDH) gene, complete cds
          Length = 15146

 Score =  111 bits (56), Expect = 1e-21
 Identities = 118/139 (84%)
 Strand = Plus / Plus

                                                                         
Query: 113   acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
             ||||||| || || || ||||| ||||||||||| || |||||||| ||||| ||||| |
Sbjct: 14513 acaccatatacttgggtgttgcactgaatttctggtagcccttgatgaccttattgacag 14572

                                                                         
Query: 173   agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
               ||||| |||| |||||| ||||| || |||||||||||||| ||||| ||||| ||||
Sbjct: 14573 catcgagaaaatccttctctgtcaccgttttcctgcgggcacgaatggcatacatcccgg 14632

                                
Query: 233   cttctgtgcagacactcct 251
             ||||||||||||| |||||
Sbjct: 14633 cttctgtgcagacgctcct 14651
to top
>gb|BT019240.1| Zea mays clone Contig913.F mRNA sequence
          Length = 764

 Score =  103 bits (52), Expect = 3e-19
 Identities = 117/139 (84%)
 Strand = Plus / Plus

                                                                       
Query: 113 acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
           ||||||| || || || ||||| ||||||||||| || |||||||| ||||| ||||| |
Sbjct: 169 acaccatatacttgggtgttgcactgaatttctggtagcccttgatgaccttattgacag 228

                                                                       
Query: 173 agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             || || |||| |||||| ||||| || |||||||||||||| ||||| ||||| ||||
Sbjct: 229 catcaagaaaatccttctctgtcaccgttttcctgcgggcacgaatggcatacatcccgg 288

                              
Query: 233 cttctgtgcagacactcct 251
           ||||||||||||| |||||
Sbjct: 289 cttctgtgcagacgctcct 307
to top
>ref|XM_468146.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1281

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||||||||| || || |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 1273 acaccatgtattttggagtcgcgctgaacttctgataccctttgatgaccttgtttacag 1214

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
              || ||||| | |||||| ||||| || ||||  ||||| || || || |||||||| |
Sbjct: 1213 catcaaggaagtccttctcagtcactgttttccgtcgggcgcgaatcgcatacatgccag 1154

                               
Query: 233  cttctgtgcagacactcct 251
            |||||||||||||||||||
Sbjct: 1153 cttctgtgcagacactcct 1135
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Plus

                                                                            
Query: 113      acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
                ||||||||||||| || || |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 33334213 acaccatgtattttggagtcgcgctgaacttctgataccctttgatgaccttgtttacag 33334272

                                                                            
Query: 173      agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
                  || ||||| | |||||| ||||| || ||||  ||||| || || || |||||||| |
Sbjct: 33334273 catcaaggaagtccttctcagtcactgttttccgtcgggcgcgaatcgcatacatgccag 33334332

                                   
Query: 233      cttctgtgcagacactcct 251
                |||||||||||||||||||
Sbjct: 33334333 cttctgtgcagacactcct 33334351
to top
>dbj|AP004849.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1311_D08
          Length = 163702

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Plus

                                                                          
Query: 113    acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
              ||||||||||||| || || |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 163522 acaccatgtattttggagtcgcgctgaacttctgataccctttgatgaccttgtttacag 163581

                                                                          
Query: 173    agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
                || ||||| | |||||| ||||| || ||||  ||||| || || || |||||||| |
Sbjct: 163582 catcaaggaagtccttctcagtcactgttttccgtcgggcgcgaatcgcatacatgccag 163641

                                 
Query: 233    cttctgtgcagacactcct 251
              |||||||||||||||||||
Sbjct: 163642 cttctgtgcagacactcct 163660
to top
>dbj|AP004095.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1715_H01
          Length = 138733

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Plus

                                                                         
Query: 113   acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
             ||||||||||||| || || |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 74963 acaccatgtattttggagtcgcgctgaacttctgataccctttgatgaccttgtttacag 75022

                                                                         
Query: 173   agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
               || ||||| | |||||| ||||| || ||||  ||||| || || || |||||||| |
Sbjct: 75023 catcaaggaagtccttctcagtcactgttttccgtcgggcgcgaatcgcatacatgccag 75082

                                
Query: 233   cttctgtgcagacactcct 251
             |||||||||||||||||||
Sbjct: 75083 cttctgtgcagacactcct 75101
to top
>gb|AY104186.1| Zea mays PCO090008 mRNA sequence
          Length = 1614

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||| ||||| ||||| || |||||||| ||||||||||| |
Sbjct: 1375 acaccatatacttgggtgttgcactgaacttctggtagcccttgatgaccttgttgacag 1316

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
              ||||| |||| ||| || ||||| || ||||||||||| || ||||||||||| ||||
Sbjct: 1315 catcgagaaaatccttttctgtcaccgttttcctgcgggcgcgaatggcgtacatcccgg 1256

                               
Query: 233  cttctgtgcagacactcct 251
            |||||||||| || |||||
Sbjct: 1255 cttctgtgcaaacgctcct 1237
to top
>dbj|AB070252.1| Oryza sativa (japonica cultivar-group) OsRPT1b mRNA for 26S
           proteasome regulatory particle triple-A ATPase
           subunit1b, partial cds
          Length = 887

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 116/139 (83%)
 Strand = Plus / Minus

                                                                       
Query: 113 acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
           ||||||||||||| || || |||||||| ||||||||||| ||||| |||||||| || |
Sbjct: 701 acaccatgtattttggagtcgcgctgaacttctgataccctttgatgaccttgtttacag 642

                                                                       
Query: 173 agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             || ||||| | |||||| ||||| || ||||  ||||| || || || |||||||| |
Sbjct: 641 catcaaggaagtccttctcagtcactgttttccgtcgggcgcgaatcgcatacatgccag 582

                              
Query: 233 cttctgtgcagacactcct 251
           |||||||||||||||||||
Sbjct: 581 cttctgtgcagacactcct 563
to top
>dbj|AK061876.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-A12, full
            insert sequence
          Length = 1567

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 1386 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 1327

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 1326 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 1267

                              
Query: 233  cttctgtgcagacactcc 250
            | || ||||| |||||||
Sbjct: 1266 cctccgtgcacacactcc 1249
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                           
Query: 113     acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
               ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 4681264 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 4681205

                                                                           
Query: 173     agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
                ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 4681204 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 4681145

                                 
Query: 233     cttctgtgcagacactcc 250
               | || ||||| |||||||
Sbjct: 4681144 cctccgtgcacacactcc 4681127
to top
>dbj|AP004738.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0090D06
          Length = 174500

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                          
Query: 113    acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
              ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 168628 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 168569

                                                                          
Query: 173    agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
               ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 168568 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 168509

                                
Query: 233    cttctgtgcagacactcc 250
              | || ||||| |||||||
Sbjct: 168508 cctccgtgcacacactcc 168491
to top
>dbj|AP003514.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0698A06
          Length = 156514

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                         
Query: 113   acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
             ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 43863 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 43804

                                                                         
Query: 173   agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
              ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 43803 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 43744

                               
Query: 233   cttctgtgcagacactcc 250
             | || ||||| |||||||
Sbjct: 43743 cctccgtgcacacactcc 43726
to top
>dbj|AK103801.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033146D17, full
            insert sequence
          Length = 1512

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 1387 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 1328

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 1327 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 1268

                              
Query: 233  cttctgtgcagacactcc 250
            | || ||||| |||||||
Sbjct: 1267 cctccgtgcacacactcc 1250
to top
>dbj|AK100060.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013159J17, full
            insert sequence
          Length = 1510

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 1385 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 1326

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 1325 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 1266

                              
Query: 233  cttctgtgcagacactcc 250
            | || ||||| |||||||
Sbjct: 1265 cctccgtgcacacactcc 1248
to top
>dbj|AK070538.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023060N22, full
            insert sequence
          Length = 1828

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 1387 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 1328

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 1327 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 1268

                              
Query: 233  cttctgtgcagacactcc 250
            | || ||||| |||||||
Sbjct: 1267 cctccgtgcacacactcc 1250
to top
>dbj|AB033535.1| Oryza sativa (japonica cultivar-group) OsRPT1 mRNA for 26S proteasome
            regulatory particle triple-A ATPase subunit1, complete
            cds
          Length = 1481

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                        
Query: 113  acaccatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccg 172
            ||||||| || || || ||||||||||| || || || |||||||| ||||| || ||||
Sbjct: 1290 acaccatatacttgggcgttgcgctgaacttttggtaacccttgatcaccttattcaccg 1231

                                                                        
Query: 173  agtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccgg 232
             ||| | ||||| |||||| ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 1230 cgtccaagaaatccttctctgtcaccgtcttcctgcgagcgcggatggcgtacatgccag 1171

                              
Query: 233  cttctgtgcagacactcc 250
            | || ||||| |||||||
Sbjct: 1170 cctccgtgcacacactcc 1153
to top
>gb|DQ306749.1| Hevea brasiliensis isolate SSH20 mRNA sequence
          Length = 526

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 120/148 (81%)
 Strand = Plus / Plus

                                                                       
Query: 104 ctcaattggacaccatgtatttcggggttgcgctgaatttctgataccccttgataacct 163
           |||||||| | ||||| || || ||||| || ||||| ||||||||||||||||| ||||
Sbjct: 115 ctcaattgtagaccatatactttggggtcgcactgaacttctgataccccttgatcacct 174

                                                                       
Query: 164 tgttgaccgagtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgt 223
           |||| ||||  || ||||| |  ||||| || || ||||||||||| || |  ||||| |
Sbjct: 175 tgttcaccgcatccaggaagtctttctcagtaactgtcttcctgcgtgccctaatggcat 234

                                       
Query: 224 acatgccggcttctgtgcagacactcct 251
           |||| || || || ||||||||||||||
Sbjct: 235 acatcccagcctcagtgcagacactcct 262
to top
>gb|AF041258.1|AF041258 Prunus persica 26S proteasome subunit 7 mRNA, complete cds
          Length = 1539

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 115  accatgtatttcggggttgcgctgaatttctgataccccttgataaccttgttgaccgag 174
            ||||| || ||||| ||||| ||||| ||||| |||||||| || || ||||| || |  
Sbjct: 1376 accatatacttcggtgttgcactgaacttctggtaccccttaatcactttgttcacagca 1317

                                                                        
Query: 175  tcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgtacatgccggct 234
            || ||||||| |||||| || || |||||||| || ||||||||||||||||| || |||
Sbjct: 1316 tcaaggaaatccttctctgttactgtcttccttcgtgcacggatggcgtacattccagct 1257

                    
Query: 235  tctgtgca 242
            || |||||
Sbjct: 1256 tcagtgca 1249
to top
>gb|AC135796.25| Medicago truncatula clone mth2-28b18, complete sequence
          Length = 118959

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 118/148 (79%)
 Strand = Plus / Plus

                                                                         
Query: 104   ctcaattggacaccatgtatttcggggttgcgctgaatttctgataccccttgataacct 163
             |||||||| | ||||| ||||| || ||||| ||||||||||| ||||| ||||| || |
Sbjct: 55647 ctcaattgtagaccatatatttgggagttgcactgaatttctggtaccctttgatgactt 55706

                                                                         
Query: 164   tgttgaccgagtcgaggaaatncttctccgtcacagtcttcctgcgggcacggatggcgt 223
             | || || |  || ||||| |  ||||| || ||||||||||| | ||||||||| || |
Sbjct: 55707 tattcactgcatccaggaagtctttctctgttacagtcttccttctggcacggatagcat 55766

                                         
Query: 224   acatgccggcttctgtgcagacactcct 251
             |||| || ||||| ||||| || |||||
Sbjct: 55767 acataccagcttcagtgcacacgctcct 55794
to top
>ref|XM_959037.1| Neurospora crassa OR74A probable 26S proteasome regulatory particle
            chain RPT1 [MIPS] (NCU02840.1) partial mRNA
          Length = 1320

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 201  cttcctgcgggcacggatggcgtacatgccggcttctgtgcagacact 248
            ||||||||| |||||||||||| ||||||| || || ||||| |||||
Sbjct: 1224 cttcctgcgcgcacggatggcgaacatgcccgcctccgtgcaaacact 1177
to top
>ref|XM_330027.1| Neurospora crassa OR74A probable 26S proteasome regulatory particle
            chain RPT1 [MIPS] (NCU02840.1) partial mRNA
          Length = 1320

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 201  cttcctgcgggcacggatggcgtacatgccggcttctgtgcagacact 248
            ||||||||| |||||||||||| ||||||| || || ||||| |||||
Sbjct: 1224 cttcctgcgcgcacggatggcgaacatgcccgcctccgtgcaaacact 1177
to top
>emb|BX069371.1|CNS09POV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 153 cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
           |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 168 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 210
to top
>emb|BX065166.1|CNS09MG2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 153 cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
           |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 189 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 231
to top
>emb|BX065165.1|CNS09MG1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 153 cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
           |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 936 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 894
to top
>emb|BX060321.1|CNS09IPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 153 cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
           |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 193 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 235
to top
>emb|BX041702.1|CNS094CA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 153 cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
           |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 181 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 223
to top
>emb|BX842624.1| Neurospora crassa DNA linkage group I BAC clone B10D6
          Length = 89019

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 201   cttcctgcgggcacggatggcgtacatgccggcttctgtgcagacact 248
             ||||||||| |||||||||||| ||||||| || || ||||| |||||
Sbjct: 81588 cttcctgcgcgcacggatggcgaacatgcccgcctccgtgcaaacact 81635
to top
>ref|XM_309476.2| Anopheles gambiae str. PEST ENSANGP00000021987 (ENSANGG00000019498),
            partial mRNA
          Length = 1491

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 153  cttgataaccttgttgaccgagtcgaggaaatncttctccgtc 195
            |||||| |||||||||||||  |||||||| | ||||||||||
Sbjct: 1443 cttgatcaccttgttgaccgcctcgaggaagtccttctccgtc 1401
to top
>ref|XM_380735.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
            (FG00559.1) partial mRNA
          Length = 1323

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 214  cggatggcgtacatgccggcttctgtgcagacact 248
            ||||||||||||||||| ||||| ||||| |||||
Sbjct: 1214 cggatggcgtacatgccagcttcagtgcacacact 1180
to top
>ref|XM_805956.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase
            subunit 1 (Tc00.1047053506857.90) partial mRNA
          Length = 1314

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 88/110 (80%)
 Strand = Plus / Minus

                                                                        
Query: 133  gcgctgaatttctgataccccttgataaccttgttgaccgagtcgaggaaatncttctcc 192
            ||||||||||| || | ||||||||| ||||||||||| |  || ||||| | ||| || 
Sbjct: 1286 gcgctgaatttgtggtgccccttgatcaccttgttgacagcatcaaggaagtccttttcg 1227

                                                              
Query: 193  gtcacagtcttcctgcgggcacggatggcgtacatgccggcttctgtgca 242
             | |  ||||| | |||||| ||||||||  ||||||||||||| |||||
Sbjct: 1226 ttgatcgtcttgcggcgggctcggatggcaaacatgccggcttccgtgca 1177
to top
>ref|XM_808626.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase
            subunit 1 (Tc00.1047053509207.160) partial mRNA
          Length = 1314

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 88/110 (80%)
 Strand = Plus / Minus

                                                                        
Query: 133  gcgctgaatttctgataccccttgataaccttgttgaccgagtcgaggaaatncttctcc 192
            ||||||||||| || | ||||||||| ||||||||||| |  || ||||| | ||| || 
Sbjct: 1286 gcgctgaatttgtggtgccccttgatcaccttgttgacagcatcaaggaagtccttttcg 1227

                                                              
Query: 193  gtcacagtcttcctgcgggcacggatggcgtacatgccggcttctgtgca 242
             | |  ||||| | |||||| ||||||||  ||||||||||||| |||||
Sbjct: 1226 ttgatcgtcttgcggcgggctcggatggcaaacatgccggcttccgtgca 1177
to top
>dbj|BS000061.1| Pan troglodytes chromosome 22 clone:PTB-027C13, map 22, complete
              sequences
          Length = 164304

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 128    gggttgcgctgaatttctgata 149
              ||||||||||||||||||||||
Sbjct: 125374 gggttgcgctgaatttctgata 125395
to top
>ref|NM_008950.1| Mus musculus protease (prosome, macropain) 26S subunit, ATPase 5
            (Psmc5), mRNA
          Length = 1277

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1116 ggcgtacatgccagcttctgtgcacacac 1088
to top
>gb|BC004052.1| Mus musculus protease (prosome, macropain) 26S subunit, ATPase 5,
           mRNA (cDNA clone IMAGE:3497597), partial cds
          Length = 1012

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 219 ggcgtacatgccggcttctgtgcagacac 247
           |||||||||||| ||||||||||| ||||
Sbjct: 811 ggcgtacatgccagcttctgtgcacacac 783
to top
>emb|CR847808.6| Zebrafish DNA sequence from clone CH211-151I8 in linkage group 22,
             complete sequence
          Length = 147994

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    caaacatgcactgaaacaaaa 90
             |||||||||||||||||||||
Sbjct: 47381 caaacatgcactgaaacaaaa 47361
to top
>gb|BC030840.1| Mus musculus protease (prosome, macropain) 26S subunit, ATPase 5,
            mRNA (cDNA clone MGC:31044 IMAGE:3994523), complete cds
          Length = 1415

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1226 ggcgtacatgccagcttctgtgcacacac 1198
to top
>dbj|AK135451.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820422J17 product:protease (prosome,
            macropain) 26S subunit, ATPase 5, full insert sequence
          Length = 1291

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1126 ggcgtacatgccagcttctgtgcacacac 1098
to top
>dbj|AK145703.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0031K24 product:protease (prosome,
            macropain) 26S subunit, ATPase 5, full insert sequence
          Length = 1284

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1120 ggcgtacatgccagcttctgtgcacacac 1092
to top
>dbj|AK010505.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
            clone:2410015M02 product:protease (prosome, macropain)
            26S subunit, ATPase 5, full insert sequence
          Length = 1302

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1136 ggcgtacatgccagcttctgtgcacacac 1108
to top
>emb|BX321898.29| Zebrafish DNA sequence from clone DKEYP-34C12 in linkage group 22,
              complete sequence
          Length = 195042

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     caaacatgcactgaaacaaaa 90
              |||||||||||||||||||||
Sbjct: 147920 caaacatgcactgaaacaaaa 147940
to top
>emb|Z54219.1|MMSUG1MR M.musculus mRNA for mSUG1
          Length = 1277

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 219  ggcgtacatgccggcttctgtgcagacac 247
            |||||||||||| ||||||||||| ||||
Sbjct: 1116 ggcgtacatgccagcttctgtgcacacac 1088
to top
>emb|AL604045.7| Mouse DNA sequence from clone RP23-418O11 on chromosome 11, complete
             sequence
          Length = 221399

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 219   ggcgtacatgccggcttctgtgcagacac 247
             |||||||||||| ||||||||||| ||||
Sbjct: 44875 ggcgtacatgccagcttctgtgcacacac 44847
to top
>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence
          Length = 216364

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 136    ctgaatttctgatacccctt 155
              ||||||||||||||||||||
Sbjct: 178593 ctgaatttctgatacccctt 178612
to top
>gb|BC050253.1| Mus musculus single-strand selective monofunctional uracil DNA
           glycosylase, mRNA (cDNA clone MGC:57026 IMAGE:6467286),
           complete cds
          Length = 2339

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 ctgaatttctgatacccctt 155
           ||||||||||||||||||||
Sbjct: 155 ctgaatttctgatacccctt 174
to top
>gb|AC162693.5| Mus musculus chromosome 15, clone RP24-89G21, complete sequence
          Length = 159813

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   ctgaatttctgatacccctt 155
             ||||||||||||||||||||
Sbjct: 28911 ctgaatttctgatacccctt 28930
to top
>gb|BC054071.1| Mus musculus single-strand selective monofunctional uracil DNA
           glycosylase, mRNA (cDNA clone IMAGE:6442163)
          Length = 2338

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 ctgaatttctgatacccctt 155
           ||||||||||||||||||||
Sbjct: 155 ctgaatttctgatacccctt 174
to top
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 215     ggatggcgtacatgccggct 234
               ||||||||||||||||||||
Sbjct: 3028832 ggatggcgtacatgccggct 3028813
to top
>ref|NM_058125.3| Drosophila melanogaster Rpt1 CG1341-RA (Rpt1), mRNA
          Length = 1513

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                   
Query: 153  cttgataaccttgttgaccgagtcgaggaaatncttctc 191
            |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 1365 cttgataaccttcttgacggcttcgaggaaatccttctc 1327
to top
>gb|AY061606.1| Drosophila melanogaster SD07148 full length cDNA
          Length = 1518

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                   
Query: 153  cttgataaccttgttgaccgagtcgaggaaatncttctc 191
            |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 1349 cttgataaccttcttgacggcttcgaggaaatccttctc 1311
to top
>gb|AC093046.1| Drosophila melanogaster, chromosome 2R, region 43D-43E, BAC clone
             BACR29D02, complete sequence
          Length = 158372

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                    
Query: 153   cttgataaccttgttgaccgagtcgaggaaatncttctc 191
             |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 73254 cttgataaccttcttgacggcttcgaggaaatccttctc 73292
to top
>gb|AC008259.4|AC008259 Drosophila melanogaster, chromosome 2R, region 43D-43D, BAC clone
              BACR04H12, complete sequence
          Length = 175285

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                     
Query: 153    cttgataaccttgttgaccgagtcgaggaaatncttctc 191
              |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 145771 cttgataaccttcttgacggcttcgaggaaatccttctc 145809
to top
>dbj|AK020817.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930006H09 product:single-strand selective
           monofunctional uracil DNA glycosylase, full insert
           sequence
          Length = 851

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 ctgaatttctgatacccctt 155
           ||||||||||||||||||||
Sbjct: 387 ctgaatttctgatacccctt 406
to top
>gb|AC019216.9|AC019216 Homo sapiens BAC clone RP11-484N11 from 4, complete sequence
          Length = 160858

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tgcaaacatgcactgaaaca 87
             ||||||||||||||||||||
Sbjct: 71429 tgcaaacatgcactgaaaca 71410
to top
>gb|AC084462.1|AC084462 Caenorhabditis briggsae cosmid CB034G23, complete sequence
          Length = 72268

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   cttgctcaattggacaccat 119
             ||||||||||||||||||||
Sbjct: 59484 cttgctcaattggacaccat 59465
to top
>gb|AF145307.1|AF145307 Drosophila melanogaster 26S proteasome regulatory complex subunit
            p48B mRNA, complete cds
          Length = 1302

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                   
Query: 153  cttgataaccttgttgaccgagtcgaggaaatncttctc 191
            |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 1254 cttgataaccttcttgacggcttcgaggaaatccttctc 1216
to top
>emb|BX649262.4| Zebrafish DNA sequence from clone DKEY-174I8 in linkage group 20,
             complete sequence
          Length = 55019

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 57    tacggtatggatgcaaacatgcactgaa 84
             ||||||| |||||||||||| |||||||
Sbjct: 43114 tacggtagggatgcaaacatccactgaa 43141
to top
>emb|BX324180.4| Zebrafish DNA sequence from clone CH211-134O13 in linkage group 22,
              complete sequence
          Length = 136724

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 57     tacggtatggatgcaaacatgcactgaa 84
              ||||||| |||||||||||| |||||||
Sbjct: 124555 tacggtagggatgcaaacatccactgaa 124582
to top
>emb|AL953867.18| Zebrafish DNA sequence from clone CH211-258L4 in linkage group 22,
             complete sequence
          Length = 177575

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    ggatgcaaacatgcactgaa 84
             ||||||||||||||||||||
Sbjct: 52270 ggatgcaaacatgcactgaa 52251
to top
>gb|AE003840.3| Drosophila melanogaster chromosome 2R, section 10 of 73 of the complete
              sequence
          Length = 272100

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                     
Query: 153    cttgataaccttgttgaccgagtcgaggaaatncttctc 191
              |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 136175 cttgataaccttcttgacggcttcgaggaaatccttctc 136213
to top
>gb|AC005447.1|AC005447 Drosophila melanogaster, chromosome 2R, region 43E5-43E10, P1 clone
             DS03503, complete sequence
          Length = 77907

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                    
Query: 153   cttgataaccttgttgaccgagtcgaggaaatncttctc 191
             |||||||||||| ||||| |  |||||||||| ||||||
Sbjct: 50423 cttgataaccttcttgacggcttcgaggaaatccttctc 50461


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,537,821
Number of Sequences: 3902068
Number of extensions: 1537821
Number of successful extensions: 25976
Number of sequences better than 10.0: 60
Number of HSP's better than 10.0 without gapping: 60
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25883
Number of HSP's gapped (non-prelim): 92
length of query: 259
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 237
effective length of database: 17,147,199,772
effective search space: 4063886345964
effective search space used: 4063886345964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top