>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 45/45 (100%)
 Strand = Plus / Minus

                                                             
Query: 205      cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 249
                |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29461424 cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 29461380

>dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0621D05
          Length = 180250

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 45/45 (100%)
 Strand = Plus / Minus

                                                           
Query: 205    cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 249
              |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172305 cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 172261

>dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0655A07
          Length = 172473

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 45/45 (100%)
 Strand = Plus / Minus

                                                          
Query: 205   cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 249
             |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 25930 cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 25886

>dbj|AK100915.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133D21, full
           insert sequence
          Length = 773

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 45/45 (100%)
 Strand = Plus / Minus

                                                        
Query: 205 cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 249
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 cttcttgaggctgccgcggacgccgggcttgggcttggaggagga 407

>gb|AY105672.1| Zea mays PCO122536 mRNA sequence
          Length = 842

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 41/41 (100%)
 Strand = Plus / Minus

                                                    
Query: 205 cttcttgaggctgccgcggacgccgggcttgggcttggagg 245
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 432 cttcttgaggctgccgcggacgccgggcttgggcttggagg 392

>gb|BT016375.1| Zea mays clone Contig208 mRNA sequence
          Length = 815

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 209 ttgaggctgccgcggacgccgggcttgggcttggagg 245
           |||||||||||||||||||||||||||||||||||||
Sbjct: 417 ttgaggctgccgcggacgccgggcttgggcttggagg 381

>gb|BT017513.1| Zea mays clone EL01N0419A08.c mRNA sequence
          Length = 817

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 205 cttcttgaggctgccgcggacgccgggcttgggcttggagg 245
           |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 410 cttcttaaggctgccgcggacgccgggcttgggcttggagg 370

>gb|AY106117.1| Zea mays PCO122535 mRNA sequence
          Length = 764

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                    
Query: 205 cttcttgaggctgccgcggacgccgggcttgggcttggagg 245
           ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 403 cttcttgaggctgccgcggaccccgggcttgggcttggagg 363

>emb|AJ389885.1|AFR389885 Artemia franciscana partial mRNA for Na,K-ATPase alpha-1 subunit,
            clone c130
          Length = 2990

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  ggagggggtttagattaccc 201
            ||||||||||||||||||||
Sbjct: 2846 ggagggggtttagattaccc 2827


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,589,530
Number of Sequences: 3902068
Number of extensions: 1589530
Number of successful extensions: 45311
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45293
Number of HSP's gapped (non-prelim): 18
length of query: 254
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 232
effective length of database: 17,147,199,772
effective search space: 3978150347104
effective search space used: 3978150347104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)