ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd23a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 42 1.3
2ref|XM_957307.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.3
3ref|XM_326220.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.3
4gb|AC008953.7| Homo sapiens chromosome 5 clone CTD-2339M3, compl... 42 1.3
5gb|AC035140.7| Homo sapiens chromosome 5 clone CTD-2631K10, comp... 42 1.3
6dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
7dbj|AK109939.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
8dbj|AK106277.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
9gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.3
10gb|AY732106.1| Hepatitis C virus isolate 01CHNYNHCV3 from China ... 40 5.3
11gb|AY732103.1| Hepatitis C virus isolate 00CHNYN18M from China p... 40 5.3
12ref|XM_465884.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.3
13gb|AY725971.1| Hepatitis C virus clone 03 polyprotein gene, part... 40 5.3
14gb|AY725970.1| Hepatitis C virus clone 28 polyprotein gene, part... 40 5.3
15gb|AY725966.1| Hepatitis C virus clone 04 polyprotein gene, part... 40 5.3
16gb|AY725965.1| Hepatitis C virus clone 10 polyprotein gene, part... 40 5.3
17gb|AY725964.1| Hepatitis C virus clone 12 polyprotein gene, part... 40 5.3
18gb|AY725963.1| Hepatitis C virus clone 16 polyprotein gene, part... 40 5.3
19gb|AY725962.1| Hepatitis C virus clone 26 polyprotein gene, part... 40 5.3
20gb|AY725961.1| Hepatitis C virus clone 01 polyprotein gene, part... 40 5.3
21gb|AY725960.1| Hepatitis C virus clone 14 polyprotein gene, part... 40 5.3
22gb|AY725959.1| Hepatitis C virus clone 32 polyprotein gene, part... 40 5.3
23ref|XM_367331.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.3
24ref|XM_590721.2| PREDICTED: Bos taurus similar to Nuclear mitoti... 40 5.3
25gb|AC120181.10| Mus musculus chromosome 12, clone RP24-500I11, c... 40 5.3
26gb|M62381.1|HPCST77 Hepatitis C virus polyprotein gene, partial cds 40 5.3
27gb|AC123058.3| Mus musculus BAC clone RP23-188J8 from 19, comple... 40 5.3
28emb|BX640404.2| Chicken DNA sequence from clone WAG-36O23, compl... 40 5.3
29gb|AC125451.7| Mus musculus chromosome 12, clone RP23-41O6, comp... 40 5.3
30emb|AL359079.15| Human DNA sequence from clone RP13-360B22 on ch... 40 5.3
31dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
32dbj|AP003796.2| Gallus gallus genomic DNA, chromosome 5, clone:2... 40 5.3
33ref|NM_204949.1| Gallus gallus transcription factor cash4 (LOC39... 40 5.3
34gb|AF245893.1|AF245893 Hepatitis C virus isolate P9 clone C69 po... 40 5.3
35gb|AF245892.1|AF245892 Hepatitis C virus isolate P9 clone C65 po... 40 5.3
36gb|AF245890.1|AF245890 Hepatitis C virus isolate P9 clone C62 po... 40 5.3
37gb|AF245889.1|AF245889 Hepatitis C virus isolate P9 clone C119 p... 40 5.3
38gb|AF245888.1|AF245888 Hepatitis C virus isolate P9 clone C118 p... 40 5.3
39gb|AF245887.1|AF245887 Hepatitis C virus isolate P9 clone C116 p... 40 5.3
40gb|AF245885.1|AF245885 Hepatitis C virus isolate P9 clone C51 po... 40 5.3
41gb|AF245884.1|AF245884 Hepatitis C virus isolate P9 clone C23 po... 40 5.3
42gb|AF245883.1|AF245883 Hepatitis C virus isolate P9 clone B347 p... 40 5.3
43gb|AF245881.1|AF245881 Hepatitis C virus isolate P9 clone B345 p... 40 5.3
44gb|AF245879.1|AF245879 Hepatitis C virus isolate P9 clone B343 p... 40 5.3
45gb|AF245878.1|AF245878 Hepatitis C virus isolate P9 clone B337 p... 40 5.3
46gb|AF245876.1|AF245876 Hepatitis C virus isolate P9 clone B256 p... 40 5.3
47gb|AF245875.1|AF245875 Hepatitis C virus isolate P9 clone B225 p... 40 5.3
48gb|AF245874.1|AF245874 Hepatitis C virus isolate P9 clone B111 p... 40 5.3
49gb|AF245873.1|AF245873 Hepatitis C virus isolate P9 clone A60 po... 40 5.3
50gb|AF245872.1|AF245872 Hepatitis C virus isolate P9 clone A59 po... 40 5.3
51gb|AF245870.1|AF245870 Hepatitis C virus isolate P9 clone A53 po... 40 5.3
52gb|AF245869.1|AF245869 Hepatitis C virus isolate P9 clone A52 po... 40 5.3
53gb|AF245868.1|AF245868 Hepatitis C virus isolate P9 clone A49 po... 40 5.3
54gb|AF245867.1|AF245867 Hepatitis C virus isolate P9 clone A107 p... 40 5.3
55gb|AF245865.1|AF245865 Hepatitis C virus isolate P9 clone A103 p... 40 5.3
56gb|AF245841.1|AF245841 Hepatitis C virus isolate P9 clone A105 p... 40 5.3
57gb|AF230452.1|AF230452 Hepatitis C virus isolate X361A-ww polypr... 40 5.3
58gb|AF230451.1|AF230451 Hepatitis C virus isolate X361A-vv polypr... 40 5.3
59gb|AF230450.1|AF230450 Hepatitis C virus isolate X361A-uu polypr... 40 5.3
60gb|AF230448.1|AF230448 Hepatitis C virus isolate X361A-ff polypr... 40 5.3
61gb|AF230447.1|AF230447 Hepatitis C virus isolate X361A-a polypro... 40 5.3
62gb|AF230446.1|AF230446 Hepatitis C virus isolate X187A-e polypro... 40 5.3
63gb|AF230445.1|AF230445 Hepatitis C virus isolate X187A-ss polypr... 40 5.3
64gb|AF230444.1|AF230444 Hepatitis C virus isolate X187A-nn polypr... 40 5.3
65gb|AF230443.1|AF230443 Hepatitis C virus isolate X187A-mm polypr... 40 5.3
66gb|AF230442.1|AF230442 Hepatitis C virus isolate X187A-a polypro... 40 5.3
67gb|AF230441.1|AF230441 Hepatitis C virus isolate X187HC4_1 polyp... 40 5.3
68gb|AF230440.1|AF230440 Hepatitis C virus isolate X187HC3_11 poly... 40 5.3
69gb|AF230439.1|AF230439 Hepatitis C virus isolate X187HC6_15 poly... 40 5.3
70gb|AF230438.1|AF230438 Hepatitis C virus isolate X186A-qq polypr... 40 5.3
71gb|AF230437.1|AF230437 Hepatitis C virus isolate X186A-b polypro... 40 5.3
72gb|AF230436.1|AF230436 Hepatitis C virus isolate X186A-ll polypr... 40 5.3
73gb|AF230435.1|AF230435 Hepatitis C virus isolate X186A-mm polypr... 40 5.3
74gb|AF230434.1|AF230434 Hepatitis C virus isolate X186A-a polypro... 40 5.3
75gb|AF230433.1|AF230433 Hepatitis C virus isolate X186HC12_4 poly... 40 5.3
76gb|AF230432.1|AF230432 Hepatitis C virus isolate X186HC26_2 poly... 40 5.3
77gb|AF230431.1|AF230431 Hepatitis C virus isolate X186HC14_21 pol... 40 5.3
78gb|AF230430.1|AF230430 Hepatitis C virus isolate X268A-gg polypr... 40 5.3
79gb|AF230429.1|AF230429 Hepatitis C virus isolate X268A-ff polypr... 40 5.3
80gb|AF230428.1|AF230428 Hepatitis C virus isolate X268A-b polypro... 40 5.3
81gb|AF230427.1|AF230427 Hepatitis C virus isolate X268A-a polypro... 40 5.3
82gb|AF230426.1|AF230426 Hepatitis C virus isolate X174C-ee polypr... 40 5.3
83gb|AF230423.1|AF230423 Hepatitis C virus isolate X174C-q polypro... 40 5.3
84gb|AF230422.1|AF230422 Hepatitis C virus isolate X174C-p polypro... 40 5.3
85gb|AF230421.1|AF230421 Hepatitis C virus isolate X174A-o polypro... 40 5.3
86gb|AF230420.1|AF230420 Hepatitis C virus isolate X174A-m polypro... 40 5.3
87gb|AF230419.1|AF230419 Hepatitis C virus isolate X174A-j polypro... 40 5.3
88gb|AF230418.1|AF230418 Hepatitis C virus isolate X007A-f polypro... 40 5.3
89gb|AF230417.1|AF230417 Hepatitis C virus isolate X007A-b polypro... 40 5.3
90gb|AF230416.1|AF230416 Hepatitis C virus isolate X007A-a polypro... 40 5.3
91dbj|AP005066.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
92dbj|AB038172.1| Xenopus laevis mRNA for caspase-9, complete cds 40 5.3
93gb|U89138.1|GGU89138 Gallus gallus transcription factor cash4 mR... 40 5.3
94gb|AF011753.1|AF011753 Hepatitis C virus strain H77 pH21 polypro... 40 5.3
95gb|AF011752.1|AF011752 Hepatitis C virus strain H77 pCV-H11 poly... 40 5.3
96gb|AF011751.1|AF011751 Hepatitis C virus strain H77 pCV-H77C pol... 40 5.3
97gb|AF009606.1|AF009606 Hepatitis C virus polyprotein gene, compl... 40 5.3
98emb|AL133305.3|CNS01DUO Human chromosome 14 DNA sequence BAC R-6... 40 5.3
99emb|AL163613.2|CNS01RIJ Human chromosome 14 DNA sequence BAC R-2... 40 5.3
100gb|AY231582.1| Hepatitis C virus isolate NB74 polyprotein gene, ... 40 5.3
101gb|M67463.1|HPCCGAA Hepatitis C virus, complete genome 40 5.3

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 232   ggcggcggcggcgtcgtgttc 252
             |||||||||||||||||||||
Sbjct: 88139 ggcggcggcggcgtcgtgttc 88119



to top

>ref|XM_957307.1| Neurospora crassa OR74A hypothetical protein (NCU06366.1) partial
           mRNA
          Length = 1515

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 202 ggacagaatttggccaagaag 222
           |||||||||||||||||||||
Sbjct: 451 ggacagaatttggccaagaag 471



to top

>ref|XM_326220.1| Neurospora crassa OR74A hypothetical protein (NCU06366.1) partial
           mRNA
          Length = 1515

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 202 ggacagaatttggccaagaag 222
           |||||||||||||||||||||
Sbjct: 451 ggacagaatttggccaagaag 471



to top

>gb|AC008953.7| Homo sapiens chromosome 5 clone CTD-2339M3, complete sequence
          Length = 95401

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 333   cggcggttctttctccttggg 353
             |||||||||||||||||||||
Sbjct: 87010 cggcggttctttctccttggg 86990



to top

>gb|AC035140.7| Homo sapiens chromosome 5 clone CTD-2631K10, complete sequence
          Length = 61965

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 333   cggcggttctttctccttggg 353
             |||||||||||||||||||||
Sbjct: 12843 cggcggttctttctccttggg 12823



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 232     ggcggcggcggcgtcgtgttc 252
               |||||||||||||||||||||
Sbjct: 2534265 ggcggcggcggcgtcgtgttc 2534285



to top

>dbj|AK109939.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-A12, full
           insert sequence
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 232 ggcggcggcggcgtcgtgttc 252
           |||||||||||||||||||||
Sbjct: 700 ggcggcggcggcgtcgtgttc 720



to top

>dbj|AK106277.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-H06, full
           insert sequence
          Length = 2330

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 232 ggcggcggcggcgtcgtgttc 252
           |||||||||||||||||||||
Sbjct: 821 ggcggcggcggcgtcgtgttc 841



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 232     ggcggcggcggcgtcgtgttc 252
               |||||||||||||||||||||
Sbjct: 2543296 ggcggcggcggcgtcgtgttc 2543316



to top

>gb|AY732106.1| Hepatitis C virus isolate 01CHNYNHCV3 from China polyprotein gene,
           partial cds
          Length = 527

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 192 caccacggctgggcttgttggtct 215



to top

>gb|AY732103.1| Hepatitis C virus isolate 00CHNYN18M from China polyprotein gene,
           partial cds
          Length = 535

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 201 caccacggctgggcttgttggtct 224



to top

>ref|XM_465884.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 522

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 232 ggcggcggcggcgtcgtgtt 251
           ||||||||||||||||||||
Sbjct: 166 ggcggcggcggcgtcgtgtt 185



to top

>gb|AY725971.1| Hepatitis C virus clone 03 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725970.1| Hepatitis C virus clone 28 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725966.1| Hepatitis C virus clone 04 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725965.1| Hepatitis C virus clone 10 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725964.1| Hepatitis C virus clone 12 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725963.1| Hepatitis C virus clone 16 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725962.1| Hepatitis C virus clone 26 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725961.1| Hepatitis C virus clone 01 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725960.1| Hepatitis C virus clone 14 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>gb|AY725959.1| Hepatitis C virus clone 32 polyprotein gene, partial cds
          Length = 437

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 92  caccacggctgggcttgttggtct 115



to top

>ref|XM_367331.1| Magnaporthe grisea 70-15 hypothetical protein (MG07256.4) partial
           mRNA
          Length = 3255

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 232 ggcggcggcggcgtcgtgtt 251
           ||||||||||||||||||||
Sbjct: 371 ggcggcggcggcgtcgtgtt 352



to top

>ref|XM_590721.2| PREDICTED: Bos taurus similar to Nuclear mitotic apparatus protein 1
            (NuMA protein) (SP-H antigen) (LOC513091), mRNA
          Length = 7202

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 313  gcaggctcagggagggcctg 332
            ||||||||||||||||||||
Sbjct: 6025 gcaggctcagggagggcctg 6006



to top

>gb|AC120181.10| Mus musculus chromosome 12, clone RP24-500I11, complete sequence
          Length = 212015

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 281  agtaatcaccaggaagattg 300
            ||||||||||||||||||||
Sbjct: 2697 agtaatcaccaggaagattg 2678



to top

>gb|M62381.1|HPCST77 Hepatitis C virus polyprotein gene, partial cds
          Length = 2610

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1458 caccacggctgggcttgttggtct 1481



to top

>gb|AC123058.3| Mus musculus BAC clone RP23-188J8 from 19, complete sequence
          Length = 194636

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   gaggcatggacagaatttgg 214
             ||||||||||||||||||||
Sbjct: 81798 gaggcatggacagaatttgg 81817



to top

>emb|BX640404.2| Chicken DNA sequence from clone WAG-36O23, complete sequence
          Length = 136520

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 233   gcggcggcggcgtcgtgttc 252
             ||||||||||||||||||||
Sbjct: 61570 gcggcggcggcgtcgtgttc 61589



to top

>gb|AC125451.7| Mus musculus chromosome 12, clone RP23-41O6, complete sequence
          Length = 236838

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 281    agtaatcaccaggaagattg 300
              ||||||||||||||||||||
Sbjct: 150134 agtaatcaccaggaagattg 150115



to top

>emb|AL359079.15| Human DNA sequence from clone RP13-360B22 on chromosome Xq22.2-23
             Contains the 3' end of the AMMECR1 gene for Alport
             syndrome (mental retardation, midface hypoplasia and
             elliptocytosis, chromosomal region gene 1) (FLJ341111) and
             the 3' end of a novel gene (FLJ22679, FLJ36808), complete
             sequence
          Length = 89267

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 337   ggttctttctccttgggctc 356
             ||||||||||||||||||||
Sbjct: 62016 ggttctttctccttgggctc 61997



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 232      ggcggcggcggcgtcgtgtt 251
                ||||||||||||||||||||
Sbjct: 18098208 ggcggcggcggcgtcgtgtt 18098227



to top

>dbj|AP003796.2| Gallus gallus genomic DNA, chromosome 5, clone:26D12, complete sequence
          Length = 156014

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   gcggcggcggcgtcgtgttc 252
             ||||||||||||||||||||
Sbjct: 29091 gcggcggcggcgtcgtgttc 29072



to top

>ref|NM_204949.1| Gallus gallus transcription factor cash4 (LOC395791), mRNA
          Length = 504

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 gcggcggcggcgtcgtgttc 252
           ||||||||||||||||||||
Sbjct: 326 gcggcggcggcgtcgtgttc 307



to top

>gb|AF245893.1|AF245893 Hepatitis C virus isolate P9 clone C69 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245892.1|AF245892 Hepatitis C virus isolate P9 clone C65 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245890.1|AF245890 Hepatitis C virus isolate P9 clone C62 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245889.1|AF245889 Hepatitis C virus isolate P9 clone C119 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245888.1|AF245888 Hepatitis C virus isolate P9 clone C118 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245887.1|AF245887 Hepatitis C virus isolate P9 clone C116 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245885.1|AF245885 Hepatitis C virus isolate P9 clone C51 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245884.1|AF245884 Hepatitis C virus isolate P9 clone C23 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245883.1|AF245883 Hepatitis C virus isolate P9 clone B347 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245881.1|AF245881 Hepatitis C virus isolate P9 clone B345 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245879.1|AF245879 Hepatitis C virus isolate P9 clone B343 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245878.1|AF245878 Hepatitis C virus isolate P9 clone B337 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245876.1|AF245876 Hepatitis C virus isolate P9 clone B256 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245875.1|AF245875 Hepatitis C virus isolate P9 clone B225 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245874.1|AF245874 Hepatitis C virus isolate P9 clone B111 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245873.1|AF245873 Hepatitis C virus isolate P9 clone A60 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245872.1|AF245872 Hepatitis C virus isolate P9 clone A59 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245870.1|AF245870 Hepatitis C virus isolate P9 clone A53 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245869.1|AF245869 Hepatitis C virus isolate P9 clone A52 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245868.1|AF245868 Hepatitis C virus isolate P9 clone A49 polyprotein precursor, E1/E2
           region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245867.1|AF245867 Hepatitis C virus isolate P9 clone A107 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245865.1|AF245865 Hepatitis C virus isolate P9 clone A103 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF245841.1|AF245841 Hepatitis C virus isolate P9 clone A105 polyprotein precursor,
           E1/E2 region, gene, partial cds
          Length = 558

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 231 caccacggctgggcttgttggtct 254



to top

>gb|AF230452.1|AF230452 Hepatitis C virus isolate X361A-ww polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230451.1|AF230451 Hepatitis C virus isolate X361A-vv polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230450.1|AF230450 Hepatitis C virus isolate X361A-uu polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230448.1|AF230448 Hepatitis C virus isolate X361A-ff polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230447.1|AF230447 Hepatitis C virus isolate X361A-a polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230446.1|AF230446 Hepatitis C virus isolate X187A-e polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230445.1|AF230445 Hepatitis C virus isolate X187A-ss polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230444.1|AF230444 Hepatitis C virus isolate X187A-nn polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230443.1|AF230443 Hepatitis C virus isolate X187A-mm polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230442.1|AF230442 Hepatitis C virus isolate X187A-a polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230441.1|AF230441 Hepatitis C virus isolate X187HC4_1 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230440.1|AF230440 Hepatitis C virus isolate X187HC3_11 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230439.1|AF230439 Hepatitis C virus isolate X187HC6_15 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230438.1|AF230438 Hepatitis C virus isolate X186A-qq polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230437.1|AF230437 Hepatitis C virus isolate X186A-b polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230436.1|AF230436 Hepatitis C virus isolate X186A-ll polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230435.1|AF230435 Hepatitis C virus isolate X186A-mm polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230434.1|AF230434 Hepatitis C virus isolate X186A-a polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230433.1|AF230433 Hepatitis C virus isolate X186HC12_4 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230432.1|AF230432 Hepatitis C virus isolate X186HC26_2 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230431.1|AF230431 Hepatitis C virus isolate X186HC14_21 polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230430.1|AF230430 Hepatitis C virus isolate X268A-gg polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230429.1|AF230429 Hepatitis C virus isolate X268A-ff polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230428.1|AF230428 Hepatitis C virus isolate X268A-b polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230427.1|AF230427 Hepatitis C virus isolate X268A-a polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230426.1|AF230426 Hepatitis C virus isolate X174C-ee polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230423.1|AF230423 Hepatitis C virus isolate X174C-q polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230422.1|AF230422 Hepatitis C virus isolate X174C-p polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230421.1|AF230421 Hepatitis C virus isolate X174A-o polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230420.1|AF230420 Hepatitis C virus isolate X174A-m polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230419.1|AF230419 Hepatitis C virus isolate X174A-j polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230418.1|AF230418 Hepatitis C virus isolate X007A-f polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230417.1|AF230417 Hepatitis C virus isolate X007A-b polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>gb|AF230416.1|AF230416 Hepatitis C virus isolate X007A-a polyprotein gene, partial cds
          Length = 390

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 149 caccacggctgggcttgtcggtct 172
           |||||||||||||||||| |||||
Sbjct: 66  caccacggctgggcttgttggtct 89



to top

>dbj|AP005066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0047E05
          Length = 184323

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 232   ggcggcggcggcgtcgtgtt 251
             ||||||||||||||||||||
Sbjct: 21609 ggcggcggcggcgtcgtgtt 21628



to top

>dbj|AB038172.1| Xenopus laevis mRNA for caspase-9, complete cds
          Length = 1388

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 104 ggacccgattccgcctcaaa 123
           ||||||||||||||||||||
Sbjct: 49  ggacccgattccgcctcaaa 30



to top

>gb|U89138.1|GGU89138 Gallus gallus transcription factor cash4 mRNA, complete cds
          Length = 504

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 gcggcggcggcgtcgtgttc 252
           ||||||||||||||||||||
Sbjct: 326 gcggcggcggcgtcgtgttc 307



to top

>gb|AF011753.1|AF011753 Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds
          Length = 9599

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1523 caccacggctgggcttgttggtct 1546



to top

>gb|AF011752.1|AF011752 Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds
          Length = 9599

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1523 caccacggctgggcttgttggtct 1546



to top

>gb|AF011751.1|AF011751 Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds
          Length = 9599

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1523 caccacggctgggcttgttggtct 1546



to top

>gb|AF009606.1|AF009606 Hepatitis C virus polyprotein gene, complete cds
          Length = 9646

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1523 caccacggctgggcttgttggtct 1546



to top

>emb|AL133305.3|CNS01DUO Human chromosome 14 DNA sequence BAC R-66M11 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 159524

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   agtaatcaccaggaagattg 300
             ||||||||||||||||||||
Sbjct: 92102 agtaatcaccaggaagattg 92121



to top

>emb|AL163613.2|CNS01RIJ Human chromosome 14 DNA sequence BAC R-25I19 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 150312

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 38    aaaaacagagcagagcttccaaag 61
             |||| |||||||||||||||||||
Sbjct: 14429 aaaaccagagcagagcttccaaag 14406



to top

>gb|AY231582.1| Hepatitis C virus isolate NB74 polyprotein gene, partial cds
          Length = 1805

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1448 caccacggctgggcttgttggtct 1471



to top

>gb|M67463.1|HPCCGAA Hepatitis C virus, complete genome
          Length = 9416

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 149  caccacggctgggcttgtcggtct 172
            |||||||||||||||||| |||||
Sbjct: 1523 caccacggctgggcttgttggtct 1546


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,271,174
Number of Sequences: 3902068
Number of extensions: 3271174
Number of successful extensions: 94425
Number of sequences better than 10.0: 101
Number of HSP's better than 10.0 without gapping: 101
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93921
Number of HSP's gapped (non-prelim): 498
length of query: 396
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 374
effective length of database: 17,147,199,772
effective search space: 6413052714728
effective search space used: 6413052714728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top