>emb|AJ342483.1|HSA342483 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-OC23R
          Length = 801

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 21  gtcagtcacacacactctttat 42
           ||||||||||||||||||||||
Sbjct: 751 gtcagtcacacacactctttat 772

>gb|AF075610.1| Equus caballus microsatellite LEX007
          Length = 401

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 27  cacacacactctttatacgtacaca 51
           |||||||||||||||||| ||||||
Sbjct: 177 cacacacactctttatacttacaca 153

>gb|AC123074.2| Mus musculus BAC clone RP23-168H19 from 10, complete sequence
          Length = 210189

 Score = 42.1 bits (21), Expect = 0.90
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    gtctcgtctccattgctgctt 165
              |||||||||||||||||||||
Sbjct: 117090 gtctcgtctccattgctgctt 117070

>ref|XM_823315.1| Trypanosoma brucei TREU927 mitochondrial DNA polymerase I protein D
            (Tb11.02.0770) partial mRNA; nuclear gene for
            mitochondrial product
          Length = 4890

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 123  gagcagcatgcccgatgtga 142
            ||||||||||||||||||||
Sbjct: 3376 gagcagcatgcccgatgtga 3357

>gb|AC148526.24| Medicago truncatula clone mth2-53k6, complete sequence
          Length = 89055

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 164   ttcattttgttgctataaataatg 187
             ||||||||||| ||||||||||||
Sbjct: 36806 ttcattttgttcctataaataatg 36829

>emb|AL135797.10| Human DNA sequence from clone GS1-77J13 on chromosome 1 Contains part
             of the gene for hemicentin, complete sequence
          Length = 41219

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   attttgttgctataaataat 186
             ||||||||||||||||||||
Sbjct: 24123 attttgttgctataaataat 24142

>emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001
          Length = 281116

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     cagtcacacacactctttat 42
              ||||||||||||||||||||
Sbjct: 260954 cagtcacacacactctttat 260935

>gb|AF445379.1| Trypanosoma brucei DNA polymerase I-like protein D (POLID) gene,
            complete cds; nuclear gene for mitochondrial product
          Length = 5997

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 123  gagcagcatgcccgatgtga 142
            ||||||||||||||||||||
Sbjct: 4135 gagcagcatgcccgatgtga 4116

>gb|AC148482.10| Medicago truncatula clone mth2-36j11, complete sequence
          Length = 115873

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 164    ttcattttgttgctataaataatg 187
              ||||||||||| ||||||||||||
Sbjct: 114923 ttcattttgttcctataaataatg 114900

>gb|AC093807.3| Homo sapiens BAC clone RP11-330J16 from 4, complete sequence
          Length = 171415

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 59    aaaatttataagaggcaaag 78
             ||||||||||||||||||||
Sbjct: 64404 aaaatttataagaggcaaag 64385

>gb|AC006946.20| Homo sapiens Chromosome 22q11 Pac Clone p109l3 in CES region, complete
             sequence
          Length = 193159

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    cagtcacacacactctttat 42
             ||||||||||||||||||||
Sbjct: 54999 cagtcacacacactctttat 54980

>gb|AC016559.3| Homo sapiens chromosome 5 clone CTC-422A18, complete sequence
          Length = 143039

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   tctccattgctgcttcattt 170
             ||||||||||||||||||||
Sbjct: 23294 tctccattgctgcttcattt 23275

>dbj|AP003900.1| Homo sapiens genomic DNA, chromosome 21q, clone:CMP21-T171+S39,
             complete sequences
          Length = 85444

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    cagtcacacacactctttat 42
             ||||||||||||||||||||
Sbjct: 65282 cagtcacacacactctttat 65263

>dbj|AP000549.1| Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye Syndrome region,
             clone:c1A3
          Length = 35878

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    cagtcacacacactctttat 42
             ||||||||||||||||||||
Sbjct: 26900 cagtcacacacactctttat 26919


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,866,170
Number of Sequences: 3902068
Number of extensions: 1866170
Number of successful extensions: 34332
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34316
Number of HSP's gapped (non-prelim): 16
length of query: 272
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 250
effective length of database: 17,147,199,772
effective search space: 4286799943000
effective search space used: 4286799943000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)