Clone Name | rbasd22l05 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_476990.1| Oryza sativa (japonica cultivar-group), mRNA Length = 987 Score = 293 bits (148), Expect = 2e-76 Identities = 205/224 (91%) Strand = Plus / Minus Query: 194 ctcgagcacgaccgacttggggttcaccatgggcgggcccttctcccggccctcgagctc 253 |||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| Sbjct: 688 ctcgagcagcacggacttagggttcaccatgggcgggcccttctccctcccctcgagctc 629 Query: 254 gtcgacgccgaaggtgatgagcctatcccagttcccgccctcgaacagcacccccacctt 313 ||||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||| Sbjct: 628 gtcgagatcgaaggtgatgagcctgtcccagatccccccctcgaacagcaccccgacctt 569 Query: 314 cccatcggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttctt 373 || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 568 gccgtcggtgacgcgctgcacgatgccgcagtacatgtggtaggcgttgttggggttctt 509 Query: 374 gacgagcaccaccatgccagggaggaacagcggcaactccggcg 417 ||||||||||||||| || |||||||||||||||| |||||||| Sbjct: 508 gacgagcaccaccatcccggggaggaacagcggcagctccggcg 465 Score = 44.1 bits (22), Expect = 0.36 Identities = 37/42 (88%) Strand = Plus / Minus Query: 125 ggcggccgtgtcttcctcttccttcttcttctcggccacctc 166 |||||| ||| ||||||| ||||||||||||| |||| |||| Sbjct: 778 ggcggcggtgccttcctcctccttcttcttcttggcctcctc 737
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 293 bits (148), Expect = 2e-76 Identities = 205/224 (91%) Strand = Plus / Plus Query: 194 ctcgagcacgaccgacttggggttcaccatgggcgggcccttctcccggccctcgagctc 253 |||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| Sbjct: 5248480 ctcgagcagcacggacttagggttcaccatgggcgggcccttctccctcccctcgagctc 5248539 Query: 254 gtcgacgccgaaggtgatgagcctatcccagttcccgccctcgaacagcacccccacctt 313 ||||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||| Sbjct: 5248540 gtcgagatcgaaggtgatgagcctgtcccagatccccccctcgaacagcaccccgacctt 5248599 Query: 314 cccatcggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttctt 373 || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 5248600 gccgtcggtgacgcgctgcacgatgccgcagtacatgtggtaggcgttgttggggttctt 5248659 Query: 374 gacgagcaccaccatgccagggaggaacagcggcaactccggcg 417 ||||||||||||||| || |||||||||||||||| |||||||| Sbjct: 5248660 gacgagcaccaccatcccggggaggaacagcggcagctccggcg 5248703 Score = 44.1 bits (22), Expect = 0.36 Identities = 37/42 (88%) Strand = Plus / Plus Query: 125 ggcggccgtgtcttcctcttccttcttcttctcggccacctc 166 |||||| ||| ||||||| ||||||||||||| |||| |||| Sbjct: 5248390 ggcggcggtgccttcctcctccttcttcttcttggcctcctc 5248431
>dbj|AP003848.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1715_A07 Length = 130907 Score = 293 bits (148), Expect = 2e-76 Identities = 205/224 (91%) Strand = Plus / Plus Query: 194 ctcgagcacgaccgacttggggttcaccatgggcgggcccttctcccggccctcgagctc 253 |||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| Sbjct: 115194 ctcgagcagcacggacttagggttcaccatgggcgggcccttctccctcccctcgagctc 115253 Query: 254 gtcgacgccgaaggtgatgagcctatcccagttcccgccctcgaacagcacccccacctt 313 ||||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||| Sbjct: 115254 gtcgagatcgaaggtgatgagcctgtcccagatccccccctcgaacagcaccccgacctt 115313 Query: 314 cccatcggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttctt 373 || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 115314 gccgtcggtgacgcgctgcacgatgccgcagtacatgtggtaggcgttgttggggttctt 115373 Query: 374 gacgagcaccaccatgccagggaggaacagcggcaactccggcg 417 ||||||||||||||| || |||||||||||||||| |||||||| Sbjct: 115374 gacgagcaccaccatcccggggaggaacagcggcagctccggcg 115417 Score = 44.1 bits (22), Expect = 0.36 Identities = 37/42 (88%) Strand = Plus / Plus Query: 125 ggcggccgtgtcttcctcttccttcttcttctcggccacctc 166 |||||| ||| ||||||| ||||||||||||| |||| |||| Sbjct: 115104 ggcggcggtgccttcctcctccttcttcttcttggcctcctc 115145
>dbj|AP004379.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0589E08 Length = 138416 Score = 293 bits (148), Expect = 2e-76 Identities = 205/224 (91%) Strand = Plus / Plus Query: 194 ctcgagcacgaccgacttggggttcaccatgggcgggcccttctcccggccctcgagctc 253 |||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| Sbjct: 47243 ctcgagcagcacggacttagggttcaccatgggcgggcccttctccctcccctcgagctc 47302 Query: 254 gtcgacgccgaaggtgatgagcctatcccagttcccgccctcgaacagcacccccacctt 313 ||||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||| Sbjct: 47303 gtcgagatcgaaggtgatgagcctgtcccagatccccccctcgaacagcaccccgacctt 47362 Query: 314 cccatcggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttctt 373 || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 47363 gccgtcggtgacgcgctgcacgatgccgcagtacatgtggtaggcgttgttggggttctt 47422 Query: 374 gacgagcaccaccatgccagggaggaacagcggcaactccggcg 417 ||||||||||||||| || |||||||||||||||| |||||||| Sbjct: 47423 gacgagcaccaccatcccggggaggaacagcggcagctccggcg 47466 Score = 44.1 bits (22), Expect = 0.36 Identities = 37/42 (88%) Strand = Plus / Plus Query: 125 ggcggccgtgtcttcctcttccttcttcttctcggccacctc 166 |||||| ||| ||||||| ||||||||||||| |||| |||| Sbjct: 47153 ggcggcggtgccttcctcctccttcttcttcttggcctcctc 47194
>dbj|AK070765.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023071P20, full insert sequence Length = 987 Score = 285 bits (144), Expect = 6e-74 Identities = 204/224 (91%) Strand = Plus / Minus Query: 194 ctcgagcacgaccgacttggggttcaccatgggcgggcccttctcccggccctcgagctc 253 |||||||| || ||||| |||||||||||||||||||||||||||| ||||||||||| Sbjct: 688 ctcgagcagcacggacttagggttcaccatgggcgggcccttctccctcccctcgagctc 629 Query: 254 gtcgacgccgaaggtgatgagcctatcccagttcccgccctcgaacagcacccccacctt 313 ||||| |||||||||||||||| |||||| |||| ||||||||||||||||| ||||| Sbjct: 628 gtcgagatcgaaggtgatgagcctgtcccagatccccccctcgaacagcaccccgacctt 569 Query: 314 cccatcggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttctt 373 || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 568 gccgtcggtgacgcgctgcacgatgccgcagtacatgtggtaggcgttgttggggttctt 509 Query: 374 gacgagcaccaccatgccagggaggaacagcggcaactccggcg 417 |||||| |||||||| || |||||||||||||||| |||||||| Sbjct: 508 gacgagtaccaccatcccggggaggaacagcggcagctccggcg 465 Score = 44.1 bits (22), Expect = 0.36 Identities = 37/42 (88%) Strand = Plus / Minus Query: 125 ggcggccgtgtcttcctcttccttcttcttctcggccacctc 166 |||||| ||| ||||||| ||||||||||||| |||| |||| Sbjct: 778 ggcggcggtgccttcctcctccttcttcttcttggcctcctc 737
>gb|AC109601.9| Oryza sativa chromosome 3 BAC OSJNBa0004G03 genomic sequence, complete sequence Length = 145590 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 320 ggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttc 371 ||||| |||||||||||| ||| ||||||||||||| | ||||||||||||| Sbjct: 60222 ggtgatgcgctgcacgatcccgtagtacatgtggtaggtgttgttggggttc 60171
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 320 ggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttc 371 ||||| |||||||||||| ||| ||||||||||||| | ||||||||||||| Sbjct: 22464975 ggtgatgcgctgcacgatcccgtagtacatgtggtaggtgttgttggggttc 22464924
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 63.9 bits (32), Expect = 4e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 320 ggtgacgcgctgcacgatgccgcagtacatgtggtacgcgttgttggggttc 371 ||||| |||||||||||| ||| ||||||||||||| | ||||||||||||| Sbjct: 22458004 ggtgatgcgctgcacgatcccgtagtacatgtggtaggtgttgttggggttc 22457953
>gb|AC139348.4| Mus musculus BAC clone RP24-336F19 from chromosome 18, complete sequence Length = 145012 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttctc 157 ||||||||||||||||||||||| Sbjct: 49615 tcttcctcttccttcttcttctc 49637
>emb|AL358876.11| Human DNA sequence from clone RP11-431K24 on chromosome 1 Contains the 3' end of a novel gene (FLJ26758), a 52kDa eukaryotic translation initiation factor 2 subunit 3 gamma (EIF2S3) pseudogene and two novel genes, complete sequence Length = 171183 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttctc 157 ||||||||||||||||||||||| Sbjct: 42943 tcttcctcttccttcttcttctc 42921
>emb|AL139417.9| Human DNA sequence from clone RP1-59H12 on chromosome 1q21.1-21.3 Contains the SPRR2B gene for small proline-rich protein 2B, the SPRR2E gene for small proline-rich protein 2E and the SPRR2F gene for small proline-rich protein 2F, complete sequence Length = 51059 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttctc 157 ||||||||||||||||||||||| Sbjct: 26466 tcttcctcttccttcttcttctc 26444
>gb|AC157924.6| Mus musculus chromosome 1, clone RP23-18J18, complete sequence Length = 206156 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttctc 157 ||||||||||||||||||||||| Sbjct: 171103 tcttcctcttccttcttcttctc 171081
>gb|AC020552.4|AC020552 Homo sapiens BAC clone RP11-431K24 from 1, complete sequence Length = 178820 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttctc 157 ||||||||||||||||||||||| Sbjct: 42943 tcttcctcttccttcttcttctc 42921
>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence Length = 201694 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagatacag 87 |||||||||||||||||||||| Sbjct: 154760 catacatacatgatagatacag 154739
>ref|NM_101953.3| Arabidopsis thaliana binding AT1G21000 mRNA, complete cds Length = 1273 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 33 tcttcctcttccttcttcttct 54
>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete sequence Length = 186202 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 51512 tcttcctcttccttcttcttct 51491
>gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete sequence Length = 172362 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 75657 ccacctcgtcctcgtccatggc 75636 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 73011 ccacctcgtcctcgtccatggc 72990
>gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosome 16, complete sequence Length = 211870 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 4034 tcttcctcttccttcttcttct 4013
>gb|U23857.1|HPU23857 Cercopithecine herpesvirus 12 BRRF2-like protein gene, partial cds; EBNA1, BKRF2-like protein, and BKRF3-like protein genes, complete cds; and BKRF4-like protein gene, partial cds Length = 3222 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 163 cctcgtcctcgtccatggcctc 184 |||||||||||||||||||||| Sbjct: 430 cctcgtcctcgtccatggcctc 409
>gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, complete sequence Length = 188137 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagatacag 87 |||||||||||||||||||||| Sbjct: 13568 catacatacatgatagatacag 13547
>ref|XM_361423.1| Magnaporthe grisea 70-15 hypothetical protein (MG03897.4) partial mRNA Length = 2016 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 155 ctcggccacctcgtcctcgtcc 176 |||||||||||||||||||||| Sbjct: 1948 ctcggccacctcgtcctcgtcc 1927
>gb|AC147132.3| Mus musculus BAC clone RP24-189K3 from chromosome 7, complete sequence Length = 189225 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 62864 tcttcctcttccttcttcttct 62885
>gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome 3, complete sequence Length = 226878 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 104873 tcttcctcttccttcttcttct 104852
>gb|AC004895.2| Homo sapiens PAC clone RP4-810E6 from 7, complete sequence Length = 152927 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 104167 tcttcctcttccttcttcttct 104146
>gb|AC123847.4| Mus musculus BAC clone RP23-443O1 from chromosome 3, complete sequence Length = 189689 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 175772 tcttcctcttccttcttcttct 175751
>ref|XM_382636.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02460.1) partial mRNA Length = 3951 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 3857 tcttcctcttccttcttcttct 3836
>gb|AC125456.4| Mus musculus BAC clone RP24-193M20 from chromosome 18, complete sequence Length = 142347 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 38903 tcttcctcttccttcttcttct 38882
>gb|AC123041.2| Mus musculus BAC clone RP24-545E4 from 3, complete sequence Length = 191533 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 77658 tcttcctcttccttcttcttct 77637
>ref|XM_759541.1| Theileria parva strain Muguga hypothetical protein (TP02_0065) partial mRNA Length = 819 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttctc 157 |||||||||||||||||||||| Sbjct: 514 cttcctcttccttcttcttctc 493
>gb|AC147635.4| Mus musculus BAC clone RP23-290C4 from chromosome 3, complete sequence Length = 213637 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 49251 tcttcctcttccttcttcttct 49272
>gb|AC158960.4| Mus musculus chromosome 1, clone RP23-315O2, complete sequence Length = 176947 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 49047 tcttcctcttccttcttcttct 49068
>emb|AL008725.1|HS148E22 Human DNA sequence from clone RP1-148E22 on chromosome 20q12-13.12 Contains the YWHAB gene for tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta polypeptide, the 5' end of the C20orf119 gene for chromosome 20 open reading frame 119 and two CpG islands, complete sequence Length = 79227 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 11967 tcttcctcttccttcttcttct 11946
>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the 5' end of the Lpo gene for lactoperoxidase, a novel gene, the Epx gene for eosinophil peroxidase, the Olfr462, Olfr463 and Olfr464 genes for olfactory receptors 462, 463 and 464, a novel gene, a cytochrome c oxidase subunit VIc (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S. cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end of the gene for dynein light chain 2 (6720463E02Rik), complete sequence Length = 184069 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 87535 tcttcctcttccttcttcttct 87556
>emb|AL670999.4| Mouse DNA sequence from clone RP23-168F16 on chromosome 4 Contains the (pseudo)gene for a novel protein similar to high-mobility group box 1 (Hmgb1), complete sequence Length = 226259 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 150320 tcttcctcttccttcttcttct 150341
>emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on chromosome 11 Contains the gene for a novel protein (1700121K02Rik), the Hnrph1 gene for heterogeneous nuclear ribonucleoprotein H1, the Rufy1 gene for RUN and FYVE domain containing 1, a novel pseudogene and three CpG islands, complete sequence Length = 193696 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 154132 tcttcctcttccttcttcttct 154153
>emb|CR352264.6| Mouse DNA sequence from clone RP23-344N9 on chromosome 4 Contains a high mobility group box 1 (Hmgb1) pseudogene, complete sequence Length = 185595 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 109653 tcttcctcttccttcttcttct 109674
>gb|AC036196.10| Homo sapiens chromosome 15, clone RP11-599A21, complete sequence Length = 180366 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 119525 tcttcctcttccttcttcttct 119546
>ref|NM_170363.1| Drosophila melanogaster CG31054-PA (CG31054) mRNA, complete cds Length = 521 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 285 ccacctcgtcctcgtccatggc 264
>ref|NM_143348.2| Drosophila melanogaster CG4849-RA (CG4849), mRNA Length = 3130 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 285 ccacctcgtcctcgtccatggc 264
>gb|AY089551.1| Drosophila melanogaster LD28793 full insert cDNA Length = 3119 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 264 ccacctcgtcctcgtccatggc 243
>gb|AF375404.1| Arabidopsis thaliana At1g21000/F9H16_1 mRNA, complete cds Length = 1243 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 21 tcttcctcttccttcttcttct 42
>dbj|AK148644.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120429L09 product:hypothetical protein, full insert sequence Length = 2406 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 2389 tcttcctcttccttcttcttct 2368
>gb|AF428392.1|AF428392 Arabidopsis thaliana At1g21000/F9H16_1 mRNA, complete cds Length = 1240 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 17 tcttcctcttccttcttcttct 38
>gb|AY696588.1| Pagrus major clone cm001045 microsatellite sequence Length = 645 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 263 tcttcctcttccttcttcttct 284
>emb|BX816755.1|CNS0ABLT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH67ZA02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1468 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 26 tcttcctcttccttcttcttct 47
>emb|BX817483.1|CNS0AAIG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL26ZA07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1045 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 13 tcttcctcttccttcttcttct 34
>emb|BX841858.1|CNS09Y3A Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS91ZD07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 938 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 33 tcttcctcttccttcttcttct 54
>gb|AC123690.19| Mus musculus chromosome 1, clone RP23-322M7, complete sequence Length = 191990 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 186971 tcttcctcttccttcttcttct 186992
>gb|AY144884.1| Saccharomyces bayanus clone Contig2890 MNN4 gene, partial cds Length = 1130 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 790 tcttcctcttccttcttcttct 769
>gb|BT003756.1| Drosophila melanogaster RE71343 full insert cDNA Length = 3136 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 285 ccacctcgtcctcgtccatggc 264
>gb|AY084849.1| Arabidopsis thaliana clone 119384 mRNA, complete sequence Length = 1235 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 17 tcttcctcttccttcttcttct 38
>emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chromosome X, complete sequence Length = 205757 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 176304 tcttcctcttccttcttcttct 176325
>gb|AE003763.3| Drosophila melanogaster chromosome 3R, section 101 of 118 of the complete sequence Length = 206189 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 71433 ccacctcgtcctcgtccatggc 71412 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 160 ccacctcgtcctcgtccatggc 181 |||||||||||||||||||||| Sbjct: 68787 ccacctcgtcctcgtccatggc 68766
>gb|AC132113.3| Mus musculus BAC clone RP24-217M2 from chromosome 3, complete sequence Length = 177519 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 105674 tcttcctcttccttcttcttct 105695
>emb|AL928978.9| Mouse DNA sequence from clone RP23-95M7 on chromosome 2, complete sequence Length = 43342 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 38 tcttcctcttccttcttcttct 17
>emb|AL669965.13| Mouse DNA sequence from clone RP23-186F24 on chromosome 4, complete sequence Length = 181196 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 24446 tcttcctcttccttcttcttct 24425
>gb|AC132334.3| Mus musculus BAC clone RP24-228N8 from 6, complete sequence Length = 150109 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 119445 tcttcctcttccttcttcttct 119424
>gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, complete sequence Length = 215121 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 102187 tcttcctcttccttcttcttct 102208
>gb|AC149608.4| Mus musculus BAC clone RP23-436E6 from 8, complete sequence Length = 196473 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 117383 tcttcctcttccttcttcttct 117362
>gb|AC123548.4| Mus musculus BAC clone RP23-441J16 from 6, complete sequence Length = 178488 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 22726 tcttcctcttccttcttcttct 22705
>emb|AL954325.8| Mouse DNA sequence from clone RP23-416H10 on chromosome 2, complete sequence Length = 195457 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 193495 tcttcctcttccttcttcttct 193474
>emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chromosome 11, complete sequence Length = 205030 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 65 gcatacatacatgatagataca 86 |||||||||||||||||||||| Sbjct: 109943 gcatacatacatgatagataca 109922
>gb|AC007369.2| Arabidopsis thaliana chromosome I BAC F9H16 genomic sequence, complete sequence Length = 103192 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttct 156 |||||||||||||||||||||| Sbjct: 10089 tcttcctcttccttcttcttct 10068
>ref|NM_111326.1| Arabidopsis thaliana unknown protein AT3G04550 mRNA, complete cds Length = 1515 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 886 cttcctcttccttcttcttct 866
>ref|NM_111327.3| Arabidopsis thaliana unknown protein AT3G04560 mRNA, complete cds Length = 2212 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 2023 cttcctcttccttcttcttct 2043
>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence Length = 177167 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 135059 tcttcctcttccttcttcttc 135039
>ref|XM_466796.1| Oryza sativa (japonica cultivar-group), mRNA Length = 705 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 157 cggccacctcgtcctcgtcca 177 ||||||||||||||||||||| Sbjct: 532 cggccacctcgtcctcgtcca 512
>ref|XM_364518.1| Magnaporthe grisea 70-15 hypothetical protein (MG09408.4) partial mRNA Length = 1521 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttctt 154 ||||||||||||||||||||| Sbjct: 1260 gtcttcctcttccttcttctt 1240
>ref|XM_882213.1| PREDICTED: Bos taurus similar to Charged multivesicular body protein 4b (Chromatin modifying protein 4b) (CHMP4b), transcript variant 3 (LOC616164), mRNA Length = 1584 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttctt 154 ||||||||||||||||||||| Sbjct: 736 gtcttcctcttccttcttctt 716
>ref|XM_868997.1| PREDICTED: Bos taurus similar to Charged multivesicular body protein 4b (Chromatin modifying protein 4b) (CHMP4b), transcript variant 1 (LOC616164), mRNA Length = 1487 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttctt 154 ||||||||||||||||||||| Sbjct: 639 gtcttcctcttccttcttctt 619
>ref|XM_882188.1| PREDICTED: Bos taurus similar to Charged multivesicular body protein 4b (Chromatin modifying protein 4b) (CHMP4b), transcript variant 2 (LOC616164), mRNA Length = 1620 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttctt 154 ||||||||||||||||||||| Sbjct: 772 gtcttcctcttccttcttctt 752
>gb|AC096338.17| Rattus norvegicus X BAC CH230-95I19 (Children's Hospital Oakland Research Institute) complete sequence Length = 236662 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 46943 tcttcctcttccttcttcttc 46923
>gb|AC137150.11| Mus musculus chromosome 18, clone RP23-342A15, complete sequence Length = 213513 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 11459 tcttcctcttccttcttcttc 11479
>gb|AC135104.22| Mus musculus strain C57BL/6J clone rp23-206l6, complete sequence Length = 198294 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 172885 tcttcctcttccttcttcttc 172905
>gb|AC107837.11| Mus musculus chromosome 1, clone RP23-272H13, complete sequence Length = 189415 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 132508 tcttcctcttccttcttcttc 132528
>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequence Length = 95310 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 5160 cttcctcttccttcttcttct 5140
>gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, complete sequence Length = 206833 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 99867 tcttcctcttccttcttcttc 99887
>gb|AC098733.2| Mus musculus BAC clone RP23-103C10 from 19, complete sequence Length = 214382 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 catacatacatgatagataca 86 ||||||||||||||||||||| Sbjct: 46595 catacatacatgatagataca 46615
>gb|AC121932.2| Mus musculus BAC clone RP24-205N24 from 17, complete sequence Length = 152782 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 96938 tcttcctcttccttcttcttc 96958
>gb|AC115885.29| Mus musculus chromosome 3, clone RP24-396D16, complete sequence Length = 186636 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 154624 tcttcctcttccttcttcttc 154604
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3' end of the KCNN3 gene for potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, a novel gene and the 5' end of the ADAR gene for adenosine deaminase, RNA-specific, complete sequence Length = 173014 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 169486 tcttcctcttccttcttcttc 169466 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 169238 tcttcctcttccttcttcttc 169218
>emb|X95970.1|SLGROESEL S.lividans groES-groEL1 operon Length = 2440 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 125 ggcggccgtgtcttcctcttccttcttct 153 |||||||| ||||||||||||||||||| Sbjct: 2263 ggcggccggctcttcctcttccttcttct 2235
>emb|X75206.1|SCGROEL S.coelicolor groES and groEL1 genes for GroES and GroEL1 proteins Length = 3000 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 125 ggcggccgtgtcttcctcttccttcttct 153 |||||||| ||||||||||||||||||| Sbjct: 2761 ggcggccggctcttcctcttccttcttct 2733
>gb|AY063107.1| Arabidopsis thaliana unknown protein (At3g04550) mRNA, complete cds Length = 1381 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 847 cttcctcttccttcttcttct 827
>gb|AY034914.1| Arabidopsis thaliana unknown protein (At3g04550) mRNA, complete cds Length = 1532 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 886 cttcctcttccttcttcttct 866
>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29 Length = 292100 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 125 ggcggccgtgtcttcctcttccttcttct 153 |||||||| ||||||||||||||||||| Sbjct: 96824 ggcggccggctcttcctcttccttcttct 96796
>gb|AY114629.1| Arabidopsis thaliana unknown protein (At3g04550) mRNA, complete cds Length = 1403 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 847 cttcctcttccttcttcttct 827
>gb|AC147364.7| Medicago truncatula clone mth2-68g24, complete sequence Length = 109540 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 103087 cttcctcttccttcttcttct 103067
>ref|NM_079755.1| Drosophila melanogaster Organic cation transporter CG6331-RA (Orct), mRNA Length = 2534 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 1621 cttcttcttttcggccacctcgtcc 1597
>dbj|AK139485.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830098P14 product:Warning: possibly chimeric clone, full insert sequence Length = 4969 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 633 tcttcctcttccttcttcttc 653
>dbj|AK159063.1| Mus musculus visual cortex cDNA, RIKEN full-length enriched library, clone:K530047L18 product:unclassifiable, full insert sequence Length = 2525 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 2397 tcttcctcttccttcttcttc 2377
>gb|AY062440.1| Arabidopsis thaliana Unknown protein (At3g04550; F7O18.2) mRNA, complete cds Length = 1476 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 876 cttcctcttccttcttcttct 856
>gb|AY058437.1| Drosophila melanogaster GH21655 full length cDNA Length = 2564 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 1621 cttcttcttttcggccacctcgtcc 1597
>gb|AF336797.2|AF336797 Homo sapiens small-conductance calcium-activated potassium channel (KCNN3) gene, complete cds Length = 163217 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 115242 tcttcctcttccttcttcttc 115262 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 114876 tcttcctcttccttcttcttc 114896 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 114628 tcttcctcttccttcttcttc 114648
>dbj|AK044430.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library, clone:A930012L18 product:unclassifiable, full insert sequence Length = 2368 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 1090 tcttcctcttccttcttcttc 1110
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 157 cggccacctcgtcctcgtcca 177 ||||||||||||||||||||| Sbjct: 24720540 cggccacctcgtcctcgtcca 24720560
>gb|AC105384.3| Homo sapiens BAC clone RP11-89B16 from 4, complete sequence Length = 155324 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 132 gtgtcttcctcttccttcttcttct 156 ||||||||||||| ||||||||||| Sbjct: 98317 gtgtcttcctctttcttcttcttct 98293
>gb|AC108034.2| Homo sapiens BAC clone RP11-137J16 from 4, complete sequence Length = 164396 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagataca 86 ||||||||||||||||||||| Sbjct: 149258 catacatacatgatagataca 149238
>gb|AC008204.9|AC008204 Drosophila melanogaster, chromosome 3R, region 95E-95F, BAC clone BACR04E17, complete sequence Length = 199016 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 27336 cttcttcttttcggccacctcgtcc 27312
>gb|AC079378.2| Rattus norvegicus strain Brown Norway chromosome 4 clone RP31-7L11, complete sequence Length = 189137 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 catacatacatgatagataca 86 ||||||||||||||||||||| Sbjct: 188302 catacatacatgatagataca 188322
>ref|XM_341556.2| PREDICTED: Rattus norvegicus UPF2 regulator of nonsense transcripts homolog (yeast) (predicted) (Upf2_predicted), mRNA Length = 1977 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 725 tcttcctcttccttcttcttc 705
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 181 cctcgacgagcgcctcgagca 201 ||||||||||||||||||||| Sbjct: 4855473 cctcgacgagcgcctcgagca 4855493
>dbj|AP004059.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1372_D06 Length = 129242 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 157 cggccacctcgtcctcgtcca 177 ||||||||||||||||||||| Sbjct: 101938 cggccacctcgtcctcgtcca 101958
>dbj|AP004053.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1234_B11 Length = 128095 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 157 cggccacctcgtcctcgtcca 177 ||||||||||||||||||||| Sbjct: 20188 cggccacctcgtcctcgtcca 20208
>emb|AJ430047.1|MTR430047 Medicago truncatula mRNA for 1-deoxy-D-xylulose 5-phosphate synthase 1 (dxs1 gene) Length = 2302 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 75 cttcctcttccttcttcttct 95
>ref|XM_321355.2| Anopheles gambiae str. PEST ENSANGP00000008498 (ENSANGG00000006399), partial mRNA Length = 3952 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 155 ctcggccacctcgtcctcgtccatg 179 |||||||||||| |||||||||||| Sbjct: 420 ctcggccacctcatcctcgtccatg 444
>gb|AC124191.4| Mus musculus BAC clone RP23-275E4 from 18, complete sequence Length = 203003 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 49737 tcttcctcttccttcttcttc 49717
>gb|AC007773.1|AC007773 Homo sapiens chromosome 19, BAC 275282 (CIT-B-325L16), complete sequence Length = 180316 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 129084 tcttcctcttccttcttcttc 129064
>gb|AE003747.3| Drosophila melanogaster chromosome 3R, section 85 of 118 of the complete sequence Length = 206741 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 27592 cttcttcttttcggccacctcgtcc 27568
>emb|AJ870460.1| Saccharomyces cerevisiae 26S rRNA gene, isolate ABT507 Length = 1938 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ttcctcttccttcttcttctc 157 ||||||||||||||||||||| Sbjct: 641 ttcctcttccttcttcttctc 661
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome Length = 1551335 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttct 156 ||||||||||||||||||||| Sbjct: 1429744 cttcctcttccttcttcttct 1429724
>gb|AC122301.4| Mus musculus BAC clone RP23-276C6 from 10, complete sequence Length = 179801 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ttcctcttccttcttcttctc 157 ||||||||||||||||||||| Sbjct: 34538 ttcctcttccttcttcttctc 34558
>emb|CT010496.14| Mouse DNA sequence from clone RP23-193I7 on chromosome 17, complete sequence Length = 209258 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 112180 tcttcctcttccttcttcttc 112160
>emb|AL845518.6| Mouse DNA sequence from clone RP23-300M9 on chromosome 2, complete sequence Length = 118632 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagataca 86 ||||||||||||||||||||| Sbjct: 6063 catacatacatgatagataca 6043
>emb|AL591665.15| Mouse DNA sequence from clone RP23-333A18 on chromosome 2, complete sequence Length = 181419 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 catacatacatgatagataca 86 ||||||||||||||||||||| Sbjct: 139871 catacatacatgatagataca 139891
>emb|AL645740.6| Mouse DNA sequence from clone RP23-411H13 on chromosome 4, complete sequence Length = 172665 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 45804 tcttcctcttccttcttcttc 45824 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 45663 tcttcctcttccttcttcttc 45683
>emb|AL645471.8| Mouse DNA sequence from clone RP23-456M3 on chromosome 11, complete sequence Length = 178361 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttcttc 155 ||||||||||||||||||||| Sbjct: 144925 tcttcctcttccttcttcttc 144905
>emb|Y12400.1|DMORCT2 D.melanogaster mRNA for putative organic cation transporter, 2064 bp Length = 2064 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 1245 cttcttcttttcggccacctcgtcc 1221
>emb|Y12399.1|DMORCT1 D.melanogaster mRNA for putative organic cation transporter, 2458 bp Length = 2458 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 cttcttcttctcggccacctcgtcc 170 ||||||||| ||||||||||||||| Sbjct: 932 cttcttcttttcggccacctcgtcc 908
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 50864 ttcctcttccttcttcttct 50845
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 ttccttcttcttctcggcca 162 |||||||||||||||||||| Sbjct: 3989211 ttccttcttcttctcggcca 3989192
>ref|NM_122876.1| Arabidopsis thaliana nucleic acid binding AT5G34870 mRNA, complete cds Length = 1551 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 779 cttcctcttccttcttcttc 760
>ref|NM_117510.2| Arabidopsis thaliana ATP binding / microtubule motor AT4G14330 mRNA, complete cds Length = 2799 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 1319 cttcctcttccttcttcttc 1300
>ref|NM_117993.2| Arabidopsis thaliana MYB98; DNA binding / transcription factor AT4G18770 (MYB98) mRNA, complete cds Length = 2004 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 1171 tcctcttccttcttcttctc 1152
>ref|NM_106085.1| Arabidopsis thaliana heat shock protein binding / nucleic acid binding / unfolded protein binding / zinc ion binding AT1G74250 mRNA, complete cds Length = 1893 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 764 tcctcttccttcttcttctc 745
>gb|DQ198082.1| Arabidopsis thaliana myb family transcription factor (MYB98) mRNA, complete cds Length = 1284 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 1133 tcctcttccttcttcttctc 1114
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 cgtcctcgtccatggcctcgacga 189 |||| ||||||||||||||||||| Sbjct: 1055671 cgtcatcgtccatggcctcgacga 1055694
>gb|AC159412.1| Trypanosoma brucei chromosome 7 clone RPCI93-21H15, complete sequence Length = 159636 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttcttctc 157 |||||||| ||||||||||||||| Sbjct: 86330 gtcttcctattccttcttcttctc 86307
>gb|AC158121.12| Mus musculus chromosome 5, clone RP23-440H19, complete sequence Length = 202895 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 15233 tcctcttccttcttcttctc 15252
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 134 gtcttcctcttccttcttcttctc 157 |||||||| ||||||||||||||| Sbjct: 2020268 gtcttcctattccttcttcttctc 2020291
>gb|AC160471.10| Mus musculus chromosome 7, clone RP23-432D9, complete sequence Length = 222272 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 catacatacatgatagatac 85 |||||||||||||||||||| Sbjct: 117020 catacatacatgatagatac 117039
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cctcgacgagcgcctcgagc 200 |||||||||||||||||||| Sbjct: 2423184 cctcgacgagcgcctcgagc 2423203
>gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, complete sequence Length = 172490 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 48109 tcctcttccttcttcttctc 48090
>gb|AC119197.9| Mus musculus chromosome 8, clone RP24-180H20, complete sequence Length = 150207 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagatac 85 |||||||||||||||||||| Sbjct: 40430 catacatacatgatagatac 40411
>gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's Hospital Oakland Research Institute) complete sequence Length = 220401 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 100313 tcttcctcttccttcttctt 100294
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cctcgacgagcgcctcgagc 200 |||||||||||||||||||| Sbjct: 3638330 cctcgacgagcgcctcgagc 3638349
>gb|AC107763.25| Mus musculus chromosome 5, clone RP23-180F3, complete sequence Length = 219488 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 43446 tcctcttccttcttcttctc 43427
>gb|AC145557.3| Mus musculus BAC clone RP23-313I19 from chromosome 19, complete sequence Length = 226099 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 78471 tcttcctcttccttcttctt 78490
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 163 cctcgtcctcgtccatggcctcga 186 |||||||||||| ||||||||||| Sbjct: 1970782 cctcgtcctcgtgcatggcctcga 1970759
>gb|AC157583.9| Mus musculus chromosome 15, clone RP24-367L4, complete sequence Length = 185401 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 66 catacatacatgatagatacagga 89 ||||||||||||||||||| |||| Sbjct: 70043 catacatacatgatagatagagga 70020
>gb|AC148455.2| Xenopus tropicalis clone CH216-165I8, complete sequence Length = 170350 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 49380 tcctcttccttcttcttctc 49361
>gb|AC118639.12| Mus musculus chromosome 15, clone RP24-112I4, complete sequence Length = 166053 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 87837 tcctcttccttcttcttctc 87818
>gb|AC131756.3| Mus musculus BAC clone RP24-199J23 from chromosome 19, complete sequence Length = 175604 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 84823 tcttcctcttccttcttctt 84842
>gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, complete sequence Length = 245165 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 163569 tcctcttccttcttcttctc 163588
>gb|AC073089.5| Homo sapiens BAC clone RP11-324F21 from 7, complete sequence Length = 171788 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 17028 tcttcctcttccttcttctt 17047
>gb|AC132122.2| Mus musculus chromosome 7 clone RP24-78F23, complete sequence Length = 203549 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 139898 tcctcttccttcttcttctc 139879
>ref|XM_847128.1| PREDICTED: Canis familiaris similar to CG9047-PA, isoform A (LOC609791), mRNA Length = 654 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 50 tcttcctcttccttcttctt 31
>gb|AC117058.19| Rattus norvegicus 16 BAC CH230-318I9 (Children's Hospital Oakland Research Institute) complete sequence Length = 181157 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 7976 tcttcctcttccttcttctt 7995
>ref|XM_974268.1| PREDICTED: Mus musculus similar to Myosin light chain kinase 2, skeletal/cardiac muscle (MLCK2), transcript variant 1 (LOC669275), mRNA Length = 2935 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 869 cctcttccttcttcttctctgcca 846
>ref|XM_974312.1| PREDICTED: Mus musculus similar to Myosin light chain kinase 2, skeletal/cardiac muscle (MLCK2), transcript variant 2 (LOC669275), mRNA Length = 2949 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 869 cctcttccttcttcttctctgcca 846
>ref|XM_991707.1| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast) (Upf2), mRNA Length = 5173 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>ref|XM_976588.1| PREDICTED: Mus musculus chromatin modifying protein 4B (Chmp4b), mRNA Length = 1482 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 665 tcttcctcttccttcttctt 646
>ref|XM_905384.2| PREDICTED: Mus musculus myosin, light polypeptide kinase 2, skeletal muscle, transcript variant 1 (Mylk2), mRNA Length = 2931 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 869 cctcttccttcttcttctctgcca 846
>ref|XM_974580.1| PREDICTED: Mus musculus myosin, light polypeptide kinase 2, skeletal muscle, transcript variant 2 (Mylk2), mRNA Length = 2945 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 869 cctcttccttcttcttctctgcca 846
>ref|XM_001005681.1| PREDICTED: Mus musculus myosin, light polypeptide kinase 2, skeletal muscle (Mylk2), mRNA Length = 2934 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 869 cctcttccttcttcttctctgcca 846
>ref|XM_920690.2| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 7 (Upf2), mRNA Length = 4418 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>ref|XM_920705.2| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 9 (Upf2), mRNA Length = 5174 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>ref|XM_908046.2| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 6 (Upf2), mRNA Length = 5730 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 937 tcttcctcttccttcttctt 918
>ref|XM_898407.2| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 2 (Upf2), mRNA Length = 4418 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>ref|XM_140801.7| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 1 (Upf2), mRNA Length = 5174 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>ref|XM_898420.2| PREDICTED: Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), transcript variant 4 (Upf2), mRNA Length = 5730 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 937 tcttcctcttccttcttctt 918
>gb|BC059279.1| Mus musculus chromatin modifying protein 4B, mRNA (cDNA clone MGC:68279 IMAGE:4019739), complete cds Length = 1581 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 740 tcttcctcttccttcttctt 721
>gb|AC116326.5| Mus musculus BAC clone RP24-64C6 from chromosome 7, complete sequence Length = 181548 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 149526 tcttcctcttccttcttctt 149545
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 167469 ttcctcttccttcttcttct 167450
>gb|AC140193.3| Mus musculus BAC clone RP23-247C12 from chromosome 19, complete sequence Length = 173527 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 108 tcttcctcttccttcttctt 89
>ref|XM_542966.2| PREDICTED: Canis familiaris similar to Protein c20orf178 (LOC485842), mRNA Length = 1608 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 761 tcttcctcttccttcttctt 742
>ref|XM_752624.1| Ustilago maydis 521 hypothetical protein (UM01570.1) partial mRNA Length = 6954 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 tcggccacctcgtcctcgtc 175 |||||||||||||||||||| Sbjct: 512 tcggccacctcgtcctcgtc 493
>gb|AC146108.3| Pan troglodytes BAC clone RP43-22F10 from 7, complete sequence Length = 230349 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 6803 cttcctcttccttcttcttc 6822
>gb|AC146056.2| Pan troglodytes BAC clone RP43-89N11 from 7, complete sequence Length = 154447 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 50081 cttcctcttccttcttcttc 50100
>ref|XM_390705.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG10529.1) partial mRNA Length = 1482 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 1038 ttcctcttccttcttcttct 1019
>gb|AY288511.1| Euglena gracilis heat shock protein 90 mRNA, partial cds Length = 1915 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 1537 ttcctcttccttcttcttct 1518
>gb|AY288510.1| Euglena gracilis heat shock protein 90 mRNA, partial cds Length = 1915 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 1537 ttcctcttccttcttcttct 1518
>gb|AC111008.6| Mus musculus BAC clone RP23-415J21 from chromosome 7, complete sequence Length = 193593 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttct 153 |||||||||||||||||||| Sbjct: 57740 gtcttcctcttccttcttct 57721
>gb|AC125130.3| Mus musculus BAC clone RP24-309C7 from chromosome 14, complete sequence Length = 159361 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 115594 tcctcttccttcttcttctc 115613
>gb|AC124349.4| Mus musculus BAC clone RP24-463G19 from chromosome 12, complete sequence Length = 122944 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 40058 tcctcttccttcttcttctc 40077
>gb|AC125074.3| Mus musculus BAC clone RP23-464N18 from chromosome 14, complete sequence Length = 181200 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 180180 tcctcttccttcttcttctc 180161
>gb|AC124722.3| Mus musculus BAC clone RP23-389E7 from chromosome 6, complete sequence Length = 193830 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 30075 tcctcttccttcttcttctc 30094
>ref|XM_855970.1| PREDICTED: Canis familiaris similar to CpG binding protein (Protein containing PHD finger and CXXC domain 1) (CXXC finger protein 1), transcript variant 7 (LOC480217), mRNA Length = 1523 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 ctcttccttcttcttctcgg 159 |||||||||||||||||||| Sbjct: 1190 ctcttccttcttcttctcgg 1171
>ref|XM_537342.2| PREDICTED: Canis familiaris similar to CpG binding protein (Protein containing PHD finger and CXXC domain 1) (CXXC finger protein 1), transcript variant 1 (LOC480217), mRNA Length = 2442 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 ctcttccttcttcttctcgg 159 |||||||||||||||||||| Sbjct: 1214 ctcttccttcttcttctcgg 1195
>ref|XM_855914.1| PREDICTED: Canis familiaris similar to CpG binding protein (Protein containing PHD finger and CXXC domain 1) (CXXC finger protein 1), transcript variant 6 (LOC480217), mRNA Length = 2193 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 ctcttccttcttcttctcgg 159 |||||||||||||||||||| Sbjct: 965 ctcttccttcttcttctcgg 946
>ref|XM_855885.1| PREDICTED: Canis familiaris similar to CpG binding protein (Protein containing PHD finger and CXXC domain 1) (CXXC finger protein 1), transcript variant 5 (LOC480217), mRNA Length = 2307 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 ctcttccttcttcttctcgg 159 |||||||||||||||||||| Sbjct: 1097 ctcttccttcttcttctcgg 1078
>ref|XM_845095.1| PREDICTED: Canis familiaris similar to CpG binding protein (Protein containing PHD finger and CXXC domain 1) (CXXC finger protein 1), transcript variant 2 (LOC480217), mRNA Length = 2418 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 ctcttccttcttcttctcgg 159 |||||||||||||||||||| Sbjct: 1190 ctcttccttcttcttctcgg 1171
>gb|AC107753.10| Mus musculus chromosome 15, clone RP23-243P15, complete sequence Length = 173814 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 66 catacatacatgatagatacagga 89 ||||||||||||||||||| |||| Sbjct: 129714 catacatacatgatagatagagga 129691
>gb|AC147434.12| Medicago truncatula clone mth2-28h7, complete sequence Length = 127300 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 cgtgtcttcctcttccttct 150 |||||||||||||||||||| Sbjct: 89964 cgtgtcttcctcttccttct 89945
>gb|DQ446849.1| Arabidopsis thaliana clone pENTR221-At4g18770 myb family transcription factor (At4g18770) mRNA, complete cds Length = 1284 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 1133 tcctcttccttcttcttctc 1114
>emb|Z95332.1|HSCFAT5 Human DNA sequence from clone XX-CFAT5 on chromosome 11, complete sequence Length = 20874 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 296 gaacagcacccccaccttcc 315 |||||||||||||||||||| Sbjct: 11116 gaacagcacccccaccttcc 11135
>emb|AL683812.12| Human DNA sequence from clone RP5-1014E24 on chromosome 1, complete sequence Length = 40731 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 25648 tcctcttccttcttcttctc 25667
>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3' end of the IL3RA gene for interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174), the SLC25A6 gene for solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for acetylserotonin O-methyltransferase-like (ASMTLX), a novel gene (LOC286530), a novel gene (FLJ13330) and six CpG islands, complete sequence Length = 162377 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 atacatacatgatagataca 86 |||||||||||||||||||| Sbjct: 130566 atacatacatgatagataca 130547
>emb|AL590803.10| Human DNA sequence from clone RP11-114C3 on chromosome 13, complete sequence Length = 25375 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 6812 tcctcttccttcttcttctc 6831
>emb|AL450472.14| Human DNA sequence from clone RP11-265D19 on chromosome X Contains the 5' end of the ZNF75 gene for zinc finger protein 75 (D8C6), gene FLJ23614, two novel genes, the 5' end of a novel gene, a novel pseudogene and four CpG islands, complete sequence Length = 177877 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 91947 cttcctcttccttcttcttc 91966
>emb|AL450326.30| Human DNA sequence from clone RP11-517P14 on chromosome 10 Contains the 5' end of the HNRPF gene for heterogeneous nuclear ribonucleoprotein F, part of a novel gene, the ZNF239 gene for zinc finger protein 239 (MOK2, HOK-2), two sinc finger protein pseudogenes and seven CpG islands, complete sequence Length = 197786 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 135338 cttcctcttccttcttcttc 135357
>emb|AL360172.17| Human DNA sequence from clone RP11-402D22 on chromosome 10 Contains the 5' end of the variant of a novel gene, complete sequence Length = 188937 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 165648 tcctcttccttcttcttctc 165629
>emb|AL139380.6| Human DNA sequence from clone RP11-463M3 on chromosome 13 Contains the 5' end of a novel gene, a G protein-coupled receptor kinase 6 (GPRK6)(GRK6) pseudogene and two CpG islands, complete sequence Length = 45797 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 34986 tcctcttccttcttcttctc 35005
>emb|AL096763.14|HSJ1129A6 Human DNA sequence from clone RP5-1129A6 on chromosome Xp22.11-22.2 Contains the 3'end of the SCML2 gene for sex comb on midleg-like 2 (Drosophila), a novel protein (MGC33653) and one CpG island, complete sequence Length = 109018 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 77 gatagatacaggaacaggaagacg 100 ||||||||||||||||| |||||| Sbjct: 92493 gatagatacaggaacagaaagacg 92516
>emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 1 Length = 206606 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 3869 cttcctcttccttcttcttc 3850
>gb|BC049622.1| Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast), mRNA (cDNA clone IMAGE:6531961), partial cds Length = 663 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 381 tcttcctcttccttcttctt 362
>gb|AC163018.3| Mus musculus chromosome 15, clone RP24-366J14, complete sequence Length = 175394 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 66 catacatacatgatagatacagga 89 ||||||||||||||||||| |||| Sbjct: 143997 catacatacatgatagatagagga 143974
>gb|AC106606.5| Rattus norvegicus 1 BAC CH230-148J18 (Children's Hospital Oakland Research Institute) complete sequence Length = 227298 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 44166 tcttcctcttccttcttctt 44185
>emb|AL596025.22| Mouse DNA sequence from clone RP23-215H18 on chromosome 11 Contains a novel gene and the 3' end of a gene that is a possible ortholog of human dynein axonemal heavy polypeptide 9 (DNAH9), complete sequence Length = 190066 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 95786 cttcctcttccttcttcttc 95805
>emb|BX640447.1| Bordetella bronchiseptica strain RB50, complete genome; segment 11/16 Length = 349442 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 acctcgtcctcgtccatggc 181 |||||||||||||||||||| Sbjct: 32442 acctcgtcctcgtccatggc 32461
>emb|BX640428.1| Bordetella parapertussis strain 12822, complete genome; segment 6/14 Length = 348525 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 acctcgtcctcgtccatggc 181 |||||||||||||||||||| Sbjct: 202881 acctcgtcctcgtccatggc 202862
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12 Length = 343243 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 acctcgtcctcgtccatggc 181 |||||||||||||||||||| Sbjct: 228615 acctcgtcctcgtccatggc 228596
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cctcgacgagcgcctcgagc 200 |||||||||||||||||||| Sbjct: 3381038 cctcgacgagcgcctcgagc 3381057
>gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosome 7, complete sequence Length = 213870 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 134 gtcttcctcttccttcttct 153 |||||||||||||||||||| Sbjct: 114599 gtcttcctcttccttcttct 114580
>emb|AL606829.13| Mouse DNA sequence from clone RP23-10M12 on chromosome 11 Contains a novel gene (MOR280-1) similar to the olfactory receptor family, a novel gene (D330012D11Rik), the Zfp62 gene for zinc finger protein 62, the Mgat1 gene for mannoside acetylglucosaminyltransferase 1, a novel gene (MOR256-24) similar to the olfactory receptor family, a novel gene (MOR256-25) similar to the olfactory receptor family, a novel gene (LOC216715) similar to the olfactory receptor MOR256 family, a novel gene (MOR256-27) similar to the olfactory receptor family, a novel gene (MOR256-2) similar to the olfactory receptor family and three CpG islands, complete sequence Length = 203286 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 178703 tcctcttccttcttcttctc 178722
>emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 67 Length = 200001 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 82941 tcttcctcttccttcttctt 82922
>emb|AL161549.2|ATCHRIV49 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 49 Length = 199075 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 90545 tcctcttccttcttcttctc 90526
>emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 38 Length = 198944 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 143309 cttcctcttccttcttcttc 143290
>emb|AL035602.1|ATT29A15 Arabidopsis thaliana DNA chromosome 4, BAC clone T29A15 (ESSA project) Length = 95679 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 22231 tcttcctcttccttcttctt 22212
>emb|AL035526.1|ATF28A21 Arabidopsis thaliana DNA chromosome 4, BAC clone F28A21 (ESSA project) Length = 94301 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 71264 tcctcttccttcttcttctc 71245
>emb|AJ293946.1|BLA293946 Bifidobacterium lactis guaA gene (partial), xfp gene and pta gene (partial) Length = 4123 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 241 ggccctcgagctcgtcgacgccga 264 ||||||||||||| |||||||||| Sbjct: 3235 ggccctcgagctcatcgacgccga 3258
>emb|AL645582.22| Mouse DNA sequence from clone RP23-302J15 on chromosome 11 Contains two CpG islands, complete sequence Length = 135978 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 catacatacatgatagatac 85 |||||||||||||||||||| Sbjct: 8243 catacatacatgatagatac 8262
>gb|AC106857.8| Homo sapiens chromosome 8, clone RP11-262O21, complete sequence Length = 159454 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 38316 tcttcctcttccttcttctt 38297
>emb|AJ421478.1| Mus musculus X-inactivation center region; segment 1/3 Length = 247850 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 atacatacatgatagataca 86 |||||||||||||||||||| Sbjct: 53317 atacatacatgatagataca 53336
>gb|AC022666.14| Homo sapiens, clone RP11-30K7, complete sequence Length = 150721 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 106748 tcttcctcttccttcttctt 106767
>gb|AC091834.2| Homo sapiens chromosome 5 clone CTD-2054H24, complete sequence Length = 120472 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 16220 cttcctcttccttcttcttc 16239
>gb|AC090648.5| Genomic sequence for Mus musculus, clone RP23-331I23, complete sequence Length = 198695 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 164703 tcctcttccttcttcttctc 164684
>gb|AF312994.1|AF312994 Mus musculus chromosome 1 clone MML, complete sequence Length = 228283 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 136585 tcctcttccttcttcttctc 136566
>dbj|AK159193.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420007P03 product:weakly similar to Human full-length cDNA clone CS0DL001YE08 of B cells (Ramos cell line) of Homo sapiens (Human) [Homo sapiens], full insert sequence Length = 1568 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 750 tcttcctcttccttcttctt 731
>dbj|AK164550.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330038I01 product:weakly similar to Human full-length cDNA clone CS0DL001YE08 of B cells (Ramos cell line) of Homo sapiens (Human) [Homo sapiens], full insert sequence Length = 1493 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 677 tcttcctcttccttcttctt 658
>gb|AF320249.1|AF320249 Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2) gene, complete cds Length = 3225 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 1652 cttcctcttccttcttcttc 1633
>gb|AF320248.1|AF320248 Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2) mRNA, complete cds Length = 2801 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 1296 cttcctcttccttcttcttc 1277
>dbj|AK156473.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830023C17 product:weakly similar to Human full-length cDNA clone CS0DL001YE08 of B cells (Ramos cell line) of Homo sapiens (Human) [Homo sapiens], full insert sequence Length = 1569 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 748 tcttcctcttccttcttctt 729
>gb|AC090649.4| Genomic sequence for Mus musculus, clone RP23-361O12, complete sequence Length = 211611 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 174662 tcctcttccttcttcttctc 174681
>gb|AC151535.2| Mus musculus BAC clone RP23-213M8 from chromosome 7, complete sequence Length = 216527 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 57812 tcctcttccttcttcttctc 57831
>gb|AC155321.2| Pan troglodytes BAC clone CH251-489N11 from chromosome unknown, complete sequence Length = 202104 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 140090 tcctcttccttcttcttctc 140071
>dbj|AK017045.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4933433M02 product:RAD54 like (S. cerevisiae), full insert sequence Length = 1520 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 1378 tcttcctcttccttcttctt 1397
>gb|AF176003.2|AF176003 Arabidopsis thaliana putative transcription factor (MYB98) mRNA, complete cds Length = 1484 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 1195 tcctcttccttcttcttctc 1176
>gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete sequence Length = 201299 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 125797 tcttcctcttccttcttctt 125816
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 ttccttcttcttctcggcca 162 |||||||||||||||||||| Sbjct: 207699 ttccttcttcttctcggcca 207718
>gb|AC151837.4| Mus musculus BAC clone RP23-330A14 from chromosome 7, complete sequence Length = 209661 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 199100 tcttcctcttccttcttctt 199119
>gb|AC139332.5| Mus musculus BAC clone RP24-113C21 from chromosome 5, complete sequence Length = 143802 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 43638 tcttcctcttccttcttctt 43619
>gb|AC159251.2| Mus musculus BAC clone RP24-113B8 from chromosome 12, complete sequence Length = 200896 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 146865 tcctcttccttcttcttctc 146884
>gb|AC119193.9| Mus musculus chromosome 7, clone RP24-178L6, complete sequence Length = 162310 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catacatacatgatagatac 85 |||||||||||||||||||| Sbjct: 155492 catacatacatgatagatac 155473
>dbj|AK079396.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830004H17 product:myosin-light-chain kinase (EC 2.7.1.117), skeletal muscle homolog [Rattus norvegicus], full insert sequence Length = 2950 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 139 cctcttccttcttcttctcggcca 162 ||||||||||||||||||| |||| Sbjct: 874 cctcttccttcttcttctctgcca 851
>gb|AC091866.2|AC091866 Homo sapiens chromosome 5 clone CTD-2360G24, complete sequence Length = 119903 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 136 cttcctcttccttcttcttc 155 |||||||||||||||||||| Sbjct: 69055 cttcctcttccttcttcttc 69074
>dbj|AK008205.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010012F05 product:weakly similar to CDA04 [Homo sapiens], full insert sequence Length = 1053 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 753 tcttcctcttccttcttctt 734
>gb|DQ061984.1| Burkholderia mallei strain ATCC 23344 DnaK (dnaK) gene, complete cds Length = 1953 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cctcgacgagcgcctcgagc 200 |||||||||||||||||||| Sbjct: 934 cctcgacgagcgcctcgagc 915
>gb|AC158658.4| Mus musculus 6 BAC RP23-400L4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 197909 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 118015 tcctcttccttcttcttctc 117996
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 caactacgcatacatacatg 77 |||||||||||||||||||| Sbjct: 25688640 caactacgcatacatacatg 25688659
>gb|AY518213.1| Bifidobacterium animalis xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (xfp) gene, complete cds Length = 2841 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 241 ggccctcgagctcgtcgacgccga 264 ||||||||||||| |||||||||| Sbjct: 2599 ggccctcgagctcatcgacgccga 2622
>gb|BC011429.1| Mus musculus chromatin modifying protein 4B, mRNA (cDNA clone MGC:19416 IMAGE:3485793), complete cds Length = 1080 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 765 tcttcctcttccttcttctt 746
>gb|BC006905.1| Mus musculus chromatin modifying protein 4B, mRNA (cDNA clone MGC:11948 IMAGE:3600183), complete cds Length = 841 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 504 tcttcctcttccttcttctt 485
>gb|AC020579.5|AC020579 Arabidopsis thaliana chromosome 1 BAC F1O17 genomic sequence, complete sequence Length = 50821 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 tcctcttccttcttcttctc 157 |||||||||||||||||||| Sbjct: 31864 tcctcttccttcttcttctc 31883
>gb|U07000.1|HSU07000 Human breakpoint cluster region (BCR) gene, complete cds Length = 152141 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 tgtcttcctcttccttcttcttct 156 |||||||||| ||||||||||||| Sbjct: 47951 tgtcttcctcctccttcttcttct 47928
>gb|AC139426.2| Homo sapiens chromosome 15, clone RP13-395E19, complete sequence Length = 188448 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ttcctcttccttcttcttct 156 |||||||||||||||||||| Sbjct: 82348 ttcctcttccttcttcttct 82329
>gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete sequence Length = 157176 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 47042 tcttcctcttccttcttctt 47023
>ref|NM_029362.2| Mus musculus chromatin modifying protein 4B (Chmp4b), mRNA Length = 1581 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 740 tcttcctcttccttcttctt 721
>ref|XM_574895.1| PREDICTED: Rattus norvegicus similar to High mobility group protein 1 (HMG-1) (Amphoterin) (Heparin-binding protein p30) (LOC499571), mRNA Length = 1192 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 tgtcttcctcttccttcttcttct 156 ||||||||||||||||||| |||| Sbjct: 689 tgtcttcctcttccttctttttct 666
>gb|AC079248.5| Homo sapiens BAC clone RP11-24J11 from 2, complete sequence Length = 128535 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 tcttcctcttccttcttctt 154 |||||||||||||||||||| Sbjct: 35589 tcttcctcttccttcttctt 35570 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,756,602 Number of Sequences: 3902068 Number of extensions: 4756602 Number of successful extensions: 134996 Number of sequences better than 10.0: 295 Number of HSP's better than 10.0 without gapping: 296 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 133035 Number of HSP's gapped (non-prelim): 1961 length of query: 419 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 397 effective length of database: 17,147,199,772 effective search space: 6807438309484 effective search space used: 6807438309484 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)