ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd23a02 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full insert sequence Length = 1067 Score = 212 bits (107), Expect = 8e-52 Identities = 153/169 (90%) Strand = Plus / Minus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 837 gctcagttgctggggctgctccggaaggagcccagcgccttgatggctgccgcccggagg 778 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 777 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 718 Query: 436 cagtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 717 cagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669
>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full insert sequence Length = 1308 Score = 204 bits (103), Expect = 2e-49 Identities = 152/169 (89%) Strand = Plus / Minus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| || |||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 950 gctcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggagg 891 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 890 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 831 Query: 436 cagtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 830 cagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782
>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full insert sequence Length = 1309 Score = 204 bits (103), Expect = 2e-49 Identities = 152/169 (89%) Strand = Plus / Minus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| || |||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 944 gctcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggagg 885 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 884 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 825 Query: 436 cagtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 824 cagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776
>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full insert sequence Length = 1296 Score = 204 bits (103), Expect = 2e-49 Identities = 152/169 (89%) Strand = Plus / Minus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| || |||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 938 gctcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggagg 879 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 878 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 819 Query: 436 cagtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 818 cagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770
>ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 200 bits (101), Expect = 3e-48 Identities = 150/167 (89%) Strand = Plus / Minus Query: 318 tcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggaggat 377 ||||||||| || |||||||||||||||| |||||||||||||| |||||||||||||| Sbjct: 849 tcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggaggat 790 Query: 378 gtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatcca 437 ||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||||| Sbjct: 789 gtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatcca 730 Query: 438 gtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 729 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683
>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06, complete sequence Length = 127420 Score = 157 bits (79), Expect = 4e-35 Identities = 111/122 (90%) Strand = Plus / Plus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| || |||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 90998 gctcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggagg 91057 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 91058 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 91117 Query: 436 ca 437 || Sbjct: 91118 ca 91119 Score = 48.1 bits (24), Expect = 0.027 Identities = 41/47 (87%) Strand = Plus / Plus Query: 438 gtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 91203 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 91249
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 157 bits (79), Expect = 4e-35 Identities = 111/122 (90%) Strand = Plus / Plus Query: 316 gctcagttgctccggctgctccggaaggagccgagcgccttgatggccgccgcccggagg 375 ||||||||||| || |||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 8906689 gctcagttgctggggttgctccggaaggagcccagcgccttgatggctgccgcccggagg 8906748 Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 ||||||||||| ||||||||||||||||||||||||| |||||| || |||| |||||| Sbjct: 8906749 atgtactggtgatacgccgccgccgccagcgctccgatgaacggccccgcccagaagatc 8906808 Query: 436 ca 437 || Sbjct: 8906809 ca 8906810 Score = 48.1 bits (24), Expect = 0.027 Identities = 41/47 (87%) Strand = Plus / Plus Query: 438 gtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 ||||| ||||||||| ||||| |||||||||||| |||||||||| Sbjct: 8906894 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 8906940
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 87.7 bits (44), Expect = 3e-14 Identities = 99/115 (86%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| ||||||||||| | ||||||||||||||||||||||| Sbjct: 962 tgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggtggtaga 903 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 902 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849
>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete cds Length = 1268 Score = 83.8 bits (42), Expect = 5e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 990 tgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggtggta 933
>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete cds Length = 1171 Score = 83.8 bits (42), Expect = 5e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| |||||||||||| | ||||||||||||||||||||||| Sbjct: 937 tgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggtggta 880 Score = 50.1 bits (25), Expect = 0.007 Identities = 59/71 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| ||||||||||||| |||||| | | ||||||||||||||| ||| Sbjct: 851 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 792 Query: 478 gcgccgaggct 488 ||||| ||||| Sbjct: 791 gcgcccaggct 781
>gb|AY109332.1| Zea mays CL502_5 mRNA sequence Length = 1969 Score = 83.8 bits (42), Expect = 5e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 1640 tgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggtggta 1583 Score = 48.1 bits (24), Expect = 0.027 Identities = 52/62 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| |||||||| |||| |||||| || | ||||||||||||||||||| Sbjct: 281 gggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcg 222 Query: 478 gc 479 || Sbjct: 221 gc 220
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 972 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 913 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 912 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 974 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 915 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 914 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 975 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 916 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 915 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| |||||||||| | ||||||||||||||||||||||| Sbjct: 538 tgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggtggtaga 479 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 478 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 972 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 913 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 912 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 566 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 507 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 506 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 972 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 913 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 912 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 79.8 bits (40), Expect = 8e-12 Identities = 98/115 (85%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 975 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 916 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 915 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence Length = 1348 Score = 75.8 bits (38), Expect = 1e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| ||||||||||| | ||||||||||||||||||||||| Sbjct: 918 tgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggtggta 861 Score = 50.1 bits (25), Expect = 0.007 Identities = 59/71 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| ||||||||||||| |||||| | | ||||||||||||||| ||| Sbjct: 832 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 773 Query: 478 gcgccgaggct 488 ||||| ||||| Sbjct: 772 gcgcccaggct 762
>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds Length = 1133 Score = 75.8 bits (38), Expect = 1e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| ||||||||||| | ||||||||||||||||||||||| Sbjct: 866 tgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggtggta 809 Score = 50.1 bits (25), Expect = 0.007 Identities = 59/71 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| ||||||||||||| |||||| | | ||||||||||||||| ||| Sbjct: 780 gggcccacccagaagatccagtggtcgtcccagggcttgtccttgttgtagatgacggcg 721 Query: 478 gcgccgaggct 488 ||||| ||||| Sbjct: 720 gcgcccaggct 710
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 71.9 bits (36), Expect = 2e-09 Identities = 91/107 (85%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 15355846 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 15355787 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatcca 437 ||||| || || || |||||||||||||||||||| |||||||| Sbjct: 15355786 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatcca 15355741 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggct 15324208 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||| ||||| |||||||||||||| Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggct 15316328 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 17089609 ctggtggtacgccgccgccg 17089590 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 17084110 ctggtggtacgccgccgccg 17084091
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 71.9 bits (36), Expect = 2e-09 Identities = 91/107 (85%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| |||||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 62845 tgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 62786 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatcca 437 ||||| || || || |||||||||||||||||||| |||||||| Sbjct: 62785 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatcca 62740 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 31235 ttgttgtagacgacggcggcgccgaggct 31207 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||| ||||| |||||||||||||| Sbjct: 23355 ttgttgtacatgacggcggcgccgaggct 23327
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 71.9 bits (36), Expect = 2e-09 Identities = 97/115 (84%), Gaps = 2/115 (1%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggtacg 391 |||||| || ||||||||| || |||||||| | ||||||||||||||||||||||| Sbjct: 974 tgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggtggtaga 915 Query: 392 ccgccgccgccagc-gctccgacgaacgggccgacccanaagatccagtggttgt 445 ||||| || || || |||||||||||||||||||| |||||||| ||||||| Sbjct: 914 acgccg-cgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds Length = 1285 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/78 (85%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtag 468 |||| |||||| || ||||| ||||||||||||| |||||| || ||||||||||||| Sbjct: 889 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 830 Query: 469 atgaccgcggcgccgagg 486 |||| |||||||||||| Sbjct: 829 atgatggcggcgccgagg 812
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds Length = 1248 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/78 (85%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtag 468 |||| |||||| || ||||| ||||||||||||| |||||| || ||||||||||||| Sbjct: 874 ccgatgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 815 Query: 469 atgaccgcggcgccgagg 486 |||| |||||||||||| Sbjct: 814 atgatggcggcgccgagg 797
>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1283 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 332 tgctccggaaggagccgagcgccttgatggccgccgcccggaggatgtactggtggta 389 |||||| |||||||||||| ||||||||||| | |||| |||||||||||||||||| Sbjct: 939 tgctcctgaaggagccgagggccttgatggcgccggccctgaggatgtactggtggta 882
>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1 (PIP1-1) mRNA, complete cds Length = 1115 Score = 54.0 bits (27), Expect = 4e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 424 acccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 ||||| ||||||||||||| |||||||||| | |||||||||||||| Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatga 762
>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds Length = 1325 Score = 52.0 bits (26), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 405 cgctccgacgaacgggccgacccanaagatccagtgg 441 ||||||| |||||||||| ||||| |||||||||||| Sbjct: 1023 cgctccggcgaacgggcccacccagaagatccagtgg 987
>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete cds Length = 1171 Score = 50.1 bits (25), Expect = 0.007 Identities = 59/71 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| |||||||| |||| |||||| || | ||||||||||||||||||| Sbjct: 863 gggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcg 804 Query: 478 gcgccgaggct 488 || || ||||| Sbjct: 803 gctcccaggct 793
>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete cds Length = 1156 Score = 48.1 bits (24), Expect = 0.027 Identities = 52/62 (83%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcg 477 ||||| ||||| |||||||| |||| |||||| || | ||||||||||||||||||| Sbjct: 853 gggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcg 794 Query: 478 gc 479 || Sbjct: 793 gc 792
>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence Length = 698 Score = 46.1 bits (23), Expect = 0.11 Identities = 31/34 (91%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggt 442 |||| ||| ||||||||||| ||||||||||||| Sbjct: 369 ccgatgaaggggccgacccagaagatccagtggt 336
>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete cds Length = 1086 Score = 46.1 bits (23), Expect = 0.11 Identities = 31/34 (91%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggt 442 |||| ||| ||||||||||| ||||||||||||| Sbjct: 800 ccgatgaaggggccgacccagaagatccagtggt 767
>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein Length = 1169 Score = 46.1 bits (23), Expect = 0.11 Identities = 31/34 (91%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggt 442 |||| ||| ||||||||||| ||||||||||||| Sbjct: 857 ccgatgaaggggccgacccagaagatccagtggt 824
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein Length = 1225 Score = 46.1 bits (23), Expect = 0.11 Identities = 31/34 (91%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggt 442 |||| ||| ||||||||||| ||||||||||||| Sbjct: 870 ccgatgaaggggccgacccagaagatccagtggt 837
>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2 (PIP2-2) mRNA, complete cds Length = 1171 Score = 46.1 bits (23), Expect = 0.11 Identities = 87/109 (79%) Strand = Plus / Minus Query: 376 atgtactggtggtacgccgccgccgccagcgctccgacgaacgggccgacccanaagatc 435 |||||||||||||| || || || || || ||||| || || || |||||||| |||||| Sbjct: 832 atgtactggtggtatgctgctgcagctagtgctcccacaaatggtccgacccagaagatc 773 Query: 436 cagtggttgtcccatgcggncttcttgttgtagatgaccgcggcgccga 484 || |||| |||||| | | |||||||||||||| |||||||||| Sbjct: 772 cactggtcgtcccaaactttttcattgttgtagatgacggcggcgccga 724
>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA, complete cds Length = 1251 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857
>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA Length = 823 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 672 gctccgatgaacggccccacccagaagatccagtggt 636
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 677 ccgacgaaggggccgagccagtagacccagtggttgtccca 637
>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence Length = 1215 Score = 44.1 bits (22), Expect = 0.42 Identities = 47/56 (83%) Strand = Plus / Minus Query: 424 acccanaagatccagtggttgtcccatgcggncttcttgttgtagatgaccgcggc 479 ||||| |||||||| |||| |||||| || | ||||||||||||||||||||| Sbjct: 865 acccagaagatccattggtcgtcccaggccttgtccttgttgtagatgaccgcggc 810
>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete cds Length = 2695 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 707 gctccgatgaacggccccacccagaagatccagtggt 671
>ref|XM_844281.1| PREDICTED: Canis familiaris similar to cytochrome P450, family 26, subfamily A, polypeptide 1 isoform 2, transcript variant 2 (LOC486804), mRNA Length = 1583 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 391 gccgccgccgccagcgctccga 412 |||||||||||||||||||||| Sbjct: 62 gccgccgccgccagcgctccga 41
>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 Length = 1204 Score = 44.1 bits (22), Expect = 0.42 Identities = 27/29 (93%) Strand = Plus / Minus Query: 424 acccanaagatccagtggttgtcccatgc 452 ||||| ||||||||||||| ||||||||| Sbjct: 854 acccaaaagatccagtggtcgtcccatgc 826
>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c Length = 986 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 763
>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B Length = 1057 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene) Length = 1364 Score = 44.1 bits (22), Expect = 0.42 Identities = 39/45 (86%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtcccatgcg 453 |||| ||| ||||| ||||| ||||||||||||| || ||||||| Sbjct: 881 ccgatgaaggggccaacccagaagatccagtggtcgttccatgcg 837
>gb|AC025571.20| Homo sapiens 3 BAC RP11-515C21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159902 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 161 actcacatgcatgcacagacac 182 |||||||||||||||||||||| Sbjct: 66966 actcacatgcatgcacagacac 66987
>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA Length = 2703 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 681 gctccgatgaacggccccacccagaagatccagtggt 645
>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds Length = 823 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 672 gctccgatgaacggccccacccagaagatccagtggt 636
>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (F22L4.16) mRNA, complete cds Length = 1031 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785
>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557), complete cds Length = 2703 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 681 gctccgatgaacggccccacccagaagatccagtggt 645
>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium, mRNA, 1211 nt, segment 1 of 2] Length = 1211 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 697 gctccgatgaacggccccacccagaagatccagtggt 661
>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane intrinsic protein 1c (At1g01620) mRNA, complete cds Length = 861 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Plus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 43108750 ccgacgaaggggccgagccagtagacccagtggttgtccca 43108790 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 20882888 ggtggtacgccgccgccgcc 20882869 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 20873565 ggtggtacgccgccgccgcc 20873546
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete cds Length = 1338 Score = 44.1 bits (22), Expect = 0.42 Identities = 39/45 (86%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtcccatgcg 453 |||| ||| ||||| ||||| ||||||||||||| || ||||||| Sbjct: 872 ccgatgaaggggccaacccagaagatccagtggtcgttccatgcg 828
>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 963 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Plus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 105779 ccgacgaaggggccgagccagtagacccagtggttgtccca 105819
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 701 ccgacgaaggggccgagccagtagacccagtggttgtccca 661
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 750 ccgacgaaggggccgagccagtagacccagtggttgtccca 710
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 44.1 bits (22), Expect = 0.42 Identities = 36/41 (87%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtccca 449 |||||||| ||||||| ||| ||| ||||||||||||||| Sbjct: 687 ccgacgaaggggccgagccagtagacccagtggttgtccca 647
>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C (transmembrane protein B) (At1g01620) mRNA, complete cds Length = 903 Score = 44.1 bits (22), Expect = 0.42 Identities = 44/52 (84%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||||| || |||||||||| |||||| ||| | |||||||||||||| Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence Length = 791 Score = 44.1 bits (22), Expect = 0.42 Identities = 39/45 (86%) Strand = Plus / Minus Query: 409 ccgacgaacgggccgacccanaagatccagtggttgtcccatgcg 453 |||| ||| ||||| ||||| ||||||||||||| || ||||||| Sbjct: 305 ccgatgaaggggccaacccagaagatccagtggtcgttccatgcg 261
>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds Length = 826 Score = 44.1 bits (22), Expect = 0.42 Identities = 33/37 (89%) Strand = Plus / Minus Query: 406 gctccgacgaacgggccgacccanaagatccagtggt 442 ||||||| |||||| || ||||| ||||||||||||| Sbjct: 675 gctccgatgaacggccccacccagaagatccagtggt 639
>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds Length = 1158 Score = 44.1 bits (22), Expect = 0.42 Identities = 27/29 (93%) Strand = Plus / Minus Query: 424 acccanaagatccagtggttgtcccatgc 452 ||||| ||||||||||||| ||||||||| Sbjct: 854 acccaaaagatccagtggtcgtcccatgc 826
>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds Length = 1116 Score = 44.1 bits (22), Expect = 0.42 Identities = 27/29 (93%) Strand = Plus / Minus Query: 424 acccanaagatccagtggttgtcccatgc 452 ||||| ||||||||||||| ||||||||| Sbjct: 847 acccaaaagatccagtggtcgtcccatgc 819
>ref|XM_550578.1| Oryza sativa (japonica cultivar-group), mRNA Length = 882 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 378 gtactggtggtacgccgccgccgcc 402 ||||||| ||||||||||||||||| Sbjct: 12 gtactggaggtacgccgccgccgcc 36
>ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 719 ttgttgtagacgacggcggcgccgaggct 691
>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA Length = 619 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 277 ttgttgtagacgacggcggcgccgaggct 249
>ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein, 28kDa) (aqp1), mRNA Length = 950 Score = 42.1 bits (21), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttg 444 |||||||| ||||||||||||||| Sbjct: 692 ccgacccaaaagatccagtggttg 669
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 390 cgccgccgccgccagcgctcc 410 ||||||||||||||||||||| Sbjct: 1747487 cgccgccgccgccagcgctcc 1747467
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 378 gtactggtggtacgccgccgccgcc 402 ||||||| ||||||||||||||||| Sbjct: 1454544 gtactggaggtacgccgccgccgcc 1454568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 13780848 ctggtggtacgccgccgccg 13780829 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cgccgccgccgccagcgctc 409 |||||||||||||||||||| Sbjct: 12763260 cgccgccgccgccagcgctc 12763241 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 1286443 ggtggtacgccgccgccgcc 1286462 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 1275146 ggtggtacgccgccgccgcc 1275165
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 42.1 bits (21), Expect = 1.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtccca 449 ||||||||||| ||| ||||||||||||||| Sbjct: 738 gggccgacccagtagacccagtggttgtccca 707
>dbj|AP002838.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0038F22 Length = 101666 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 378 gtactggtggtacgccgccgccgcc 402 ||||||| ||||||||||||||||| Sbjct: 61830 gtactggaggtacgccgccgccgcc 61854
>dbj|AP001168.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0425F02 Length = 176979 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 378 gtactggtggtacgccgccgccgcc 402 ||||||| ||||||||||||||||| Sbjct: 163083 gtactggaggtacgccgccgccgcc 163107
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 110249 ttgttgtagacgacggcggcgccgaggct 110221 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||| ||||| |||||||||||||| Sbjct: 102369 ttgttgtacatgacggcggcgccgaggct 102341
>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic protein, complete cds Length = 1260 Score = 42.1 bits (21), Expect = 1.7 Identities = 49/59 (83%) Strand = Plus / Minus Query: 414 gaacgggccgacccanaagatccagtggttgtcccatgcggncttcttgttgtagatga 472 |||||| || ||||| || |||||||||| ||||| || ||||||||||||||||| Sbjct: 888 gaacggtccaacccagaatatccagtggtcatcccaggcatgcttcttgttgtagatga 830
>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full insert sequence Length = 618 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 460 ttgttgtagatgaccgcggcgccgaggct 488 |||||||||| ||| |||||||||||||| Sbjct: 276 ttgttgtagacgacggcggcgccgaggct 248
>gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein, 28kDa), mRNA (cDNA clone MGC:89110 IMAGE:7006583), complete cds Length = 950 Score = 42.1 bits (21), Expect = 1.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttg 444 |||||||| ||||||||||||||| Sbjct: 692 ccgacccaaaagatccagtggttg 669
>emb|AL591544.30| Mouse DNA sequence from clone RP23-386D6 on chromosome 11, complete sequence Length = 201673 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 tcacatgcatgcacagacact 183 ||||||||||||||||||||| Sbjct: 42516 tcacatgcatgcacagacact 42536
>ref|NM_193436.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 4317 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 34 ggtggtacgccgccgccgcc 53
>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence Length = 177277 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 cacatgcatgcacagacactgaac 187 |||||||||||||| ||||||||| Sbjct: 133853 cacatgcatgcacacacactgaac 133830
>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence Length = 245390 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 cacatgcatgcacagacactgaac 187 |||||||||||||| ||||||||| Sbjct: 46326 cacatgcatgcacacacactgaac 46303
>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence Length = 166644 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 cacatgcatgcacagacactgaac 187 |||||||||||||| ||||||||| Sbjct: 86180 cacatgcatgcacacacactgaac 86203
>emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chromosome 10 Contains the 5' end of the SLIT1 gene for slit homolog 1 (Drosophila), a novel gene and a CpG island, complete sequence Length = 172510 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 tggaggagcagtactgccaa 225 |||||||||||||||||||| Sbjct: 39310 tggaggagcagtactgccaa 39329
>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the 3' end of a variant of the EPM2A gene for progressive myoclonus type 2 epilepsy (Lafora disease) protein (laforin) and a BTB/POZ domain zinc finger protein pseudogene, complete sequence Length = 115835 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 tgcatgcacagacactgaac 187 |||||||||||||||||||| Sbjct: 106284 tgcatgcacagacactgaac 106265
>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma membrane intrinsic protein (pip1.2 gene) Length = 1124 Score = 40.1 bits (20), Expect = 6.6 Identities = 31/35 (88%) Strand = Plus / Minus Query: 418 gggccgacccanaagatccagtggttgtcccatgc 452 ||||| ||||| ||||||||||||| |||||||| Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgc 832
>dbj|AB193040.1| Nicotiana tabacum NtTOM3 mRNA for tobamovirus multiplication 3, complete cds Length = 1122 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 152 ggtggtacgccgccgccgcc 133
>gb|AC012368.6| Homo sapiens BAC clone RP11-547M24 from 2, complete sequence Length = 196206 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 cacatgcatgcacagacact 183 |||||||||||||||||||| Sbjct: 179733 cacatgcatgcacagacact 179714
>dbj|AP003902.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1110C07 Length = 173859 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 101330 ggtggtacgccgccgccgcc 101311 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 92007 ggtggtacgccgccgccgcc 91988
>dbj|AP003456.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0542E10 Length = 146196 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 138396 ggtggtacgccgccgccgcc 138415 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ggtggtacgccgccgccgcc 402 |||||||||||||||||||| Sbjct: 127099 ggtggtacgccgccgccgcc 127118
>dbj|AP005646.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1077E08 Length = 145275 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 34988 ctggtggtacgccgccgccg 34969
>dbj|AP005477.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0039F24 Length = 132107 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cgccgccgccgccagcgctc 409 |||||||||||||||||||| Sbjct: 116781 cgccgccgccgccagcgctc 116762
>dbj|AP004811.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0019A05 Length = 144255 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cgccgccgccgccagcgctc 409 |||||||||||||||||||| Sbjct: 64037 cgccgccgccgccagcgctc 64018
>dbj|AP004315.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0571D04 Length = 149302 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 42735 ctggtggtacgccgccgccg 42716 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 ctggtggtacgccgccgccg 400 |||||||||||||||||||| Sbjct: 37236 ctggtggtacgccgccgccg 37217
>emb|BX663521.10| Zebrafish DNA sequence from clone DKEYP-50F5 in linkage group 14, complete sequence Length = 179663 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 cggttttacaggttcaatcc 48 |||||||||||||||||||| Sbjct: 113082 cggttttacaggttcaatcc 113101
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 40.1 bits (20), Expect = 6.6 Identities = 28/31 (90%) Strand = Plus / Minus Query: 421 ccgacccanaagatccagtggttgtcccatg 451 |||||||| ||||||||||||| ||||||| Sbjct: 324 ccgacccagtagatccagtggttatcccatg 294
>emb|BX005274.11| Zebrafish DNA sequence from clone DKEY-77B9 in linkage group 19, complete sequence Length = 165012 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gttgcattaaattattggcc 310 |||||||||||||||||||| Sbjct: 80678 gttgcattaaattattggcc 80697 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,515,099 Number of Sequences: 3902068 Number of extensions: 3515099 Number of successful extensions: 100375 Number of sequences better than 10.0: 97 Number of HSP's better than 10.0 without gapping: 99 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 99383 Number of HSP's gapped (non-prelim): 992 length of query: 488 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 466 effective length of database: 17,147,199,772 effective search space: 7990595093752 effective search space used: 7990595093752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
