ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd22k02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein 369 4e-99
2emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMW... 129 7e-27
3gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich ... 50 0.005
4gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.020
5gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23... 48 0.020
6dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.020
7gb|AC009159.12| Homo sapiens chromosome 16 clone RP11-70D24, com... 44 0.31
8emb|AJ720719.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.31
9ref|NM_001006412.1| Gallus gallus high mobility group nucleosoma... 44 0.31
10gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 44 0.31
11ref|XM_515163.1| PREDICTED: Pan troglodytes similar to D-PCa-2 p... 42 1.2
12ref|XM_530683.1| PREDICTED: Pan troglodytes LOC460985 (LOC460985... 42 1.2
13ref|NM_005517.2| Homo sapiens high-mobility group nucleosomal bi... 42 1.2
14ref|XM_516308.1| PREDICTED: Pan troglodytes similar to 2-hydroxy... 42 1.2
15ref|XM_515655.1| PREDICTED: Pan troglodytes similar to Nonhiston... 42 1.2
16ref|XM_530248.1| PREDICTED: Pan troglodytes LOC457914 (LOC457914... 42 1.2
17ref|XM_477694.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.2
18ref|XM_530110.1| PREDICTED: Pan troglodytes LOC456663 (LOC456663... 42 1.2
19gb|BC081567.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
20gb|AY704551.1| Gekko japonicus GekBS049P mRNA, complete cds 42 1.2
21gb|BC075837.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
22gb|BC072010.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
23gb|BC072011.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
24gb|BC000378.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
25gb|BC014644.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
26gb|BC003050.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
27gb|BC070297.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
28gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic ... 42 1.2
29ref|XM_846735.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
30gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome... 42 1.2
31ref|XM_844334.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
32gb|AY459322.1| Mus musculus apoptosis repressor interacting with... 42 1.2
33gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome... 42 1.2
34ref|XM_534124.2| PREDICTED: Canis familiaris similar to L-plasti... 42 1.2
35ref|XM_843311.1| PREDICTED: Canis familiaris similar to L-plasti... 42 1.2
36ref|XM_847544.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
37gb|BC075848.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
38gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome... 42 1.2
39ref|XM_847200.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
40gb|AC112504.6| Homo sapiens 3 BAC RP11-271K21 (Roswell Park Canc... 42 1.2
41emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A... 42 1.2
42ref|XM_845631.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
43ref|XM_845691.1| PREDICTED: Canis familiaris similar to Nonhisto... 42 1.2
44gb|BC063551.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolo... 42 1.2
45gb|BC001783.1| Homo sapiens mRNA similar to ribosomal protein L3... 42 1.2
46emb|Z83840.7|HS216E10 Human DNA sequence from clone CTA-216E10 o... 42 1.2
47emb|Z97055.1|HS388M5 Human DNA sequence from clone RP3-388M5 on ... 42 1.2
48emb|AL607067.17| Human DNA sequence from clone RP11-201K10 on ch... 42 1.2
49emb|AL513365.27| Human DNA sequence from clone RP3-476K8 on chro... 42 1.2
50emb|AL513185.12| Human DNA sequence from clone RP11-167P22 on ch... 42 1.2
51emb|AL390838.26| Human DNA sequence from clone RP11-158D2 on chr... 42 1.2
52ref|NM_030152.2| Mus musculus nucleolar protein 3 (apoptosis rep... 42 1.2
53emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chr... 42 1.2
54emb|AL139415.10| Human DNA sequence from clone RP3-477M7 on chro... 42 1.2
55emb|CR859118.1| Pongo pygmaeus mRNA; cDNA DKFZp468C094 (from clo... 42 1.2
56emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chr... 42 1.2
57gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R... 42 1.2
58gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 42 1.2
59gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 42 1.2
60emb|CR624609.1| full-length cDNA clone CS0CAP008YJ21 of Thymus o... 42 1.2
61emb|CR624004.1| full-length cDNA clone CS0DI075YK09 of Placenta ... 42 1.2
62emb|CR622123.1| full-length cDNA clone CS0DL009YG08 of B cells (... 42 1.2
63emb|CR621179.1| full-length cDNA clone CS0DI055YJ13 of Placenta ... 42 1.2
64emb|CR619884.1| full-length cDNA clone CS0DJ013YC12 of T cells (... 42 1.2
65emb|CR614459.1| full-length cDNA clone CS0DM006YI10 of Fetal liv... 42 1.2
66emb|CR612973.1| full-length cDNA clone CL0BA002ZH08 of Placenta ... 42 1.2
67emb|CR611141.1| full-length cDNA clone CS0CAP003YB16 of Thymus o... 42 1.2
68emb|CR609228.1| full-length cDNA clone CS0DF002YD20 of Fetal bra... 42 1.2
69emb|CR608465.1| full-length cDNA clone CL0BA008ZE05 of Placenta ... 42 1.2
70emb|CR607698.1| full-length cDNA clone CS0CAP006YC12 of Thymus o... 42 1.2
71emb|CR606135.1| full-length cDNA clone CS0DD003YG22 of Neuroblas... 42 1.2
72emb|CR605166.1| full-length cDNA clone CL0BA011ZG12 of Placenta ... 42 1.2
73emb|CR602382.1| full-length cDNA clone CS0DB001YD15 of Neuroblas... 42 1.2
74emb|CR599316.1| full-length cDNA clone CS0CAP006YG17 of Thymus o... 42 1.2
75emb|CR598323.1| full-length cDNA clone CS0CAP004YI14 of Thymus o... 42 1.2
76emb|CR596866.1| full-length cDNA clone CS0DH005YD16 of T cells (... 42 1.2
77emb|CR595538.1| full-length cDNA clone CS0DC025YM12 of Neuroblas... 42 1.2
78emb|CR595467.1| full-length cDNA clone CL0BB010ZB04 of Neuroblas... 42 1.2
79emb|CR593313.1| full-length cDNA clone CS0DI020YC24 of Placenta ... 42 1.2
80emb|CR592727.1| full-length cDNA clone CS0DI051YN20 of Placenta ... 42 1.2
81emb|CR590834.1| full-length cDNA clone CS0DI082YF23 of Placenta ... 42 1.2
82emb|CR590487.1| full-length cDNA clone CS0DD005YI07 of Neuroblas... 42 1.2
83gb|AC116441.2| Homo sapiens chromosome 3 clone RP11-20O23, compl... 42 1.2
84gb|AC022394.7| Homo sapiens chromosome 10 clone RP11-325M24, com... 42 1.2
85gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, co... 42 1.2
86dbj|AK136964.1| Mus musculus 12 days embryo embryonic body betwe... 42 1.2
87gb|AC099560.2| Homo sapiens chromosome 3 clone RP11-761N21, comp... 42 1.2
88ref|XM_937222.1| PREDICTED: Homo sapiens similar to TRM5 tRNA me... 42 1.2
89ref|XM_945624.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
90ref|XM_945621.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
91ref|XM_942006.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
92ref|XM_929021.1| PREDICTED: Homo sapiens similar to TRM5 tRNA me... 42 1.2
93ref|XM_933938.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
94ref|XM_933937.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
95ref|XM_929731.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
96ref|XM_927624.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
97ref|XM_939591.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
98ref|XM_941943.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
99ref|XM_930287.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
100ref|XM_937902.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
101ref|XM_937758.1| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
102ref|XM_086360.6| PREDICTED: Homo sapiens similar to Nonhistone c... 42 1.2
103emb|CR542122.1| Homo sapiens full open reading frame cDNA clone ... 42 1.2
104dbj|AB179399.1| Macaca fascicularis testis cDNA clone: QtsA-1926... 42 1.2
105dbj|AK079536.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 42 1.2
106ref|NG_000892.1| Homo sapiens high-mobility group (nonhistone ch... 42 1.2
107ref|NG_001142.1| Homo sapiens high-mobility group (nonhistone ch... 42 1.2
108ref|NG_002646.1| Homo sapiens high-mobility group (nonhistone ch... 42 1.2
109dbj|AK053846.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 42 1.2
110dbj|AK021023.1| Mus musculus 4 days neonate male adipose cDNA, R... 42 1.2
111dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
112gb|DQ015919.1| Homo sapiens tight junction protein 1 (zona occlu... 42 1.2
113gb|DQ000559.1| Synthetic construct clone PSF:109216 high mobilit... 42 1.2
114gb|AC117394.10| Homo sapiens 3 BAC RP11-529G21 (Roswell Park Can... 42 1.2
115gb|BC029638.1| Homo sapiens, Similar to high-mobility group (non... 42 1.2
116ref|NM_001003101.1| Canis familiaris non-histone chromosomal pro... 42 1.2
117gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complet... 42 1.2
118gb|AC007395.3|AC007395 Homo sapiens BAC clone RP11-504O1 from 2,... 42 1.2
119gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p... 42 1.2
120gb|AF198109.1|AF198109 Trichomonas vaginalis eukaryotic release ... 42 1.2
121dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
122dbj|AP004264.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
123dbj|AK026562.1| Homo sapiens cDNA: FLJ22909 fis, clone KAT05694,... 42 1.2
124dbj|AK105945.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.2
125gb|BC071707.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
126gb|BC027290.1| Mus musculus nucleolar protein 3 (apoptosis repre... 42 1.2
127gb|BC032140.2| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
128emb|AL163052.4|CNS01RIB Human chromosome 14 DNA sequence BAC R-7... 42 1.2
129emb|AL160236.4|CNS01RH0 Human chromosome 14 DNA sequence BAC R-1... 42 1.2
130gb|BC099178.1| Rattus norvegicus high mobility group nucleosomal... 42 1.2
131gb|BC099815.1| Rattus norvegicus high mobility group nucleosomal... 42 1.2
132ref|NM_001025624.1| Rattus norvegicus high mobility group nucleo... 42 1.2
133gb|BC053971.1| Mus musculus nucleolar protein 3 (apoptosis repre... 42 1.2
134gb|BC003689.1| Homo sapiens high-mobility group nucleosomal bind... 42 1.2
135gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome ... 42 1.2
136ref|NM_020810.1| Homo sapiens TRM5 tRNA methyltransferase 5 homo... 42 1.2
137emb|AL732319.17| Mouse DNA sequence from clone RP23-180O4 on chr... 42 1.2
138emb|AL844586.5| Mouse DNA sequence from clone RP23-259N17 on chr... 42 1.2
139emb|AL844537.5| Mouse DNA sequence from clone RP23-448A16 on chr... 42 1.2
140gb|M12623.1|HUMHMG17 Human non-histone chromosomal protein HMG-1... 42 1.2
141emb|AJ388518.1|CFA388518 Canis familiaris mRNA for non-histone c... 42 1.2
142emb|X06444.1|HSHMG17P Human retropseudogene for chromosomal prot... 42 1.2
143emb|X13546.1|HSHMG17G Human HMG-17 gene for non-histone chromoso... 42 1.2
144dbj|AB037814.1| Homo sapiens mRNA for KIAA1393 protein, partial cds 42 1.2
145gb|U80815.2| Caenorhabditis elegans cosmid W02C12, complete sequ... 40 4.9
146ref|XM_477690.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.9
147ref|XM_360938.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 4.9
148gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome ... 40 4.9
149ref|NM_008169.1| Mus musculus glutamate receptor, ionotropic, NM... 40 4.9
150ref|NM_003632.1| Homo sapiens contactin associated protein 1 (CN... 40 4.9
151emb|Z93375.1|CEC38C6 Caenorhabditis elegans Cosmid C38C6, comple... 40 4.9
152gb|BC039157.1| Mus musculus glutamate receptor, ionotropic, NMDA... 40 4.9
153gb|AF036699.2| Caenorhabditis elegans cosmid F58F6, complete seq... 40 4.9
154emb|AL158139.26| Human DNA sequence from clone RP1-80B9 on chrom... 40 4.9
155emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chro... 40 4.9
156gb|AC153008.4| Mus musculus BAC clone RP23-457I7 from chromosome... 40 4.9
157dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 4.9
158dbj|AK158175.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 4.9
159dbj|AK087384.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 4.9
160dbj|AK076389.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 40 4.9
161ref|NM_061930.2| Caenorhabditis elegans F34D6.1 (F34D6.1) mRNA, ... 40 4.9
162dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
163dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
164emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 i... 40 4.9
165gb|AE004965.1| Pseudomonas aeruginosa PAO1, section 526 of 529 o... 40 4.9
166gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Can... 40 4.9
167gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, com... 40 4.9
168dbj|AP003062.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 4.9
169gb|AF221552.1|AF221552 Oryza sativa proline-rich protein RiP-15 ... 40 4.9
170dbj|AK105956.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
171gb|AF025454.1| Caenorhabditis elegans cosmid F34D6, complete seq... 40 4.9
172emb|BX927356.22| Zebrafish DNA sequence from clone DKEY-54K20 in... 40 4.9
173gb|U87223.1|HSU87223 Homo sapiens contactin associated protein (... 40 4.9
174gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.9
175emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4,... 40 4.9
176emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa... 40 4.9
177emb|AL935141.16| Zebrafish DNA sequence from clone CH211-173A9 i... 40 4.9
178emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa... 40 4.9
179gb|U23764.1|PAU23764 Pseudomonas aeruginosa TonB (tonB) gene, co... 40 4.9
180gb|AF040654.3| Caenorhabditis elegans cosmid R06B10, complete se... 40 4.9
181emb|AL732309.9| Mouse DNA sequence from clone RP23-132N23 on chr... 40 4.9
182dbj|D10028.1|MUSGLURZ1 Mus musculus mRNA for glutamate receptor ... 40 4.9

>emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein
          Length = 1487

 Score =  369 bits (186), Expect = 4e-99
 Identities = 260/283 (91%), Gaps = 4/283 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    gaatacaaggaatgcaaaaaagatgcatcatcactatctcgctagccggatactatgcca 60
            ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 1367 gaatacaaggaatacaaaaa-gatgcatcatcactatctcgctaaccggatactatgcca 1309

                                                                        
Query: 61   cttattctggaaatagcacatcgtggctccggacggggtcgatctcctcctccttcggct 120
            |||||||| ||||||||||||||||||||||||||||||||||||||||||   || |||
Sbjct: 1308 cttattctagaaatagcacatcgtggctccggacggggtcgatctcctcct---tcagct 1252

                                                                        
Query: 121  gtcatatgtgagcatcacatcaattgtccgtcatcggcggcttgcccttcgnaggcggct 180
            |||||||||||| ||||||||||||||| |||||||| ||||||||||||| ||||||||
Sbjct: 1251 gtcatatgtgagtatcacatcaattgtcagtcatcggtggcttgcccttcggaggcggct 1192

                                                                        
Query: 181  ccggcttgggttcgggttcaggcttgggctctggcttaggcatgggttgaggcttgggct 240
            ||||||| |||||||| |||||||||||||||||||||||||| |||| |||||| ||||
Sbjct: 1191 ccggcttcggttcgggctcaggcttgggctctggcttaggcataggttcaggcttaggct 1132

                                                       
Query: 241  ctggttttggcattgggtaaggcttgggctctggctttggcat 283
            ||||||| |||| ||| |  ||||| |||||||||||||||||
Sbjct: 1131 ctggtttaggcaatggtttgggcttaggctctggctttggcat 1089



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 195  ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttggcatt 254
            ||||||||||| |||||||| |||||||  ||||  ||||| |||||||| |||||||| 
Sbjct: 1147 ggttcaggcttaggctctggtttaggcaatggtttgggcttaggctctggctttggcatc 1088

                                   
Query: 255  gggtaaggcttgggctctggctt 277
            || | ||||||||||||||||||
Sbjct: 1087 ggctcaggcttgggctctggctt 1065



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 230 aggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 280
           |||||| ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 890 aggcttaggctcaggtttgggcattgggtaaggcttgggctcaggctttgg 840



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                        
Query: 230  aggcttgggctctggttttggcattgggtaaggcttgggctctggctttggcataanctc 289
            ||||||||||||||| || ||||| || | |||||| |||||||| || ||||     | 
Sbjct: 1172 aggcttgggctctggcttaggcataggttcaggcttaggctctggtttaggcaatggttt 1113

                                                   
Query: 290  gggcttangctccggctttggcatcggctctggcttggg 328
            ||||||| |||| ||||||||||||||||| ||||||||
Sbjct: 1112 gggcttaggctctggctttggcatcggctcaggcttggg 1074



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 287  ctcgggcttangctccggctttggcatcggctctggcttgggttcaggttt 337
            |||||||||  | ||||||||||||||||||||||||||||| || |||||
Sbjct: 1031 ctcgggctttggttccggctttggcatcggctctggcttgggctcgggttt 981



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| || ||||||||||||||||||||||
Sbjct: 979 ggctctggctttggttccggctttggcatcggctcgggtttgg 937



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| ||||| |||||||||||||||||||
Sbjct: 937 ggctctggctttggttctggtttgggcatcggctcgggtttgg 895



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 287 ctcgggcttangctccggctttggcatcggctctggcttgggttcagg 334
           |||||||||  ||||||| |||||||||||||| |||||||| |||||
Sbjct: 809 ctcgggcttgggctccggttttggcatcggctcaggcttgggctcagg 762



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 213 ggcttaggcatgggttgaggcttgggctctggttttggcattgggtaaggcttgggctct 272
           |||| |||| |||| | ||||||||| || ||||||||||| || | |||||||||||||
Sbjct: 781 ggctcaggcttgggctcaggcttgggttccggttttggcatcggctcaggcttgggctct 722

                
Query: 273 ggctt 277
           |||||
Sbjct: 721 ggctt 717



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||| ||||| ||||| |||||||||||||||||||| ||||
Sbjct: 853 ggctcaggctttggttccggttttggcatcggctcgggcttgg 811



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 231 ggcttgggctctggttttggcattgggtaaggcttgggctctggctt 277
           ||||||||||| ||||||||||| || | |||||||||||| |||||
Sbjct: 805 ggcttgggctccggttttggcatcggctcaggcttgggctcaggctt 759



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 315 ggctctggcttgggttcaggttttggcatcggctc 349
           ||||| ||||||||||| |||||||||||||||||
Sbjct: 769 ggctcaggcttgggttccggttttggcatcggctc 735



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| ||||| |||||||||||||| ||||
Sbjct: 664 ggctctggctttggttctggtttaggcatcggctcgggcttgg 622



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||| ||||| ||||||||||||||||| |||||||| ||||
Sbjct: 559 ggctcgggctttggttcaggttttggcataggctcgggcttgg 517



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 230 aggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 280
           |||||| ||||| ||||| ||||| |||| |||||||||||| ||||||||
Sbjct: 470 aggcttaggctcaggtttgggcatcgggtcaggcttgggctcaggctttgg 420



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 315 ggctctggcttgggttcaggttttggcatcggct 348
           ||||||||||| ||||| ||||||||||||||||
Sbjct: 622 ggctctggcttcggttcgggttttggcatcggct 589



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 204 ttgggctctggcttaggcatgggttgaggcttgggc 239
           |||||||||||||| |||||||||| ||| ||||||
Sbjct: 382 ttgggctctggctttggcatgggttcaggtttgggc 347



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 200 aggcttgggctctggcttaggcatgggttgaggctt 235
           |||||| ||||||||||| |||||||||| ||||||
Sbjct: 302 aggcttaggctctggctttggcatgggttcaggctt 267



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 ggctctggcttgggttcaggttttggcatcggctc 349
           ||||| |||||||| || |||||||||||||||||
Sbjct: 811 ggctcgggcttgggctccggttttggcatcggctc 777



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 198 tcaggcttgggctctggcttagg 220
           |||||||||||||||||||||||
Sbjct: 736 tcaggcttgggctctggcttagg 714



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 ggctctggcttgggttcaggttttggcatcggctc 349
           ||||||||||| ||||| ||||| |||||||||||
Sbjct: 517 ggctctggctttggttccggtttgggcatcggctc 483



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 300 tccggctttggcatcggctctggcttgggttcagg 334
           ||||| || |||||||||||||||||||| |||||
Sbjct: 502 tccggtttgggcatcggctctggcttgggctcagg 468



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 194 gggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctgg 244
           |||||||||||| |||  |||||  ||| ||||||| ||||||||||||||
Sbjct: 278 gggttcaggcttaggcattggctctggcttgggttgcggcttgggctctgg 228



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 315 ggctctggcttgggttcaggttttggcatcggct 348
           ||||||||||| ||||| ||||| ||||||||||
Sbjct: 727 ggctctggcttaggttcgggtttcggcatcggct 694



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 243 ggttttggcattgggtaaggcttgggctctggctttgg 280
           ||||||||||| || |  ||||||||||||||||||||
Sbjct: 541 ggttttggcataggctcgggcttgggctctggctttgg 504



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 300 tccggctttggcatcggctctggcttggg 328
           |||||||||||||||||||| || |||||
Sbjct: 964 tccggctttggcatcggctcgggtttggg 936



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 182 cggcttgggttcgggttcaggcttgggctctggcttaggcatgggttgaggcttgggctc 241
           ||||| ||||| ||| |||||||| ||||| || || ||||| || | ||||||||||||
Sbjct: 908 cggctcgggtttgggctcaggcttaggctcaggtttgggcattgggtaaggcttgggctc 849

                    
Query: 242 tggttttgg 250
            || |||||
Sbjct: 848 aggctttgg 840



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 300 tccggctttggcatcggctctggcttggg 328
           ||||| |||||||||||||| ||||||||
Sbjct: 838 tccggttttggcatcggctcgggcttggg 810



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 300 tccggctttggcatcggctctggcttggg 328
           ||||| |||||||||||||| ||||||||
Sbjct: 754 tccggttttggcatcggctcaggcttggg 726



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 229 gaggcttgggctctggttttggcat 253
           ||||||| |||||||||||||||||
Sbjct: 345 gaggcttaggctctggttttggcat 321



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 72/90 (80%)
 Strand = Plus / Minus

                                                                        
Query: 260  aggcttgggctctggctttggcataanctcgggcttangctccggctttggcatcggctc 319
            |||||||||||||||||| ||||||   || |||||| |||| || || ||||  || | 
Sbjct: 1172 aggcttgggctctggcttaggcataggttcaggcttaggctctggtttaggcaatggttt 1113

                                          
Query: 320  tggcttgggttcaggttttggcatcggctc 349
             ||||| || || || ||||||||||||||
Sbjct: 1112 gggcttaggctctggctttggcatcggctc 1083



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 264 ttgggctctggctttggcat 283
           ||||||||||||||||||||
Sbjct: 382 ttgggctctggctttggcat 363



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 260 aggcttgggctctggctttggcat 283
           |||||| |||||||||||||||||
Sbjct: 302 aggcttaggctctggctttggcat 279



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 303 ggctttggcatcggctctggcttgggtt 330
           ||||| ||||| ||||||||||||||||
Sbjct: 271 ggcttaggcattggctctggcttgggtt 244



to top

>emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMWG0646
          Length = 694

 Score =  129 bits (65), Expect = 7e-27
 Identities = 96/105 (91%), Gaps = 2/105 (1%)
 Strand = Plus / Minus

                                                                       
Query: 255 gggtaaggcttgggctctggctttggcataan-ctcgggcttangctccggctttggcat 313
           |||||||||||||||||||||||||||||    |||||||||| ||||||||||||||||
Sbjct: 694 gggtaaggcttgggctctggctttggcattcggctcgggcttaggctccggctttggcat 635

                                                        
Query: 314 cggctctggcttgggttca-ggttttggcatcggctcgggtttgg 357
           ||||||||||||||| ||| ||||||||| |||||||||| ||||
Sbjct: 634 cggctctggcttgggktcagggttttggcctcggctcgggcttgg 590



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 527 ggctctggctttggttcgggttttggcatcggctctggtttgg 485



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 485 ggctctggctttggttcgggttttggcatcggctctggtttgg 443



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct: 317 ggctctggctttggttcgggttttggcatcggctcgggcttgg 275



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 255 ggctctggctttggttcaggttttggcatgggctcaggtttgg 213



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 79  ggctctggctttggttcaggttttggcatgggctcaggtttgg 37



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 315 ggctctggcttgggttcaggttttggcatcggctcggg 352
           ||||||||||| ||||| ||||||||||||||||||||
Sbjct: 359 ggctctggctttggttcgggttttggcatcggctcggg 322



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 230 aggcttgggctctggttttggcattgggtaaggcttgggctctggctt 277
           |||||| ||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 438 aggcttaggctcaggtttgggcatggggtaaggcttgggctcaggctt 391



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 291 ggcttangctccggctttggcatcggctctggcttgggttca 332
           |||||| |||| ||||||||||||||||| ||||||| ||||
Sbjct: 135 ggcttaggctcgggctttggcatcggctccggcttggcttca 94



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 315 ggctctggcttgggttcaggttttggcatcgg 346
           ||||||||||| ||||| ||||||||||||||
Sbjct: 590 ggctctggcttcggttcgggttttggcatcgg 559



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 48/55 (87%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                  
Query: 230 aggcttgggctctggttttggcatt-gggtaaggcttgggctctggctttggcat 283
           ||||||||||||||| ||||||||| || |  ||||| ||||| |||||||||||
Sbjct: 689 aggcttgggctctggctttggcattcggctcgggcttaggctccggctttggcat 635



 Score = 46.1 bits (23), Expect = 0.079
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 315 ggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||| ||||| ||||| ||||| |||||||||||||| ||||
Sbjct: 401 ggctcaggcttcggttcgggtttcggcatcggctcgggcttgg 359



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 306 tttggcatcggctctggcttgggttcagg 334
           ||||||||||||||||| ||||| |||||
Sbjct: 464 tttggcatcggctctggtttgggctcagg 436



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 189 ggttcgggttcaggcttgggctctggcttaggcatgggttgaggcttgggctc 241
           |||| ||| |||||||| ||||| || || |||||||| | ||||||||||||
Sbjct: 449 ggtttgggctcaggcttaggctcaggtttgggcatggggtaaggcttgggctc 397



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 309 ggcatcggctctggcttgggttcaggttttggcatcggctcgggtttgg 357
           ||||| ||||| || || ||||| ||||| |||||||||||||| ||||
Sbjct: 189 ggcataggctcaggtttcggttctggtttaggcatcggctcgggcttgg 141



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 200 aggcttgggctctggcttaggcat 223
           |||||||||||||||||| |||||
Sbjct: 689 aggcttgggctctggctttggcat 666



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 ggcttgggctctggctttgg 280
           ||||||||||||||||||||
Sbjct: 365 ggcttgggctctggctttgg 346



to top

>gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich protein mRNA,
           partial sequence
          Length = 1173

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 177 ggctccggcttgggttcgggttcaggcttgggctctggctt 217
           ||||| || ||||||| ||||||||||||||||| ||||||
Sbjct: 732 ggctctggtttgggtttgggttcaggcttgggctttggctt 692



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 195 ggttcaggcttgggctctggcttaggcatgggttgaggcttgggct 240
           ||||||||||| |||||||| || ||  |||||| |||||||||||
Sbjct: 744 ggttcaggctttggctctggtttgggtttgggttcaggcttgggct 699



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 174 ggcggctccggcttgggttcgggttcaggcttgggctctggcttaggcatgggttgaggc 233
           ||||| || ||||| |||| ||| ||||||||||| || |||| |||  | ||||| |||
Sbjct: 963 ggcgggtcgggctttggtttgggctcaggcttgggttcgggctcaggttttggttggggc 904

                            
Query: 234 ttgggctctggttttgg 250
           || ||||| ||||||||
Sbjct: 903 ttaggctccggttttgg 887



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 186 ttgggttcgggttcaggcttgggctctggcttaggca 222
           |||||||  ||| ||||||||||||||||||| ||||
Sbjct: 621 ttgggttttggtccaggcttgggctctggcttcggca 585



to top

>gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_C10,
             complete sequence
          Length = 138209

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 314   cggctctggcttgggttcaggttttggc 341
             ||||||||||||||| ||||||||||||
Sbjct: 83937 cggctctggcttgggctcaggttttggc 83964



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 225   ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 280
             |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 83074 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 83129



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 195   ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 250
             ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 83074 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 83129



to top

>gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23221 proline-rich
            protein mRNA, complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 225  ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 280
            |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 1097 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 1042



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 314 cggctctggcttgggttcaggttttggc 341
           ||||||||||||||| ||||||||||||
Sbjct: 234 cggctctggcttgggctcaggttttggc 207



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 195  ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 250
            ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 1097 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 1042



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 314     cggctctggcttgggttcaggttttggc 341
               ||||||||||||||| ||||||||||||
Sbjct: 7647542 cggctctggcttgggctcaggttttggc 7647569



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225     ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 280
               |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 7646679 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 7646734



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                       
Query: 195     ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 250
               ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 7646679 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 7646734



to top

>gb|AC009159.12| Homo sapiens chromosome 16 clone RP11-70D24, complete sequence
          Length = 165921

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 248    tggcattgggtaaggcttgggc 269
              ||||||||||||||||||||||
Sbjct: 124291 tggcattgggtaaggcttgggc 124312



to top

>emb|AJ720719.1| Gallus gallus mRNA for hypothetical protein, clone 24a7
          Length = 840

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 320 tggcttgggttcaggttttggc 341
           ||||||||||||||||||||||
Sbjct: 207 tggcttgggttcaggttttggc 186



to top

>ref|NM_001006412.1| Gallus gallus high mobility group nucleosomal binding domain 3
           (HMGN3), mRNA
          Length = 840

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 320 tggcttgggttcaggttttggc 341
           ||||||||||||||||||||||
Sbjct: 207 tggcttgggttcaggttttggc 186



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 179     ctccggcttgggttcgggttcaggcttggg 208
               |||||||||||||| ||| |||||||||||
Sbjct: 2710023 ctccggcttgggtttgggctcaggcttggg 2710052



to top

>ref|XM_515163.1| PREDICTED: Pan troglodytes similar to D-PCa-2 protein isoform c;
           Dresden prostate cancer 2; Dresden prostate carcinoma 2
           (LOC458871), mRNA
          Length = 388

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103



to top

>ref|XM_530683.1| PREDICTED: Pan troglodytes LOC460985 (LOC460985), mRNA
          Length = 902

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 626 aggcttgggctctggctttgg 646



to top

>ref|NM_005517.2| Homo sapiens high-mobility group nucleosomal binding domain 2
           (HMGN2), mRNA
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 313 aggcttgggctctggctttgg 293



to top

>ref|XM_516308.1| PREDICTED: Pan troglodytes similar to 2-hydroxyphytanoyl-CoA lyase
            (2-HPCL) (HSPC279) (LOC460203), mRNA
          Length = 1882

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 1732 aggcttgggctctggctttgg 1712



to top

>ref|XM_515655.1| PREDICTED: Pan troglodytes similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC459448), mRNA
          Length = 993

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 423 aggcttgggctctggctttgg 403



to top

>ref|XM_530248.1| PREDICTED: Pan troglodytes LOC457914 (LOC457914), mRNA
          Length = 922

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 622 aggcttgggctctggctttgg 642



to top

>ref|XM_477694.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1088

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 313 tcggctctggcttgggttcaggttttggc 341
           ||||||| || ||||||||||||||||||
Sbjct: 668 tcggctcaggtttgggttcaggttttggc 640



to top

>ref|XM_530110.1| PREDICTED: Pan troglodytes LOC456663 (LOC456663), mRNA
          Length = 1412

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 623 aggcttgggctctggctttgg 643



to top

>gb|BC081567.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88718 IMAGE:4131303), complete cds
          Length = 1230

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191



to top

>gb|AY704551.1| Gekko japonicus GekBS049P mRNA, complete cds
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 234 aggcttgggctctggctttgg 214



to top

>gb|BC075837.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88719 IMAGE:6272425), complete cds
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 313 aggcttgggctctggctttgg 293



to top

>gb|BC072010.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88720 IMAGE:6273507), complete cds
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 212 aggcttgggctctggctttgg 192



to top

>gb|BC072011.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88721 IMAGE:6647282), complete cds
          Length = 1209

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188



to top

>gb|BC000378.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:8383 IMAGE:2820349), complete cds
          Length = 1250

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 228 aggcttgggctctggctttgg 208



to top

>gb|BC014644.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:15731 IMAGE:3355317), complete cds
          Length = 1231

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188



to top

>gb|BC003050.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:750 IMAGE:3543809), complete cds
          Length = 1242

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198



to top

>gb|BC070297.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88292 IMAGE:4282630), complete cds
          Length = 1181

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 176 aggcttgggctctggctttgg 156



to top

>gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic RFLP marker
           Csu1138
          Length = 369

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 204 ttgggctctggcttaggcatgggttgaggcttgggctctgg 244
           |||||||||||||| ||| |||| |  ||||||||||||||
Sbjct: 141 ttgggctctggcttgggcttgggctccggcttgggctctgg 101



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 177 ggctccggcttgggttcgggttcaggcttgggctctggctt 217
           ||||| |||||||| | ||| || |||||||||||||||||
Sbjct: 138 ggctctggcttgggcttgggctccggcttgggctctggctt 98



to top

>ref|XM_846735.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC609476), mRNA
          Length = 580

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 246 aggcttgggctctggctttgg 226



to top

>gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome 8, complete sequence
          Length = 190381

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 176    cggctccggcttgggttcgggttcaggcttgggctctggct 216
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 152163 cggctcgggctcgggttcgggttctggctcgggctccggct 152203



to top

>ref|XM_844334.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC607595), mRNA
          Length = 1096

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 666 aggcttgggctctggctttgg 646



to top

>gb|AY459322.1| Mus musculus apoptosis repressor interacting with CARD (Nol3) mRNA,
           complete cds
          Length = 983

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 750 cggctcgggctcgggttcgggttctggctcgggctccggct 710



to top

>gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome 14, complete sequence
          Length = 174986

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 80378 aggcttgggctctggctttgg 80398



to top

>ref|XM_534124.2| PREDICTED: Canis familiaris similar to L-plastin (Lymphocyte
            cytosolic protein 1) (LCP-1) (LC64P), transcript variant
            1 (LOC476921), mRNA
          Length = 3110

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 2144 aggcttgggctctggctttgg 2124



to top

>ref|XM_843311.1| PREDICTED: Canis familiaris similar to L-plastin (Lymphocyte
            cytosolic protein 1) (LCP-1) (LC64P), transcript variant
            2 (LOC476921), mRNA
          Length = 3116

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 2150 aggcttgggctctggctttgg 2130



to top

>ref|XM_847544.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC610127), mRNA
          Length = 462

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 220 aggcttgggctctggctttgg 200



to top

>gb|BC075848.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
            (cDNA clone IMAGE:4581619), **** WARNING: chimeric clone
            ****
          Length = 3796

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 2797 aggcttgggctctggctttgg 2777



to top

>gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome 8, complete sequence
          Length = 193083

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 176    cggctccggcttgggttcgggttcaggcttgggctctggct 216
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 113786 cggctcgggctcgggttcgggttctggctcgggctccggct 113826



to top

>ref|XM_847200.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC609853), mRNA
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203



to top

>gb|AC112504.6| Homo sapiens 3 BAC RP11-271K21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 215077

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 96392 aggcttgggctctggctttgg 96372



to top

>emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A2 on chromosome 1q42.11-42.3
             Contains the 5' end of the NUP133 gene, a novel gene, the
             ABCB10 gene for ATP-binding cassette, sub-family B
             (MDR/TAP), member 10, a high-mobility group nucleosomal
             binding domain 2 (HMGN2) pseudogene, the TAF5L gene for
             TAF5-like RNA polymerase II, p300/CBP-associated factor
             (PCAF)-associated factor, 65kDa, the 5' end of a novel
             gene (KIAA0133) and three CpG islands, complete sequence
          Length = 147913

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 230   aggcttgggctctggttttgg 250
             |||||||||||||||||||||
Sbjct: 84668 aggcttgggctctggttttgg 84648



to top

>ref|XM_845631.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC608920), mRNA
          Length = 1198

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203



to top

>ref|XM_845691.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC608614), mRNA
          Length = 1535

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 576 aggcttgggctctggctttgg 556



to top

>gb|BC063551.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae),
           mRNA (cDNA clone IMAGE:4779792), complete cds
          Length = 1363

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 456 aggcttgggctctggctttgg 436



to top

>gb|BC001783.1| Homo sapiens mRNA similar to ribosomal protein L35a (cDNA clone
            IMAGE:3355533)
          Length = 4331

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 3027 aggcttgggctctggctttgg 3047



to top

>emb|Z83840.7|HS216E10 Human DNA sequence from clone CTA-216E10 on chromosome 22, complete
              sequence
          Length = 122320

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 104520 aggcttgggctctggctttgg 104540



to top

>emb|Z97055.1|HS388M5 Human DNA sequence from clone RP3-388M5 on chromosome 22, complete
             sequence
          Length = 177568

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 56316 aggcttgggctctggctttgg 56296



to top

>emb|AL607067.17| Human DNA sequence from clone RP11-201K10 on chromosome 1 Contains a
            high-mobility group nucleosomal binding domain 2 (HMGN2)
            pseudogene and the KRTCAP2 gene for keratinocyte
            associated protein 2, complete sequence
          Length = 32360

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 6843 aggcttgggctctggctttgg 6823



to top

>emb|AL513365.27| Human DNA sequence from clone RP3-476K8 on chromosome 1 Contains the
             LIN28 gene for lin-28 homolog (C. elegans), the DHDDS gene
             for dehydrodolichyl diphosphate synthase, a ribosomal
             protein L17 (RPL17) pseudogene, a novel gene, the HMGN2
             gene for high-mobility group nucleosomal binding domain 2
             and two CpG islands, complete sequence
          Length = 107415

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 40227 aggcttgggctctggctttgg 40247



to top

>emb|AL513185.12| Human DNA sequence from clone RP11-167P22 on chromosome 10 Contains the
              5' end of the CBARA1 gene for calcium binding atopy-related
              autoantigen 1, an HMG17 pseudogene, a cytochrome c oxidase
              subunit VIIc (COX7C) pseudogene, a novel gene, a novel
              pseudogene (FLJ12684) and a CpG island, complete sequence
          Length = 163632

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 137312 aggcttgggctctggctttgg 137332



to top

>emb|AL390838.26| Human DNA sequence from clone RP11-158D2 on chromosome 9 Contains a
             novel pseudogene and a novel gene, complete sequence
          Length = 193709

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 63970 aggcttgggctctggctttgg 63950



to top

>ref|NM_030152.2| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain) (Nol3), mRNA
          Length = 2870

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 743 cggctcgggctcgggttcgggttctggctcgggctccggct 703



to top

>emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chromosome 13 Contains a
              high-mobility group pseudogene, complete sequence
          Length = 162763

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 140895 aggcttgggctctggctttgg 140875



to top

>emb|AL139415.10| Human DNA sequence from clone RP3-477M7 on chromosome 1 Contains the
             ENO1 gene for  enolase 1 (alpha), two novel genes, a novel
             pseudogene, a pseudogene similar to part of a Zinc finger
             protein, a pseudogene similar to part of cytochrome
             oxidase subunit II, the CA6 gene for carbonic anhydrase VI
             and a CpG island, complete sequence
          Length = 141428

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 39050 aggcttgggctctggctttgg 39030



to top

>emb|CR859118.1| Pongo pygmaeus mRNA; cDNA DKFZp468C094 (from clone DKFZp468C094)
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 231 aggcttgggctctggctttgg 211



to top

>emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chromosome 11 Contains gene
              D930008C07Rik, the Canx gene for calnexin, a high mobility
              group nucleosomal binding domain 2 (Hmgn2) pseudogene and
              two CpG islands, complete sequence
          Length = 113907

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 105281 aggcttgggctctggctttgg 105261



to top

>gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-248L18, Complete
              Sequence, complete sequence
          Length = 231039

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 176    cggctccggcttgggttcgggttcaggcttgggctctggct 216
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 215031 cggctcgggctcgggttcgggttctggctcgggctccggct 215071



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 231     ggcttgggctctggttttggc 251
               |||||||||||||||||||||
Sbjct: 2958492 ggcttgggctctggttttggc 2958512



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 231     ggcttgggctctggttttggc 251
               |||||||||||||||||||||
Sbjct: 1056648 ggcttgggctctggttttggc 1056668



to top

>emb|CR624609.1| full-length cDNA clone CS0CAP008YJ21 of Thymus of Homo sapiens
           (human)
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 202 aggcttgggctctggctttgg 182



to top

>emb|CR624004.1| full-length cDNA clone CS0DI075YK09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1142

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188



to top

>emb|CR622123.1| full-length cDNA clone CS0DL009YG08 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1180

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 240 aggcttgggctctggctttgg 220



to top

>emb|CR621179.1| full-length cDNA clone CS0DI055YJ13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1131

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195



to top

>emb|CR619884.1| full-length cDNA clone CS0DJ013YC12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1305

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 419 aggcttgggctctggctttgg 399



to top

>emb|CR614459.1| full-length cDNA clone CS0DM006YI10 of Fetal liver of Homo sapiens
           (human)
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 222 aggcttgggctctggctttgg 202



to top

>emb|CR612973.1| full-length cDNA clone CL0BA002ZH08 of Placenta of Homo sapiens
           (human)
          Length = 1119

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191



to top

>emb|CR611141.1| full-length cDNA clone CS0CAP003YB16 of Thymus of Homo sapiens
           (human)
          Length = 1173

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198



to top

>emb|CR609228.1| full-length cDNA clone CS0DF002YD20 of Fetal brain of Homo sapiens
           (human)
          Length = 1496

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 689 aggcttgggctctggctttgg 669



to top

>emb|CR608465.1| full-length cDNA clone CL0BA008ZE05 of Placenta of Homo sapiens
           (human)
          Length = 1180

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191



to top

>emb|CR607698.1| full-length cDNA clone CS0CAP006YC12 of Thymus of Homo sapiens
           (human)
          Length = 1153

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198



to top

>emb|CR606135.1| full-length cDNA clone CS0DD003YG22 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 213 aggcttgggctctggctttgg 193



to top

>emb|CR605166.1| full-length cDNA clone CL0BA011ZG12 of Placenta of Homo sapiens
           (human)
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195



to top

>emb|CR602382.1| full-length cDNA clone CS0DB001YD15 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1163

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 213 aggcttgggctctggctttgg 193



to top

>emb|CR599316.1| full-length cDNA clone CS0CAP006YG17 of Thymus of Homo sapiens
           (human)
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 216 aggcttgggctctggctttgg 196



to top

>emb|CR598323.1| full-length cDNA clone CS0CAP004YI14 of Thymus of Homo sapiens
           (human)
          Length = 1164

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 216 aggcttgggctctggctttgg 196



to top

>emb|CR596866.1| full-length cDNA clone CS0DH005YD16 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195



to top

>emb|CR595538.1| full-length cDNA clone CS0DC025YM12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 240 aggcttgggctctggctttgg 220



to top

>emb|CR595467.1| full-length cDNA clone CL0BB010ZB04 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1127

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191



to top

>emb|CR593313.1| full-length cDNA clone CS0DI020YC24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1157

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195



to top

>emb|CR592727.1| full-length cDNA clone CS0DI051YN20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1167

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 219 aggcttgggctctggctttgg 199



to top

>emb|CR590834.1| full-length cDNA clone CS0DI082YF23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 155 aggcttgggctctggctttgg 135



to top

>emb|CR590487.1| full-length cDNA clone CS0DD005YI07 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1226

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 281 aggcttgggctctggctttgg 261



to top

>gb|AC116441.2| Homo sapiens chromosome 3 clone RP11-20O23, complete sequence
          Length = 142374

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 94281 aggcttgggctctggctttgg 94301



to top

>gb|AC022394.7| Homo sapiens chromosome 10 clone RP11-325M24, complete sequence
          Length = 154064

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 124779 aggcttgggctctggctttgg 124759



to top

>gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, complete sequence
          Length = 188117

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 86341 aggcttgggctctggctttgg 86321



to top

>dbj|AK136964.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430017G04 product:unclassifiable, full insert
            sequence
          Length = 2832

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 1732 aggcttgggctctggctttgg 1752



to top

>gb|AC099560.2| Homo sapiens chromosome 3 clone RP11-761N21, complete sequence
          Length = 192169

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 156983 aggcttgggctctggctttgg 156963



to top

>ref|XM_937222.1| PREDICTED: Homo sapiens similar to TRM5 tRNA methyltransferase 5
           homolog (S. cerevisiae) (LOC653961), mRNA
          Length = 1826

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 929 aggcttgggctctggctttgg 909



to top

>ref|XM_945624.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 3 (LOC649445), mRNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_945621.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 2 (LOC649445), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_942006.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 1 (LOC649445), mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_929021.1| PREDICTED: Homo sapiens similar to TRM5 tRNA methyltransferase 5
           homolog (S. cerevisiae) (LOC653695), mRNA
          Length = 1826

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 929 aggcttgggctctggctttgg 909



to top

>ref|XM_933938.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 3 (LOC643872), mRNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_933937.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 2 (LOC643872), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_929731.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 1 (LOC643872), mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217



to top

>ref|XM_927624.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC644498), mRNA
          Length = 440

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 230 aggcttgggctctggctttgg 210



to top

>ref|XM_939591.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC650503), mRNA
          Length = 440

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 230 aggcttgggctctggctttgg 210



to top

>ref|XM_941943.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC652483), mRNA
          Length = 696

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 444 aggcttgggctctggctttgg 424



to top

>ref|XM_930287.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC647242), mRNA
          Length = 696

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 444 aggcttgggctctggctttgg 424



to top

>ref|XM_937902.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC648822), mRNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103



to top

>ref|XM_937758.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC148915), mRNA
          Length = 1568

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 582 aggcttgggctctggctttgg 562



to top

>ref|XM_086360.6| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC148915), mRNA
          Length = 1568

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 582 aggcttgggctctggctttgg 562



to top

>emb|CR542122.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0523D for
           gene HMGN2, high-mobility group nucleosomal binding
           domain 2; complete cds, incl. stopcodon
          Length = 273

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103



to top

>dbj|AB179399.1| Macaca fascicularis testis cDNA clone: QtsA-19263, similar to human
           high-mobility group nucleosomal binding domain 2(HMGN2),
           mRNA, RefSeq: NM_005517.1
          Length = 1092

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 255 aggcttgggctctggctttgg 235



to top

>dbj|AK079536.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230035L15 product:nucleolar
           protein 3 (apoptosis repressor with CARD domain) [Homo
           sapiens]., full insert sequence
          Length = 1620

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 774 cggctcgggctcgggttcgggttctggctcgggctccggct 734



to top

>ref|NG_000892.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17-like 2 (HMG17L2) pseudogene on chromosome 22
          Length = 465

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203



to top

>ref|NG_001142.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17 pseudogene 2 (HMG17P2) on chromosome 6
          Length = 1308

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 287 aggcttgggctctggctttgg 267



to top

>ref|NG_002646.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17-like 1 (HMG17L1) pseudogene on chromosome 22
          Length = 1660

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 619 aggcttgggctctggctttgg 599



to top

>dbj|AK053846.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130314L04 product:apoptosis repressor
           with CARD domain [Homo sapiens], full insert sequence
          Length = 2870

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 743 cggctcgggctcgggttcgggttctggctcgggctccggct 703



to top

>dbj|AK021023.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
           enriched library, clone:B430311C09 product:apoptosis
           repressor with CARD domain [Homo sapiens], full insert
           sequence
          Length = 927

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 688 cggctcgggctcgggttcgggttctggctcgggctccggct 648



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 313      tcggctctggcttgggttcaggttttggc 341
                ||||||| || ||||||||||||||||||
Sbjct: 13313504 tcggctcaggtttgggttcaggttttggc 13313476



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 189      ggttcgggttcaggcttgggctctggcttagg 220
                |||| |||||||||||| ||||| ||||||||
Sbjct: 13301053 ggtttgggttcaggctttggctccggcttagg 13301084



to top

>gb|DQ015919.1| Homo sapiens tight junction protein 1 (zona occludens 1) (TJP1) gene,
             complete cds
          Length = 125625

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 92962 aggcttgggctctggctttgg 92982



to top

>gb|DQ000559.1| Synthetic construct clone PSF:109216 high mobility group protein 17
           gene, complete cds
          Length = 345

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 195 aggcttgggctctggctttgg 175



to top

>gb|AC117394.10| Homo sapiens 3 BAC RP11-529G21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 198170

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 168343 aggcttgggctctggctttgg 168363



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 197    ttcaggcttgggctctggctt 217
              |||||||||||||||||||||
Sbjct: 168340 ttcaggcttgggctctggctt 168360



to top

>gb|BC029638.1| Homo sapiens, Similar to high-mobility group (nonhistone
           chromosomal) protein 17, clone IMAGE:4777228, mRNA
          Length = 1295

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 379 aggcttgggctctggctttgg 359



to top

>ref|NM_001003101.1| Canis familiaris non-histone chromosomal protein HMG-17 (HMG-17),
           mRNA
          Length = 656

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188



to top

>gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complete sequence
          Length = 173169

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 131885 aggcttgggctctggctttgg 131905



to top

>gb|AC007395.3|AC007395 Homo sapiens BAC clone RP11-504O1 from 2, complete sequence
          Length = 158458

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 109708 aggcttgggctctggctttgg 109688



to top

>gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p, complete sequence
          Length = 173842

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 117509 aggcttgggctctggctttgg 117489



to top

>gb|AF198109.1|AF198109 Trichomonas vaginalis eukaryotic release factor 3 GTPase subunit
           (erf3) gene, complete cds
          Length = 2242

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 ggcttgggctctggttttggc 251
           |||||||||||||||||||||
Sbjct: 585 ggcttgggctctggttttggc 565



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 207 ggctctggcttaggcatgggttgaggcttgggctctggttttgg 250
           |||| ||||| |||| ||||||  ||||| ||||||||||||||
Sbjct: 537 ggctttggctcaggcttgggttctggctttggctctggttttgg 494



to top

>dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1123_B01
          Length = 105736

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 313   tcggctctggcttgggttcaggttttggc 341
             ||||||| || ||||||||||||||||||
Sbjct: 27942 tcggctcaggtttgggttcaggttttggc 27914



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 189   ggttcgggttcaggcttgggctctggcttagg 220
             |||| |||||||||||| ||||| ||||||||
Sbjct: 15491 ggtttgggttcaggctttggctccggcttagg 15522



to top

>dbj|AP004264.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0025D09
          Length = 142593

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 313    tcggctctggcttgggttcaggttttggc 341
              ||||||| || ||||||||||||||||||
Sbjct: 101367 tcggctcaggtttgggttcaggttttggc 101339



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 189   ggttcgggttcaggcttgggctctggcttagg 220
             |||| |||||||||||| ||||| ||||||||
Sbjct: 88916 ggtttgggttcaggctttggctccggcttagg 88947



to top

>dbj|AK026562.1| Homo sapiens cDNA: FLJ22909 fis, clone KAT05694, highly similar to
           HUMHMG17 Human non-histone chromosomal protein HMG-17
           mRNA
          Length = 1164

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 167 aggcttgggctctggctttgg 147



to top

>dbj|AK105945.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-C04, full
           insert sequence
          Length = 1088

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 313 tcggctctggcttgggttcaggttttggc 341
           ||||||| || ||||||||||||||||||
Sbjct: 668 tcggctcaggtttgggttcaggttttggc 640



to top

>gb|BC071707.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:87991 IMAGE:3849426), complete cds
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198



to top

>gb|BC027290.1| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain), mRNA (cDNA clone MGC:27734 IMAGE:2647023),
           complete cds
          Length = 1022

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 769 cggctcgggctcgggttcgggttctggctcgggctccggct 729



to top

>gb|BC032140.2| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:29711 IMAGE:5021546), complete cds
          Length = 1265

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 217 aggcttgggctctggctttgg 197



to top

>emb|AL163052.4|CNS01RIB Human chromosome 14 DNA sequence BAC R-769B21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181905

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 34283 aggcttgggctctggctttgg 34263



to top

>emb|AL160236.4|CNS01RH0 Human chromosome 14 DNA sequence BAC R-193F5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192401

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 46598 aggcttgggctctggctttgg 46578



to top

>gb|BC099178.1| Rattus norvegicus high mobility group nucleosomal binding domain 2,
           mRNA (cDNA clone MGC:116347 IMAGE:7383003), complete cds
          Length = 1240

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 245 aggcttgggctctggctttgg 225



to top

>gb|BC099815.1| Rattus norvegicus high mobility group nucleosomal binding domain 2,
           mRNA (cDNA clone MGC:124667 IMAGE:7929654), complete cds
          Length = 1228

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 254 aggcttgggctctggctttgg 234



to top

>ref|NM_001025624.1| Rattus norvegicus high mobility group nucleosomal binding domain 2
           (Hmgn2), mRNA
          Length = 1240

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 245 aggcttgggctctggctttgg 225



to top

>gb|BC053971.1| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain), mRNA (cDNA clone IMAGE:1397304)
          Length = 960

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 176 cggctccggcttgggttcgggttcaggcttgggctctggct 216
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 714 cggctcgggctcgggttcgggttctggctcgggctccggct 674



to top

>gb|BC003689.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone IMAGE:3455121)
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 189 aggcttgggctctggctttgg 169



to top

>gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome 14, complete sequence
          Length = 255753

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 260   aggcttgggctctggctttgg 280
             |||||||||||||||||||||
Sbjct: 76218 aggcttgggctctggctttgg 76198



to top

>ref|NM_020810.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae)
            (TRMT5), mRNA
          Length = 5272

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 4379 aggcttgggctctggctttgg 4359



to top

>emb|AL732319.17| Mouse DNA sequence from clone RP23-180O4 on chromosome X, complete
              sequence
          Length = 151503

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 139040 aggcttgggctctggctttgg 139020



to top

>emb|AL844586.5| Mouse DNA sequence from clone RP23-259N17 on chromosome 2, complete
              sequence
          Length = 181467

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 260    aggcttgggctctggctttgg 280
              |||||||||||||||||||||
Sbjct: 170594 aggcttgggctctggctttgg 170614



to top

>emb|AL844537.5| Mouse DNA sequence from clone RP23-448A16 on chromosome 2, complete
            sequence
          Length = 185541

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 5931 aggcttgggctctggctttgg 5911



to top

>gb|M12623.1|HUMHMG17 Human non-histone chromosomal protein HMG-17 mRNA, complete cds
          Length = 1187

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191



to top

>emb|AJ388518.1|CFA388518 Canis familiaris mRNA for non-histone chromosomal protein HMG-17
           (hmg-17 gene)
          Length = 656

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188



to top

>emb|X06444.1|HSHMG17P Human retropseudogene for chromosomal protein HMG-17 (clone 60H)
          Length = 1392

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 260 aggcttgggctctggctttgg 280
           |||||||||||||||||||||
Sbjct: 371 aggcttgggctctggctttgg 351



to top

>emb|X13546.1|HSHMG17G Human HMG-17 gene for non-histone chromosomal protein HMG-17
          Length = 7195

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 4002 aggcttgggctctggctttgg 3982



to top

>dbj|AB037814.1| Homo sapiens mRNA for KIAA1393 protein, partial cds
          Length = 5164

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 260  aggcttgggctctggctttgg 280
            |||||||||||||||||||||
Sbjct: 4273 aggcttgggctctggctttgg 4253



to top

>gb|U80815.2| Caenorhabditis elegans cosmid W02C12, complete sequence
          Length = 22847

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 213  ggcttaggcatgggttgaggcttgggct 240
            |||||||||||||| |||||||| ||||
Sbjct: 8200 ggcttaggcatgggctgaggcttaggct 8173



to top

>ref|XM_477690.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1057

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 189 ggttcgggttcaggcttgggctctggcttagg 220
           |||| |||||||||||| ||||| ||||||||
Sbjct: 660 ggtttgggttcaggctttggctccggcttagg 629



to top

>ref|XM_360938.1| Magnaporthe grisea 70-15 hypothetical protein (MG03481.4) partial
            mRNA
          Length = 2076

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  ggttcgggttcaggcttggg 208
            ||||||||||||||||||||
Sbjct: 1358 ggttcgggttcaggcttggg 1339



to top

>gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome 15, complete sequence
          Length = 198894

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 323    cttgggttcaggttttggca 342
              ||||||||||||||||||||
Sbjct: 186195 cttgggttcaggttttggca 186214



to top

>ref|NM_008169.1| Mus musculus glutamate receptor, ionotropic, NMDA1 (zeta 1) (Grin1),
            mRNA
          Length = 3031

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  gctccggctttggcatcggc 317
            ||||||||||||||||||||
Sbjct: 2357 gctccggctttggcatcggc 2376



to top

>ref|NM_003632.1| Homo sapiens contactin associated protein 1 (CNTNAP1), mRNA
          Length = 5293

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 176 cggctccggcttgggttcgggttcaggcttgggctc 211
           ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 180 cggctccggctagggctcgagttctggcttgggctc 145



to top

>emb|Z93375.1|CEC38C6 Caenorhabditis elegans Cosmid C38C6, complete sequence
          Length = 25943

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 194  gggttcaggcttgggctctggcttaggc 221
            |||||||||||| |||| ||||||||||
Sbjct: 2139 gggttcaggcttaggctttggcttaggc 2112



to top

>gb|BC039157.1| Mus musculus glutamate receptor, ionotropic, NMDA1 (zeta 1), mRNA
            (cDNA clone MGC:25375 IMAGE:4507986), complete cds
          Length = 3776

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  gctccggctttggcatcggc 317
            ||||||||||||||||||||
Sbjct: 2481 gctccggctttggcatcggc 2500



to top

>gb|AF036699.2| Caenorhabditis elegans cosmid F58F6, complete sequence
          Length = 43764

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 213   ggcttaggcatgggttgaggcttgggct 240
             |||||||||||||||||| |||| ||||
Sbjct: 30666 ggcttaggcatgggttgatgcttaggct 30639



to top

>emb|AL158139.26| Human DNA sequence from clone RP1-80B9 on chromosome 6 Contains the 5'
              end of the GMDS gene for GDP-mannose 4,6-dehydratase, a
              novel gene and a CpG island, complete sequence
          Length = 130403

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    ggcttgggctctggctttgg 280
              ||||||||||||||||||||
Sbjct: 112204 ggcttgggctctggctttgg 112185



to top

>emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chromosome 1q25.1-31.1
             Contains the 3' end of the RGSL1 gene for regulator of
             G-protein signalling like 1, the RNASEL gene for
             ribonuclease L (2',5'-oligoisoadenylate
             synthetase-dependent) and a CpG island, complete sequence
          Length = 100549

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gaatacaaggaatgcaaaaa 20
             ||||||||||||||||||||
Sbjct: 33258 gaatacaaggaatgcaaaaa 33277



to top

>gb|AC153008.4| Mus musculus BAC clone RP23-457I7 from chromosome 15, complete sequence
          Length = 171878

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 323   cttgggttcaggttttggca 342
             ||||||||||||||||||||
Sbjct: 49481 cttgggttcaggttttggca 49500



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 173     aggcggctccggcttgggttcggg 196
               |||||||||||||||||| |||||
Sbjct: 3480483 aggcggctccggcttgggctcggg 3480506



to top

>dbj|AK158175.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
            library, clone:F930037O14 product:glutamate receptor,
            ionotropic, NMDA1 (zeta 1), full insert sequence
          Length = 3834

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  gctccggctttggcatcggc 317
            ||||||||||||||||||||
Sbjct: 2566 gctccggctttggcatcggc 2585



to top

>dbj|AK087384.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130003G02 product:glutamate receptor,
           ionotropic, NMDA1 (zeta 1), full insert sequence
          Length = 1371

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 gctccggctttggcatcggc 317
           ||||||||||||||||||||
Sbjct: 583 gctccggctttggcatcggc 564



to top

>dbj|AK076389.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:4732488C07 product:unclassifiable, full
           insert sequence
          Length = 2859

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 gctccggctttggcatcggc 317
           ||||||||||||||||||||
Sbjct: 547 gctccggctttggcatcggc 528



to top

>ref|NM_061930.2| Caenorhabditis elegans F34D6.1 (F34D6.1) mRNA, complete cds
          Length = 1525

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 213  ggcttaggcatgggttgaggcttgggct 240
            ||||||||| |||| |||||||||||||
Sbjct: 1431 ggcttaggcttgggctgaggcttgggct 1404



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 97      ggtcgatctcctcctccttcggct 120
               ||||||||||||||||||| ||||
Sbjct: 8641318 ggtcgatctcctcctcctttggct 8641295



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    tcctcctccttcggctgtca 124
              ||||||||||||||||||||
Sbjct: 301516 tcctcctccttcggctgtca 301497



to top

>emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 in linkage group 23,
             complete sequence
          Length = 182479

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 177   ggctccggcttgggttcgggttcaggcttgggctctggct 216
             ||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 33139 ggctcgggctcgggttcgggttcgggctcgggctcgggct 33178



to top

>gb|AE004965.1| Pseudomonas aeruginosa PAO1, section 526 of 529 of the complete
            genome
          Length = 10353

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  ggcggctccggcttgggttc 193
            ||||||||||||||||||||
Sbjct: 8235 ggcggctccggcttgggttc 8254



to top

>gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 211550

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 2      aatacaaggaatgcaaaaaagatg 25
              ||||||||||||||||| ||||||
Sbjct: 209378 aatacaaggaatgcaaagaagatg 209401



to top

>gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, complete sequence
          Length = 134465

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 176   cggctccggcttgggttcgggttcaggcttgggctc 211
             ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 20565 cggctccggctagggctcgagttctggcttgggctc 20530



to top

>dbj|AP003062.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-555G19, complete
              sequence
          Length = 171428

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    gtaaggcttgggctctggct 276
              ||||||||||||||||||||
Sbjct: 153257 gtaaggcttgggctctggct 153238



to top

>gb|AF221552.1|AF221552 Oryza sativa proline-rich protein RiP-15 mRNA, partial cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 314 cggctctggcttgggttcaggttttggc 341
           ||||||||||||||| | ||||||||||
Sbjct: 215 cggctctggcttgggcttaggttttggc 188



to top

>dbj|AK105956.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-D07, full
           insert sequence
          Length = 1057

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 189 ggttcgggttcaggcttgggctctggcttagg 220
           |||| |||||||||||| ||||| ||||||||
Sbjct: 660 ggtttgggttcaggctttggctccggcttagg 629



to top

>gb|AF025454.1| Caenorhabditis elegans cosmid F34D6, complete sequence
          Length = 23656

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 213 ggcttaggcatgggttgaggcttgggct 240
           ||||||||| |||| |||||||||||||
Sbjct: 719 ggcttaggcttgggctgaggcttgggct 746



to top

>emb|BX927356.22| Zebrafish DNA sequence from clone DKEY-54K20 in linkage group 17,
             complete sequence
          Length = 204195

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   ggcttgggttcaggttttgg 340
             ||||||||||||||||||||
Sbjct: 97960 ggcttgggttcaggttttgg 97979



to top

>gb|U87223.1|HSU87223 Homo sapiens contactin associated protein (Caspr) mRNA, complete
           cds
          Length = 5293

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 176 cggctccggcttgggttcgggttcaggcttgggctc 211
           ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 180 cggctccggctagggctcgagttctggcttgggctc 145



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    tcctcctccttcggctgtca 124
              ||||||||||||||||||||
Sbjct: 301516 tcctcctccttcggctgtca 301497



to top

>emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065B15,
              complete sequence
          Length = 150007

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     ggtcgatctcctcctccttcggct 120
              ||||||||||||||||||| ||||
Sbjct: 101761 ggtcgatctcctcctcctttggct 101738



to top

>emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa0032J07 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 160673

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 105  tcctcctccttcggctgtca 124
            ||||||||||||||||||||
Sbjct: 3477 tcctcctccttcggctgtca 3496



to top

>emb|AL935141.16| Zebrafish DNA sequence from clone CH211-173A9 in linkage group 17,
            complete sequence
          Length = 136178

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 321  ggcttgggttcaggttttgg 340
            ||||||||||||||||||||
Sbjct: 8442 ggcttgggttcaggttttgg 8423



to top

>emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa0010K05 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 164143

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  tcctcctccttcggctgtca 124
            ||||||||||||||||||||
Sbjct: 8834 tcctcctccttcggctgtca 8815



to top

>gb|U23764.1|PAU23764 Pseudomonas aeruginosa TonB (tonB) gene, complete cds
          Length = 1200

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 174 ggcggctccggcttgggttc 193
           ||||||||||||||||||||
Sbjct: 593 ggcggctccggcttgggttc 574



to top

>gb|AF040654.3| Caenorhabditis elegans cosmid R06B10, complete sequence
          Length = 40468

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 200  aggcttgggctctggcttaggcatgggttgaggcttgggctctggttttggc 251
            ||||||||||| || ||||||| | |||| |||||| ||||| || ||||||
Sbjct: 9008 aggcttgggctttgacttaggctttggtttaggctttggctcaggctttggc 8957



to top

>emb|AL732309.9| Mouse DNA sequence from clone RP23-132N23 on chromosome 2, complete
              sequence
          Length = 221859

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    gctccggctttggcatcggc 317
              ||||||||||||||||||||
Sbjct: 189249 gctccggctttggcatcggc 189230



to top

>dbj|D10028.1|MUSGLURZ1 Mus musculus mRNA for glutamate receptor channel subunit zeta-1,
            complete cds
          Length = 3031

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  gctccggctttggcatcggc 317
            ||||||||||||||||||||
Sbjct: 2357 gctccggctttggcatcggc 2376


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,008,576
Number of Sequences: 3902068
Number of extensions: 3008576
Number of successful extensions: 63418
Number of sequences better than 10.0: 182
Number of HSP's better than 10.0 without gapping: 182
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62413
Number of HSP's gapped (non-prelim): 984
length of query: 368
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 346
effective length of database: 17,147,199,772
effective search space: 5932931121112
effective search space used: 5932931121112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top