>emb|AL121983.13|HSA160H22 Human DNA sequence from clone RP11-160H22 on chromosome 1q23.2-24.3
Contains three novel genes, a ribosomal protein L30
(RPL30) pseudogene, the 3' end of a novel gene, the 5' end
of a novel gene (KIAA2025) and a CpG island, complete
sequence
Length = 165436
Score = 44.1 bits (22), Expect = 0.65
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 654 gagtctaggagtttgcaaccag 675
||||||||||||||||||||||
Sbjct: 23942 gagtctaggagtttgcaaccag 23921
>emb|AL935042.6| Human DNA sequence from clone DAQB-96B10 on chromosome 6 Contains the
HLA-Z pseudogene for major histocompatibility complex,
class I, Z, the HLA-DMB gene for major histocompatibility
complex, class II, DM beta, the HLA-DMA gene for major
histocompatibility complex, class II, DM alpha, the 5' end
of the BRD2 gene for bromodomain containing 2 and 3 CpG
islands, complete sequence
Length = 95788
Score = 42.1 bits (21), Expect = 2.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 238 ggctgctccactccagcacga 258
|||||||||||||||||||||
Sbjct: 90960 ggctgctccactccagcacga 90940
>emb|AL645941.11| Human DNA sequence from clone XXbac-181M17 on chromosome 6 contains the
HLA-DMB gene for major histocompatibility complex, class
II, DM beta, the HLA-DMA gene for major histocompatibility
complex, class II, DM alpha, the BRD2 gene for bromodomain
containing 2 and two CpG islands, complete sequence
Length = 71501
Score = 42.1 bits (21), Expect = 2.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 238 ggctgctccactccagcacga 258
|||||||||||||||||||||
Sbjct: 49661 ggctgctccactccagcacga 49641
>emb|AL662845.5| Human DNA sequence from clone XXbac-136A3 on chromosome 6 contains the
HLA-DMB gene for major histocompatibility complex, class
II, DM beta, the HLA-DMA gene for major histocompatibility
complex, class II, DM alpha, the BRD2 gene for bromodomain
containing 2, the HLA-DOA gene for major
histocompatibility complex, class II, DO alpha and two CpG
islands, complete sequence
Length = 97128
Score = 42.1 bits (21), Expect = 2.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 238 ggctgctccactccagcacga 258
|||||||||||||||||||||
Sbjct: 49675 ggctgctccactccagcacga 49655
>gb|M80613.1|HUMFSHG Human homolog of Drosophila female sterile homeotic mRNA, complete
cds
Length = 4053
Score = 42.1 bits (21), Expect = 2.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 238 ggctgctccactccagcacga 258
|||||||||||||||||||||
Sbjct: 362 ggctgctccactccagcacga 342
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,035,573
Number of Sequences: 3902068
Number of extensions: 6035573
Number of successful extensions: 130230
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 129876
Number of HSP's gapped (non-prelim): 343
length of query: 737
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 714
effective length of database: 17,143,297,704
effective search space: 12240314560656
effective search space used: 12240314560656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)