ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd22e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY104639.1| Zea mays PCO082260 mRNA sequence 153 8e-34
2ref|XM_465991.1| Oryza sativa (japonica cultivar-group), mRNA 149 1e-32
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
4dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
5ref|NM_125531.2| Arabidopsis thaliana TOC1 (TIMING OF CAB1 1); t... 64 6e-07
6gb|AY094393.1| Arabidopsis thaliana AT5g61380/mfb13_150 mRNA, co... 64 6e-07
7gb|AF272039.1|AF272039 Arabidopsis thaliana timing of CAB expres... 64 6e-07
8gb|BT005816.1| Arabidopsis thaliana At5g61380/mfb13_150 gene, co... 64 6e-07
9dbj|AB041530.1| Arabidopsis thaliana APRR1 mRNA for pseudo-respo... 64 6e-07
10dbj|AB010073.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 64 6e-07
11emb|AJ251086.1|ATH251086 Arabidopsis thaliana mRNA for ABI3-inte... 64 6e-07
12gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, com... 58 4e-05
13ref|XM_456745.1| Debaryomyces hansenii CBS767 hypothetical prote... 58 4e-05
14emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS... 58 4e-05
15gb|AC120405.7| Mus musculus chromosome 1, clone RP24-409F22, com... 56 1e-04
16ref|XM_632233.1| Dictyostelium discoideum hypothetical protein (... 56 1e-04
17gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, com... 56 1e-04
18gb|AC164310.2| Mus musculus BAC clone RP23-139E15 from chromosom... 56 1e-04
19gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosom... 56 1e-04
20gb|AC157569.12| Mus musculus chromosome 3, clone RP23-434M21, co... 56 1e-04
21gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, comp... 56 1e-04
22gb|AC102923.10| Mus musculus chromosome 1, clone RP24-262J2, com... 56 1e-04
23gb|AC160339.2| Mus musculus BAC clone RP23-410O11 from chromosom... 56 1e-04
24gb|AC147229.5| Mus musculus BAC clone RP23-236E9 from chromosome... 56 1e-04
25gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, c... 56 1e-04
26gb|AC112081.8| Rattus norvegicus 7 BAC CH230-192B8 (Children's H... 56 1e-04
27gb|AC165313.7| Mus musculus chromosome 5, clone RP24-294J23, com... 56 1e-04
28gb|AC159888.2| Mus musculus BAC clone RP24-133O9 from chromosome... 56 1e-04
29gb|AC165335.3| Mus musculus BAC clone RP24-481H19 from chromosom... 56 1e-04
30gb|AC140206.2| Mus musculus BAC clone RP24-446O8 from chromosome... 56 1e-04
31gb|AC125194.4| Mus musculus BAC clone RP23-275K6 from chromosome... 56 1e-04
32gb|AC099863.14| Mus musculus chromosome 3, clone RP23-6F2, compl... 56 1e-04
33gb|AC147147.2| Pan troglodytes BAC clone CH251-230I19 from Y, co... 56 1e-04
34emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chr... 56 1e-04
35gb|AC146452.3| Pan troglodytes BAC clone CH251-483N3 from Y, com... 56 1e-04
36gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome... 56 1e-04
37gb|AC124590.4| Mus musculus BAC clone RP23-133P12 from chromosom... 56 1e-04
38gb|AC129335.4| Mus musculus BAC clone RP23-109H7 from chromosome... 56 1e-04
39gb|AC122465.4| Mus musculus BAC clone RP24-304I22 from chromosom... 56 1e-04
40gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome ... 56 1e-04
41gb|AC137605.3| Mus musculus BAC clone RP23-117H14 from 19, compl... 56 1e-04
42gb|AC121596.3| Mus musculus BAC clone RP23-299I20 from 14, compl... 56 1e-04
43gb|AC121790.2| Mus musculus BAC clone RP23-399J19 from 1, comple... 56 1e-04
44gb|AC121568.3| Mus musculus BAC clone RP23-226F18 from 15, compl... 56 1e-04
45ref|XM_721456.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 56 1e-04
46gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complet... 56 1e-04
47gb|AC118734.11| Mus musculus chromosome 18, clone RP24-170D17, c... 56 1e-04
48gb|AC115754.7| Mus musculus chromosome 12, clone RP23-34D20, com... 56 1e-04
49gb|AC156606.12| Mus musculus chromosome 7, clone RP23-78N8, comp... 56 1e-04
50emb|AL713851.8| Human DNA sequence from clone RP11-526P5 on chro... 56 1e-04
51emb|AL646099.4| Human DNA sequence from clone RP11-65B7 on chrom... 56 1e-04
52emb|AL445666.9| Human DNA sequence from clone RP11-262H5 on chro... 56 1e-04
53gb|AC164436.2| Mus musculus BAC clone RP23-134C5 from chromosome... 56 1e-04
54gb|AC161606.5| Mus musculus BAC clone RP23-232M18 from chromosom... 56 1e-04
55gb|AC160551.4| Mus musculus chromosome 5, clone RP23-296C20, com... 56 1e-04
56gb|AF330005.1|AF330003S3 Mus musculus USG protein (USG) gene, ex... 56 1e-04
57emb|AL713921.15| Mouse DNA sequence from clone RP23-475A8 on chr... 56 1e-04
58gb|AC092897.6| Homo sapiens 3 BAC RP11-292P2 (Roswell Park Cance... 56 1e-04
59gb|AC154399.5| Mus musculus chromosome 3, clone RP24-295P14, com... 56 1e-04
60gb|AC079097.6| Homo sapiens chromosome 8, clone RP11-98P2, compl... 56 1e-04
61dbj|BS000574.1| Pan troglodytes chromosome Y clone:PTB-031D23, c... 56 1e-04
62gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 56 1e-04
63gb|AC055710.10| Homo sapiens 3 BAC RP11-307E22 (Roswell Park Can... 56 1e-04
64gb|AC024908.22| Homo sapiens 10 BAC RP11-446F3 (Roswell Park Can... 56 1e-04
65gb|DQ393822.1| Melampsora lini microsatellite Ml-27 sequence 56 1e-04
66gb|AC101817.13| Mus musculus chromosome 15, clone RP24-359I22, c... 56 1e-04
67gb|AC000052.16| Homo sapiens Chromosome 22q11.2 BAC Clone 77h2 I... 56 1e-04
68gb|AC004019.20| Homo sapiens Chromosome 22q11.2 BAC Clone 357f7 ... 56 1e-04
69gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosom... 56 1e-04
70gb|AC115775.12| Mus musculus chromosome 8, clone RP23-125P1, com... 56 1e-04
71gb|AC111002.5| Homo sapiens BAC clone RP11-196C8 from 2, complet... 56 1e-04
72gb|AC104638.11| Homo sapiens 3 BAC RP11-689C17 (Roswell Park Can... 56 1e-04
73gb|AC157988.5| Mus musculus chromosome 3, clone RP23-149E4, comp... 56 1e-04
74emb|BX510350.14| Mouse DNA sequence from clone RP23-123H13 on ch... 56 1e-04
75emb|AL928568.17| Mouse DNA sequence from clone RP23-396N8 on chr... 56 1e-04
76gb|AC144942.4| Mus musculus BAC clone RP23-402N21 from 10, compl... 56 1e-04
77emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chr... 56 1e-04
78gb|AC155159.2| Mus musculus BAC clone RP24-482D1 from 18, comple... 56 1e-04
79gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complet... 56 1e-04
80emb|CT571252.9| Mouse DNA sequence from clone RP24-91J7 on chrom... 56 1e-04
81emb|AM087210.1| Phascogale tapoatafa partial adra2b gene for alp... 56 1e-04
82gb|AC123620.14| Mus musculus chromosome 12, clone RP23-53J21, co... 56 1e-04
83emb|AL772216.15| Mouse DNA sequence from clone RP23-153M22 on ch... 56 1e-04
84gb|AC116589.5| Mus musculus BAC clone RP24-65K2 from 13, complet... 56 1e-04
85gb|AC132334.3| Mus musculus BAC clone RP24-228N8 from 6, complet... 56 1e-04
86gb|AC127698.5| Mus musculus BAC clone RP24-113N24 from 3, comple... 56 1e-04
87gb|AC112259.4| Mus musculus BAC clone RP23-179F7 from 12, comple... 56 1e-04
88gb|AC134614.4| Mus musculus BAC clone RP23-148D12 from 14, compl... 56 1e-04
89gb|AC134571.4| Mus musculus BAC clone RP23-435E17 from 3, comple... 56 1e-04
90gb|AC123548.4| Mus musculus BAC clone RP23-441J16 from 6, comple... 56 1e-04
91emb|AL772171.7| Mouse DNA sequence from clone RP23-36B3 on chrom... 56 1e-04
92gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, co... 56 1e-04
93emb|AL808126.10| Mouse DNA sequence from clone RP23-37B4 on chro... 56 1e-04
94emb|AL929001.7| Mouse DNA sequence from clone RP23-324H1 on chro... 56 1e-04
95emb|AL158800.6|CNS01RGM Human chromosome 14 DNA sequence BAC R-3... 56 1e-04
96emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chr... 56 1e-04
97emb|AL672251.10| Mouse DNA sequence from clone RP23-16O15 on chr... 56 1e-04
98gb|AC107237.7| Mus musculus chromosome 3, clone RP23-475B9, comp... 56 1e-04
99emb|AL845498.9| Mouse DNA sequence from clone RP23-222D20 on chr... 56 1e-04
100emb|AL844162.9| Mouse DNA sequence from clone RP23-160O12 on chr... 56 1e-04
101emb|AL731826.12| Mouse DNA sequence from clone RP23-123O12 on ch... 56 1e-04
102emb|AL671993.7| Mouse DNA sequence from clone RP23-428E5 on chro... 56 1e-04
103emb|AL732459.5| Mouse DNA sequence from clone RP23-115J4 on chro... 56 1e-04
104gb|AC101660.25| Mus musculus chromosome 15, clone RP23-4I22, com... 56 1e-04
105gb|AC118599.24| Mus musculus chromosome 5, clone RP23-459G5, com... 56 1e-04
106gb|AC162441.11| Mus musculus chromosome 1, clone RP23-2E23, comp... 56 1e-04
107dbj|AB018492.1| Homo sapiens DNA, trinucleotide repeats region, ... 56 1e-04
108dbj|AB018525.1| Homo sapiens DNA, trinucleotide repeats region, ... 56 1e-04
109emb|AL844557.3| Mouse DNA sequence from clone RP23-203N14 on chr... 56 1e-04
110gb|AC152418.5| Mus musculus BAC clone RP23-7L11 from chromosome ... 54 6e-04
111gb|AC120870.8| Mus musculus chromosome 1, clone RP23-15D1, compl... 54 6e-04
112ref|XM_324419.1| Neurospora crassa OR74A hypothetical protein (N... 54 6e-04
113ref|XM_951344.1| Neurospora crassa OR74A hypothetical protein (N... 54 6e-04
114gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, com... 54 6e-04
115gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, com... 54 6e-04
116gb|AC154710.2| Mus musculus BAC clone RP24-357L12 from chromosom... 54 6e-04
117gb|AC092920.7| Homo sapiens 3 BAC RP11-255G21 (Roswell Park Canc... 54 6e-04
118gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, comple... 54 6e-04
119gb|AC102790.7| Mus musculus chromosome 19, clone RP23-321D22, co... 54 6e-04
120emb|AL669946.9| Mouse DNA sequence from clone RP23-71G18 on chro... 54 6e-04
121gb|AC106857.8| Homo sapiens chromosome 8, clone RP11-262O21, com... 54 6e-04
122gb|AC022666.14| Homo sapiens, clone RP11-30K7, complete sequence 54 6e-04
123emb|BX842600.1| Neurospora crassa DNA linkage group II BAC clone... 54 6e-04
124gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, com... 54 6e-04
125emb|CT573019.12| Mouse DNA sequence from clone RP24-94G12 on chr... 54 6e-04
126gb|AC149277.11| Mus musculus BAC clone RP24-213J23 from chromoso... 54 6e-04
127gb|AC109606.11| Mus musculus strain C57BL/6J chromosome 5 clone ... 54 6e-04
128gb|AC137515.3| Mus musculus BAC clone RP23-258C20 from 1, comple... 54 6e-04
129gb|AC154329.3| Mus musculus BAC clone RP23-266K11 from chromosom... 54 6e-04
130emb|AL929446.5| Mouse DNA sequence from clone RP23-177M10 on chr... 54 6e-04
131ref|NM_202851.1| Arabidopsis thaliana electron carrier AT4G20830... 52 0.002
132ref|NM_118201.2| Arabidopsis thaliana electron carrier AT4G20830... 52 0.002
133ref|XM_511299.1| PREDICTED: Pan troglodytes similar to Zinc fing... 52 0.002
134ref|XM_518365.1| PREDICTED: Pan troglodytes similar to HLA-B ass... 52 0.002
135gb|AY439179.1|AY439178S2 Drosophila virilis troponin T (TpnT) ge... 52 0.002
136gb|AC158909.6| Mus musculus chromosome 1, clone RP23-118K4, comp... 52 0.002
137gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 52 0.002
138gb|AF109906.1|MMHC310M6 Mus musculus MHC class III region RD gen... 52 0.002
139gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's H... 52 0.002
140ref|XM_715405.1| Candida albicans SC5314 putative transcription ... 52 0.002
141ref|XM_715174.1| Candida albicans SC5314 putative transcription ... 52 0.002
142gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome... 52 0.002
143gb|AC158521.2| Mus musculus BAC clone RP23-404M10 from chromosom... 52 0.002
144gb|AY422088.1| Astatotilapia burtoni neuroD (nrd) mRNA, complete... 52 0.002
145emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chro... 52 0.002
146ref|XM_386228.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 52 0.002
147gb|BC079005.1| Rattus norvegicus eukaryotic translation initiati... 52 0.002
148gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome ... 52 0.002
149ref|XM_807566.1| Trypanosoma cruzi strain CL Brener flagellar ra... 52 0.002
150gb|AC124455.6| Mus musculus BAC clone RP24-129J9 from chromosome... 52 0.002
151gb|AC104920.10| Mus musculus chromosome 10, clone RP23-360H23, c... 52 0.002
152ref|XM_721940.1| Plasmodium yoelii yoelii str. 17XNL DNA repair ... 52 0.002
153ref|XM_664868.1| Plasmodium berghei strain ANKA hypothetical pro... 52 0.002
154ref|XM_675000.1| Plasmodium berghei strain ANKA hypothetical pro... 52 0.002
155ref|XM_661959.1| Cryptosporidium hominis TU502 trehalose synthas... 52 0.002
156ref|NM_001004283.1| Rattus norvegicus eukaryotic translation ini... 52 0.002
157emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 52 0.002
158emb|X69838.1|HSG9A H.sapiens mRNA for G9a 52 0.002
159emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 52 0.002
160emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 52 0.002
161emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chrom... 52 0.002
162ref|NM_145830.1| Mus musculus euchromatic histone lysine N-methy... 52 0.002
163ref|NM_147151.1| Mus musculus euchromatic histone lysine N-methy... 52 0.002
164emb|AL354795.17| Human DNA sequence from clone RP11-174B4 on chr... 52 0.002
165gb|AY096621.1| Arabidopsis thaliana unknown protein (At5g55040) ... 52 0.002
166gb|AY074282.1| Arabidopsis thaliana unknown protein (At5g55040) ... 52 0.002
167gb|BC058357.1| Mus musculus euchromatic histone lysine N-methylt... 52 0.002
168emb|AL161553.2|ATCHRIV53 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
169emb|AL080254.1|ATF21C20 Arabidopsis thaliana DNA chromosome 4, B... 52 0.002
170emb|AJ315532.1|HSA315532 Homo sapiens mRNA for NG36/G9a protein 52 0.002
171gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, com... 52 0.002
172emb|CR936237.6| Human DNA sequence from clone DAAP-66K18 on chro... 52 0.002
173emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chr... 52 0.002
174emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chr... 52 0.002
175emb|CR759784.6| Human DNA sequence from clone DAMC-303C24 on chr... 52 0.002
176emb|BX005460.8| Human DNA sequence from clone DASS-36P22 on chro... 52 0.002
177emb|CR388219.12| Human DNA sequence from clone DADB-122G4 on chr... 52 0.002
178gb|AY133533.1| Arabidopsis thaliana At4g20830/F21C20_180 mRNA, c... 52 0.002
179gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, R... 52 0.002
180gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 m... 52 0.002
181ref|XM_631518.1| Dictyostelium discoideum AX4 hypothetical prote... 52 0.002
182gb|AY062595.1| Arabidopsis thaliana Unknown protein (F21C20.180:... 52 0.002
183dbj|AK154246.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 52 0.002
184gb|AC118231.9| Mus musculus chromosome 5, clone RP23-462J24, com... 52 0.002
185gb|AF424621.1|AF424621 Arabidopsis thaliana AT4g20830/F21C20_180... 52 0.002
186gb|BC020970.1| Homo sapiens euchromatic histone-lysine N-methylt... 52 0.002
187gb|BC018718.1| Homo sapiens euchromatic histone-lysine N-methylt... 52 0.002
188gb|BC002686.1| Homo sapiens euchromatic histone-lysine N-methylt... 52 0.002
189gb|BC009351.1| Homo sapiens euchromatic histone-lysine N-methylt... 52 0.002
190gb|AC159280.2| Mus musculus BAC clone RP23-347A2 from chromosome... 52 0.002
191ref|NM_025256.4| Homo sapiens euchromatic histone-lysine N-methy... 52 0.002
192ref|NM_006709.2| Homo sapiens euchromatic histone-lysine N-methy... 52 0.002
193emb|BX827154.1|CNS0A4MY Arabidopsis thaliana Full-length cDNA Co... 52 0.002
194emb|BX827481.1|CNS0A48P Arabidopsis thaliana Full-length cDNA Co... 52 0.002
195dbj|AB088213.1| Homo sapiens KIF1Bbeta mRNA for kinesin family m... 52 0.002
196dbj|AB088212.1| Homo sapiens KIF1Bbeta mRNA for kinesin family m... 52 0.002
197dbj|AB088211.1| Homo sapiens KIF1Bbeta mRNA for kinesin family m... 52 0.002
198dbj|AB088210.1| Homo sapiens KIF1Bbeta mRNA for kinesin family m... 52 0.002
199gb|AY211285.1| Eleutherodactylus noblei USNM534195 cellular myel... 52 0.002
200gb|AC154651.2| Mus musculus BAC clone RP24-261K2 from chromosome... 52 0.002
201gb|AC154187.2| Mus musculus BAC clone RP24-444N2 from chromosome... 52 0.002
202gb|AC007220.4|AC007220 Homo sapiens chromosome 16 clone RP11-396... 52 0.002
203dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 52 0.002
204dbj|AK196027.1| Mus musculus cDNA, clone:Y1G0120H08, strand:minu... 52 0.002
205dbj|AB017059.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
206gb|AC154591.2| Mus musculus BAC clone RP23-370M19 from 16, compl... 52 0.002
207emb|BX664748.8| Zebrafish DNA sequence from clone DKEY-3N7 in li... 52 0.002
208gb|AC123718.9| Mus musculus chromosome 1, clone RP23-401A11, com... 52 0.002
209dbj|AP001024.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 52 0.002
210emb|AL160231.4|CNS01RGW Human chromosome 14 DNA sequence BAC R-3... 52 0.002
211emb|AL133163.3|CNS01DU4 Human chromosome 14 DNA sequence BAC R-5... 52 0.002
212emb|CT025759.14| Mouse DNA sequence from clone RP24-317H19 on ch... 52 0.002
213gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, com... 52 0.002
214emb|CT009715.15| Mouse DNA sequence from clone RP23-85E24 on chr... 52 0.002
215gb|AC139294.4| Mus musculus BAC clone RP24-239E14 from 14, compl... 52 0.002
216gb|AC147986.3| Mus musculus BAC clone RP24-404L1 from 5, complet... 52 0.002
217gb|AC149608.4| Mus musculus BAC clone RP23-436E6 from 8, complet... 52 0.002
218dbj|AB209433.1| Homo sapiens mRNA for HLA-B associated transcrip... 52 0.002
219dbj|AB077210.1| Mus musculus mRNA for G9a long, complete cds 52 0.002
220dbj|AB077209.1| Mus musculus mRNA for G9a short, complete cds 52 0.002
221gb|U51583.1|RNU51583 Rattus norvegicus zinc finger homeodomain e... 52 0.002
222dbj|AB017133.1| Homo sapiens KIAA0591/KIF1Bbeta mRNA, complete cds 52 0.002
223emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the... 52 0.002
224gb|BT020470.1| Arabidopsis thaliana At2g33510 gene, complete cds 50 0.009
225ref|NM_117871.3| Arabidopsis thaliana unknown protein AT4G17620 ... 50 0.009
226ref|NM_001036577.1| Arabidopsis thaliana unknown protein AT4G176... 50 0.009
227ref|NM_128911.2| Arabidopsis thaliana unknown protein AT2G33510 ... 50 0.009
228gb|AC168073.4| Mus musculus BAC clone RP23-60N8 from chromosome ... 50 0.009
229ref|XM_642257.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
230gb|AC121821.3| Mus musculus chromosome 18 clone RP23-461O23, com... 50 0.009
231gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, com... 50 0.009
232ref|XM_636763.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
233ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
234ref|XM_635128.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
235ref|XM_635037.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
236ref|XM_629896.1| Dictyostelium discoideum hypothetical protein (... 50 0.009
237gb|AC166346.5| Mus musculus BAC clone RP24-83P13 from chromosome... 50 0.009
238gb|AC166832.2| Mus musculus BAC clone RP23-220N17 from chromosom... 50 0.009
239gb|AC117643.15| Mus musculus chromosome 8, clone RP23-237I20, co... 50 0.009
240gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 50 0.009
241gb|AC161219.4| Mus musculus chromosome 7, clone RP23-83E16, comp... 50 0.009
242gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete se... 50 0.009
243gb|AY228561.1| Perdix perdix clone LEI30 microsatellite sequence 50 0.009
244gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, co... 50 0.009
245gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, comp... 50 0.009
246gb|AC163489.5| Mus musculus chromosome 8, clone RP24-354I15, com... 50 0.009
247gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, c... 50 0.009
248gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 50 0.009
249ref|XM_957490.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.009
250ref|XM_326175.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.009
251gb|AY808382.1| Schistosoma japonicum SJCHGC09253 protein mRNA, p... 50 0.009
252gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome... 50 0.009
253ref|XM_715359.1| Candida albicans SC5314 hypothetical protein (C... 50 0.009
254ref|XM_715129.1| Candida albicans SC5314 hypothetical protein (C... 50 0.009
255ref|XM_706641.1| Candida albicans SC5314 hypothetical protein (C... 50 0.009
256ref|XM_652677.1| Aspergillus nidulans FGSC A4 hypothetical prote... 50 0.009
257gb|AC104318.2| Homo sapiens chromosome 8 clone RP11-291K24, comp... 50 0.009
258gb|AC116515.11| Mus musculus chromosome 7, clone RP24-331B9, com... 50 0.009
259gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 50 0.009
260gb|BC045402.1| Danio rerio novel nuclear protein 1, mRNA (cDNA c... 50 0.009
261gb|AC006338.6| Homo sapiens BAC clone RP11-539D10 from Y, comple... 50 0.009
262gb|BC060405.1| Xenopus laevis hypothetical protein MGC68575, mRN... 50 0.009
263gb|AC073308.4| Homo sapiens BAC clone RP11-13M3 from 7, complete... 50 0.009
264gb|AC113542.13| Mus musculus chromosome 5, clone RP23-195A18, co... 50 0.009
265gb|AC101902.9| Mus musculus chromosome 1, clone RP24-147M23, com... 50 0.009
266gb|AC126217.3| Rattus norvegicus 1 BAC CH230-9L4 (Children's Hos... 50 0.009
267gb|AC139711.4| Mus musculus BAC clone RP23-362F21 from chromosom... 50 0.009
268gb|DQ483855.1| Gymnogyps californianus clone 21G microsatellite ... 50 0.009
269gb|DQ483317.1| Gymnogyps californianus clone 20H microsatellite ... 50 0.009
270emb|AJ783629.1| Lacerta viridis microsatellite DNA, locus 9, clo... 50 0.009
271gb|AC146905.1| Human Herpesvirus 5 Toledo-BAC isolate, complete ... 50 0.009
272gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome... 50 0.009
273gb|AC132088.4| Mus musculus BAC clone RP24-410M8 from chromosome... 50 0.009
274gb|AC124557.4| Mus musculus BAC clone RP23-247H15 from chromosom... 50 0.009
275gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome... 50 0.009
276ref|XM_802648.1| Trypanosoma cruzi strain CL Brener mucin-associ... 50 0.009
277gb|AC125528.4| Mus musculus BAC clone RP23-365I9 from chromosome... 50 0.009
278gb|AC121781.3| Mus musculus BAC clone RP23-363D24 from chromosom... 50 0.009
279gb|AC125065.3| Mus musculus BAC clone RP23-430G6 from chromosome... 50 0.009
280gb|AC137948.12| Mus musculus chromosome 1, clone RP23-393D20, co... 50 0.009
281ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical... 50 0.009
282gb|AC128663.4| Mus musculus BAC clone RP24-263E2 from chromosome... 50 0.009
283gb|AC122800.3| Mus musculus BAC clone RP23-451G9 from chromosome... 50 0.009
284gb|AC126553.4| Mus musculus BAC clone RP23-448L16 from chromosom... 50 0.009
285emb|BX927349.12| Zebrafish DNA sequence from clone DKEY-84K15 in... 50 0.009
286gb|AC100858.3| Homo sapiens chromosome 8, clone RP11-1082L8, com... 50 0.009
287gb|AC112792.4| Mus musculus BAC clone RP23-192J17 from 18, compl... 50 0.009
288gb|AC098730.3| Mus musculus BAC clone RP23-3J2 from 1, complete ... 50 0.009
289gb|AC107842.13| Mus musculus chromosome 1, clone RP23-304O9, com... 50 0.009
290gb|AC159983.8| Mus musculus BAC clone RP23-192C23 from chromosom... 50 0.009
291gb|AC146790.16| Medicago truncatula clone mth2-123b21, complete ... 50 0.009
292emb|AJ852426.1| Mus musculus domesticus VpreB1 gene and Lambda5 ... 50 0.009
293gb|AC144799.3| Mus musculus chromosome 18 clone RP24-299J7, comp... 50 0.009
294gb|AC103574.7| Rattus norvegicus 1 BAC CH230-205C19 (Children's ... 50 0.009
295gb|AC103576.8| Rattus norvegicus 12 BAC CH230-63N13 (Children's ... 50 0.009
296emb|AL772284.5| Human DNA sequence from clone RP13-347D8 on chro... 50 0.009
297emb|AL445986.14| Human DNA sequence from clone RP11-310F24 on ch... 50 0.009
298emb|AL445245.12| Human DNA sequence from clone RP4-690O18 on chr... 50 0.009
299ref|XM_501164.1| Yarrowia lipolytica CLIB122, YALI0B21054g predi... 50 0.009
300gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cd... 50 0.009
301ref|XM_795364.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 50 0.009
302emb|AL135924.11| Human DNA sequence from clone RP11-63P12 on chr... 50 0.009
303emb|AL133215.17| Human DNA sequence from clone RP11-108L7 on chr... 50 0.009
304gb|AC162302.2| Mus musculus chromosome 15, clone RP23-463E8, com... 50 0.009
305emb|AL021407.1|HS13D10 Human DNA sequence from clone RP1-13D10 o... 50 0.009
306ref|XM_787432.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
307ref|XM_794933.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 50 0.009
308emb|Z99091.2|SPAC13F5 S.pombe chromosome I cosmid c13F5 50 0.009
309emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 50 0.009
310gb|AY133815.1| Arabidopsis thaliana clone U18774 unknown protein... 50 0.009
311gb|AY074548.1| Arabidopsis thaliana unknown protein (At4g17620) ... 50 0.009
312emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chrom... 50 0.009
313emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chr... 50 0.009
314emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 50 0.009
315emb|AL606479.16| Mouse DNA sequence from clone RP23-10G21 on chr... 50 0.009
316emb|AL928857.15| Mouse DNA sequence from clone RP24-499A8 on chr... 50 0.009
317emb|AL589722.17| Mouse DNA sequence from clone RP23-169M24 on ch... 50 0.009
318gb|AC157351.11| Mus musculus chromosome 5, clone RP23-219K16, co... 50 0.009
319gb|AC091782.5| Genomic sequence for Mus musculus, clone RP23-103... 50 0.009
320emb|Z49398.1|SCYJL123C S.cerevisiae chromosome X reading frame O... 50 0.009
321dbj|AB051897.1| Mus musculus Scya6, Scya9, Scya16-ps, Scya5 gene... 50 0.009
322gb|AC002332.3| Arabidopsis thaliana chromosome 2 clone F4P9 map ... 50 0.009
323gb|AC104803.4| Homo sapiens BAC clone RP11-460H9 from 4, complet... 50 0.009
324gb|AC091785.5| Genomic sequence for Mus musculus, clone RP23-349... 50 0.009
325gb|AC021539.10| Homo sapiens chromosome 4, clone RP11-460H9, com... 50 0.009
326gb|AC106821.2| Homo sapiens chromosome 5 clone RP11-730N24, comp... 50 0.009
327ref|XM_695176.1| PREDICTED: Danio rerio similar to Egr2a protein... 50 0.009
328ref|XM_694839.1| PREDICTED: Danio rerio hypothetical protein LOC... 50 0.009
329gb|AC026428.5| Homo sapiens chromosome 5 clone CTD-2203I6, compl... 50 0.009
330gb|AC022833.5| Homo sapiens chromosome , clone RP11-147C21, comp... 50 0.009
331gb|AC021909.7| Homo sapiens, clone RP11-22F19, complete sequence 50 0.009
332gb|AC008465.5| Homo sapiens chromosome 5 clone CTC-361C3, comple... 50 0.009
333gb|AC134749.4| Rattus norvegicus BAC CH230-353M13 (Children's H... 50 0.009
334gb|AC119807.11| Mus musculus chromosome 8, clone RP23-167I14, co... 50 0.009
335ref|XM_625389.1| Cryptosporidium parvum Iowa II hypothetical pro... 50 0.009
336gb|AC158535.2| Mus musculus BAC clone RP23-28J6 from chromosome ... 50 0.009
337gb|AC161058.2| Mus musculus BAC clone RP23-205J6 from chromosome... 50 0.009
338gb|AC158382.2| Mus musculus BAC clone RP24-105N17 from chromosom... 50 0.009
339ref|NM_001019082.1| Schizosaccharomyces pombe 972h- hypothetical... 50 0.009
340gb|AC010088.4| Homo sapiens BAC clone RP11-289L7 from Y, complet... 50 0.009
341ref|NM_070416.1| Caenorhabditis elegans Y41E3.16 (Y41E3.16) mRNA... 50 0.009
342tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform ... 50 0.009
343gb|AC006983.4|AC006983 Homo sapiens BAC clone RP11-70G12 from Y,... 50 0.009
344gb|BC095704.1| Danio rerio hypothetical protein LOC553462, mRNA ... 50 0.009
345dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.009
346gb|AC109617.11| Mus musculus chromosome 15, clone RP24-360D1, co... 50 0.009
347emb|BX819134.1|CNS0A8WB Arabidopsis thaliana Full-length cDNA Co... 50 0.009
348gb|AC097475.2| Homo sapiens BAC clone RP11-95J1 from 4, complete... 50 0.009
349gb|AC157212.2| Mus musculus BAC clone RP23-171A13 from chromosom... 50 0.009
350gb|AY188867.1| Streblomastix strix clone 4 heat shock protein 90... 50 0.009
351gb|AY188866.1| Streblomastix strix clone 3 heat shock protein 90... 50 0.009
352gb|AC025735.4|AC025735 Homo sapiens BAC clone RP11-214M24 from Y... 50 0.009
353gb|AC092093.34| Mus musculus strain C57BL/6J chromosome 10 clone... 50 0.009
354gb|BT004232.1| Arabidopsis thaliana clone RAFL16-03-G15 (R50081)... 50 0.009
355ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 50 0.009
356gb|AC084357.23| Homo sapiens 12q BAC RP11-415I12 (Roswell Park C... 50 0.009
357gb|AC008526.5|AC008526 Homo sapiens chromosome 5 clone CTC-470C1... 50 0.009
358emb|AJ621391.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
359emb|AJ621390.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
360emb|AJ620108.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
361emb|AJ620107.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
362emb|AJ620106.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
363dbj|AP003708.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.009
364emb|AJ617299.1| Plasmodium falciparum partial po gene for riboso... 50 0.009
365dbj|AK106116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
366dbj|AK106220.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
367dbj|AK103245.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
368gb|AC154771.2| Mus musculus BAC clone RP24-448F8 from 13, comple... 50 0.009
369gb|AC102304.6| Mus musculus chromosome 7, clone RP24-403P14, com... 50 0.009
370dbj|AK067884.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
371gb|U56663.1|PFU56663 Plasmodium falciparum acidic ribosomal phos... 50 0.009
372gb|AC151669.5| Mus musculus chromosome 5, clone RP23-44L13, comp... 50 0.009
373gb|AC123724.9| Mus musculus chromosome 15, clone RP23-432N1, com... 50 0.009
374emb|CT033750.18| Mouse DNA sequence from clone RP23-263M5 on chr... 50 0.009
375dbj|AP006248.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 50 0.009
376gb|DQ331342.1| Synthetic construct Saccharomyces cerevisiae clon... 50 0.009
377gb|BC084897.1| Xenopus laevis hypothetical LOC495411, mRNA (cDNA... 50 0.009
378emb|Z95559.1|CEY41E3 Caenorhabditis elegans YAC Y41E3, complete ... 50 0.009
379dbj|AB016928.1| Schizosaccharomyces pombe ptr6+ gene, complete cds 50 0.009
380emb|AL606976.25| Mouse DNA sequence from clone RP23-113P22 on ch... 50 0.009
381emb|AL929303.8| Mouse DNA sequence from clone RP23-240M2 on chro... 50 0.009
382gb|AC131766.4| Mus musculus BAC clone RP24-240O7 from 6, complet... 50 0.009
383gb|AC138609.4| Mus musculus BAC clone RP24-360D18 from 3, comple... 50 0.009
384gb|AC134604.5| Mus musculus BAC clone RP23-296I5 from 12, comple... 50 0.009
385gb|AC127589.4| Mus musculus BAC clone RP23-134K6 from 5, complet... 50 0.009
386gb|AC171338.5| Rhesus Macaque BAC CH250-526I15 (Children's Hosp... 50 0.009
387emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chro... 50 0.009
388emb|BX005240.7| Mouse DNA sequence from clone RP23-185M16 on chr... 50 0.009
389gb|AC000022.1|AC000022 Genomic sequence from Human Y, complete s... 50 0.009
390emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 50 0.009
391gb|AC091764.35| Mus musculus strain C57BL/6J chromosome 10 clone... 50 0.009
392gb|U31447.1|HEU31447 Heliocidaris erythrogramma HEHBOX6 (HeHbox6... 50 0.009
393emb|AL807800.7| Mouse DNA sequence from clone RP23-438D2 on chro... 50 0.009
394emb|AL772312.6| Mouse DNA sequence from clone RP23-91D16 on chro... 50 0.009
395emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on ch... 50 0.009
396emb|AL671975.12| Mouse DNA sequence from clone RP23-25O15 on chr... 50 0.009
397emb|AJ505051.1|MMU505051 Mus musculus partial pre-mRNA for CBP-i... 50 0.009
398dbj|AP001208.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 50 0.009
399emb|AL627342.15| Mouse DNA sequence from clone RP23-281G20 on ch... 50 0.009
400gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, co... 48 0.035
401gb|AC116136.9| Mus musculus chromosome 5, clone RP23-116G17, com... 48 0.035
402gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, co... 48 0.035
403gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, com... 48 0.035
404gb|AC114608.5| Mus musculus chromosome 8, clone RP23-418L5, comp... 48 0.035
405gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, co... 48 0.035
406gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cance... 48 0.035
407gb|AC120416.11| Mus musculus chromosome 1, clone RP24-472N18, co... 48 0.035
408gb|AC110510.6| Mus musculus chromosome 1, clone RP24-503F14, com... 48 0.035
409gb|AC116759.13| Mus musculus chromosome 18, clone RP23-383E12, c... 48 0.035
410gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, co... 48 0.035
411gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, com... 48 0.035
412gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, co... 48 0.035
413gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, com... 48 0.035
414gb|AC116696.20| Mus musculus chromosome 3, clone RP24-425N23, co... 48 0.035
415gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, c... 48 0.035
416gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, co... 48 0.035
417gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, c... 48 0.035
418gb|AC118200.8| Mus musculus chromosome 5, clone RP23-330E5, comp... 48 0.035
419gb|AC126598.13| Mus musculus chromosome 5, clone RP24-486L9, com... 48 0.035
420gb|AC153729.1| Mus musculus BAC RP23-88C11 (Roswell Park Cancer... 48 0.035
421ref|NM_114566.1| Arabidopsis thaliana unknown protein AT3G46990 ... 48 0.035
422ref|NM_125290.1| Arabidopsis thaliana protein binding / ubiquiti... 48 0.035
423gb|AC168274.5| Mus musculus BAC RP23-229B1 (Roswell Park Cancer... 48 0.035
424gb|AC152960.1| Mus musculus 6 BAC RP23-38B21 (Roswell Park Cance... 48 0.035
425ref|NM_125644.2| Arabidopsis thaliana ATEB1B; microtubule bindin... 48 0.035
426ref|NM_180672.2| Arabidopsis thaliana unknown protein AT3G15880 ... 48 0.035
427ref|NM_112458.5| Arabidopsis thaliana unknown protein AT3G15880 ... 48 0.035
428gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, co... 48 0.035
429gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, comp... 48 0.035
430gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, com... 48 0.035
431ref|NM_103201.2| Arabidopsis thaliana TT1 (TRANSPARENT TESTA 1);... 48 0.035
432gb|AC152947.1| Mus musculus 10 BAC RP23-12H20 (Roswell Park Canc... 48 0.035
433ref|NM_124377.2| Arabidopsis thaliana ubiquitin-protein ligase A... 48 0.035
434ref|NM_112968.3| Arabidopsis thaliana EIN3 (ETHYLENE-INSENSITIVE... 48 0.035
435gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 48 0.035
436gb|AC161271.2| Mus musculus BAC clone RP23-59D8 from chromosome ... 48 0.035
437gb|AC165256.2| Mus musculus BAC clone RP23-216O10 from chromosom... 48 0.035
438gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, co... 48 0.035
439gb|AC102311.10| Mus musculus chromosome 1, clone RP24-426M1, com... 48 0.035
440gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cance... 48 0.035
441gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosom... 48 0.035
442gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, comp... 48 0.035
443gb|AC121304.7| Mus musculus chromosome 3, clone RP24-63C3, compl... 48 0.035
444gb|AC166709.9| Mus musculus chromosome 1, clone RP23-406B10, com... 48 0.035
445gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosom... 48 0.035
446gb|AC167359.4| Mus musculus BAC clone RP24-94F12 from chromosome... 48 0.035
447gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, co... 48 0.035
448gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, com... 48 0.035
449gb|AC154516.2| Mus musculus BAC clone RP24-83D23 from chromosome... 48 0.035
450gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, com... 48 0.035
451gb|AC164397.6| Mus musculus chromosome 1, clone RP23-276M15, com... 48 0.035
452gb|AC163390.2| Mus musculus chromosome 1, clone RP24-300C19, com... 48 0.035
453gb|AC101706.9| Mus musculus chromosome 15, clone RP23-256L18, co... 48 0.035
454gb|AY421967.1| Cryptococcus gattii strain ATCC 32609 MAT-alpha m... 48 0.035
455gb|AC102739.7| Mus musculus chromosome 5, clone RP24-309H3, comp... 48 0.035
456gb|AC117757.23| Mus musculus chromosome 1, clone RP24-420I4, com... 48 0.035
457gb|AC113122.9| Mus musculus chromosome 8, clone RP23-349P4, comp... 48 0.035
458gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, c... 48 0.035
459gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, c... 48 0.035
460gb|AC158551.5| Mus musculus chromosome 8, clone RP23-466C10, com... 48 0.035
461gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome ... 48 0.035
462gb|AC161120.5| Mus musculus BAC clone RP23-84A2 from chromosome ... 48 0.035
463gb|AC154375.2| Mus musculus BAC clone RP23-69H21 from chromosome... 48 0.035
464gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosom... 48 0.035
465gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, co... 48 0.035
466gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, co... 48 0.035
467gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, co... 48 0.035
468gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, c... 48 0.035
469gb|AC111028.10| Mus musculus chromosome 8, clone RP23-221P20, co... 48 0.035
470ref|XM_631860.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
471gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome... 48 0.035
472gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, co... 48 0.035
473gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, co... 48 0.035
474gb|AY337613.1| Vitis vinifera 9-cis-epoxycarotenoid dioxygenase ... 48 0.035
475gb|AC123713.13| Mus musculus chromosome 7, clone RP23-391D20, co... 48 0.035
476ref|XM_641631.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
477gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, comp... 48 0.035
478gb|AC121851.4| Mus musculus chromosome 8 clone RP24-92F5, comple... 48 0.035
479gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, co... 48 0.035
480ref|XM_638977.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
481gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, com... 48 0.035
482ref|XM_637804.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
483ref|XM_637292.1| Dictyostelium discoideum SMAD/FHA domain-contai... 48 0.035
484ref|XM_636967.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
485ref|XM_630260.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
486ref|XM_635272.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
487ref|XM_635210.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
488ref|XM_634285.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
489ref|XM_631434.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
490gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5... 48 0.035
491ref|XM_629681.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
492ref|XM_629386.1| Dictyostelium discoideum hypothetical protein (... 48 0.035
493gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome ... 48 0.035
494gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosom... 48 0.035
495gb|AC166826.4| Mus musculus BAC clone RP23-370K22 from chromosom... 48 0.035
496gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 48 0.035
497gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome ... 48 0.035
498gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome... 48 0.035
499gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome... 48 0.035
500gb|AC165426.3| Mus musculus BAC clone RP23-157G2 from chromosome... 48 0.035

>gb|AY104639.1| Zea mays PCO082260 mRNA sequence
          Length = 912

 Score =  153 bits (77), Expect = 8e-34
 Identities = 118/132 (89%), Gaps = 6/132 (4%)
 Strand = Plus / Minus

                                                                       
Query: 337 gccccctcctccaaacaca------gatttagatggagagagggagacctggaagaaagg 390
           |||||||||||||||||||      |||||||||||||||||||||||||||||||||||
Sbjct: 489 gccccctcctccaaacacatagaatgatttagatggagagagggagacctggaagaaagg 430

                                                                       
Query: 391 cgtagccttcccttgccgataagacttgccttttttcttctgcatcactgaagcagccct 450
           | |||||||||||||||||||||||||||||| |||||| |||| | | |||||| ||||
Sbjct: 429 cttagccttcccttgccgataagacttgccttctttcttgtgcaccgccgaagcatccct 370

                       
Query: 451 gctcacatgcca 462
           ||||||| ||||
Sbjct: 369 gctcacacgcca 358



to top

>ref|XM_465991.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1188

 Score =  149 bits (75), Expect = 1e-32
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                       
Query: 341 cctcctccaaacacagatttagatggagagagggagacctggaagaaaggcgtagccttc 400
           ||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 605 cctcctccaaaaacggatttagatggagagagggagacctggaagaaaggcttagccttc 546

                                          
Query: 401 ccttgccgataagacttgccttttttcttct 431
           |||||||||||||||||||||| ||||||||
Sbjct: 545 ccttgccgataagacttgccttctttcttct 515



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  149 bits (75), Expect = 1e-32
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                            
Query: 341      cctcctccaaacacagatttagatggagagagggagacctggaagaaaggcgtagccttc 400
                ||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 18928596 cctcctccaaaaacggatttagatggagagagggagacctggaagaaaggcttagccttc 18928537

                                               
Query: 401      ccttgccgataagacttgccttttttcttct 431
                |||||||||||||||||||||| ||||||||
Sbjct: 18928536 ccttgccgataagacttgccttctttcttct 18928506



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||||||||| |||||
Sbjct: 18169428 cttcttcttcttcttcctcctcctcctc 18169401



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 561      ttcttcttcttcttcctcctctt 583
                |||||||||||||||||||||||
Sbjct: 35736285 ttcttcttcttcttcctcctctt 35736263



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 560      cttcttcttcttcttcctcctc 581
                ||||||||||||||||||||||
Sbjct: 35104654 cttcttcttcttcttcctcctc 35104675



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 560      cttcttcttcttcttcctcctcttcc 585
                ||||||||||||| ||||||||||||
Sbjct: 26423577 cttcttcttcttcctcctcctcttcc 26423602



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 560      cttcttcttcttcttcctcctc 581
                ||||||||||||||||||||||
Sbjct: 26423574 cttcttcttcttcttcctcctc 26423595



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 560     cttcttcttcttcttcctcctc 581
               ||||||||||||||||||||||
Sbjct: 5758072 cttcttcttcttcttcctcctc 5758051



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||||||||| |||||||||||
Sbjct: 73464 tcttcttcttcttcttcctcttcctc 73489



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 560      cttcttcttcttcttcctcct 580
                |||||||||||||||||||||
Sbjct: 34702457 cttcttcttcttcttcctcct 34702477



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 563      cttcttcttcttcctcctcttcctc 587
                ||||||||||||| |||||||||||
Sbjct: 25165669 cttcttcttcttcttcctcttcctc 25165693



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 560      cttcttcttcttcttcctcctcttcctcg 588
                |||||||||||||||| || |||||||||
Sbjct: 20076566 cttcttcttcttcttcttcttcttcctcg 20076538



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 560      cttcttcttcttcttcctcctcttcctcg 588
                |||||||||||||||| || |||||||||
Sbjct: 18741771 cttcttcttcttcttcttcttcttcctcg 18741743



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 567     ttcttcttcctcctcttcctc 587
               |||||||||||||||||||||
Sbjct: 2948895 ttcttcttcctcctcttcctc 2948875



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 560      cttcttcttcttcttcctcc 579
                ||||||||||||||||||||
Sbjct: 35727661 cttcttcttcttcttcctcc 35727642



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 568      tcttcttcctcctcttcctc 587
                ||||||||||||||||||||
Sbjct: 35576062 tcttcttcctcctcttcctc 35576043



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 565      tcttcttcttcctcctcttc 584
                ||||||||||||||||||||
Sbjct: 35260651 tcttcttcttcctcctcttc 35260670



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 35104645 cttcttcttcttcttcttcttcttcctc 35104672



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||||||| |||||||| |||||||
Sbjct: 31655143 cttcttcttctccttcctccgcttcctc 31655116



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 568      tcttcttcctcctcttcctc 587
                ||||||||||||||||||||
Sbjct: 29226573 tcttcttcctcctcttcctc 29226592



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 562      tcttcttcttcttcctcctc 581
                ||||||||||||||||||||
Sbjct: 24934678 tcttcttcttcttcctcctc 24934697



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 558      cacttcttcttcttcttcctcctc 581
                ||||||||||||||| ||||||||
Sbjct: 21496029 cacttcttcttcttcctcctcctc 21496006



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 560      cttcttcttcttcttcctcc 579
                ||||||||||||||||||||
Sbjct: 21354719 cttcttcttcttcttcctcc 21354700



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 21005582 cttcttcttcttcttcttcttcttcctc 21005609



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 565      tcttcttcttcctcctcttc 584
                ||||||||||||||||||||
Sbjct: 20338989 tcttcttcttcctcctcttc 20339008



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 560      cttcttcttcttcttcctcctctt 583
                |||||||||||||||| |||||||
Sbjct: 19768384 cttcttcttcttcttcttcctctt 19768407



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 19768378 cttcttcttcttcttcttcttcttcctc 19768405



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 19361468 cttcttcttcttcttcttcttcttcctc 19361495



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 18169437 cttcttcttcttcttcttcttcttcctc 18169410



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| ||||| |||||
Sbjct: 18169431 cttcttcttcttcttcttcctcctcctc 18169404



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||||||||| |||||||| |||||
Sbjct: 18169425 cttcttcttcttcctcctcctcctcctc 18169398



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 561      ttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| ||||
Sbjct: 16652406 ttcttcttcttcttcctccccttc 16652429



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 565      tcttcttcttcctcctcttc 584
                ||||||||||||||||||||
Sbjct: 16359340 tcttcttcttcctcctcttc 16359359



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 1083747 cttcttcttcttcttcttcttcttcctc 1083720



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 560     cttcttcttcttcttcctcc 579
               ||||||||||||||||||||
Sbjct: 1083738 cttcttcttcttcttcctcc 1083719



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 558    cacttcttcttcttcttcct 577
              ||||||||||||||||||||
Sbjct: 884450 cacttcttcttcttcttcct 884431



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 563   cttcttcttcttcctcctct 582
             ||||||||||||||||||||
Sbjct: 72994 cttcttcttcttcctcctct 73013



to top

>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0461D06
          Length = 112895

 Score =  149 bits (75), Expect = 1e-32
 Identities = 87/91 (95%)
 Strand = Plus / Minus

                                                                         
Query: 341   cctcctccaaacacagatttagatggagagagggagacctggaagaaaggcgtagccttc 400
             ||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 92129 cctcctccaaaaacggatttagatggagagagggagacctggaagaaaggcttagccttc 92070

                                            
Query: 401   ccttgccgataagacttgccttttttcttct 431
             |||||||||||||||||||||| ||||||||
Sbjct: 92069 ccttgccgataagacttgccttctttcttct 92039



to top

>ref|NM_125531.2| Arabidopsis thaliana TOC1 (TIMING OF CAB1 1); transcription regulator
            AT5G61380 (TOC1) mRNA, complete cds
          Length = 2684

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 2263 cttcttcttcttcttcctcctcttcctcgtcatcat 2228



to top

>gb|AY094393.1| Arabidopsis thaliana AT5g61380/mfb13_150 mRNA, complete cds
          Length = 2647

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 2262 cttcttcttcttcttcctcctcttcctcgtcatcat 2227



to top

>gb|AF272039.1|AF272039 Arabidopsis thaliana timing of CAB expression 1 protein (TOC1) mRNA,
            complete cds
          Length = 2579

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 2207 cttcttcttcttcttcctcctcttcctcgtcatcat 2172



to top

>gb|BT005816.1| Arabidopsis thaliana At5g61380/mfb13_150 gene, complete cds
          Length = 1857

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 1810 cttcttcttcttcttcctcctcttcctcgtcatcat 1775



to top

>dbj|AB041530.1| Arabidopsis thaliana APRR1 mRNA for pseudo-response regulator 1,
            complete cds
          Length = 1880

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 1820 cttcttcttcttcttcctcctcttcctcgtcatcat 1785



to top

>dbj|AB010073.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFB13
          Length = 80376

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                 
Query: 560   cttcttcttcttcttcctcctcttcctcgacatcat 595
             ||||||||||||||||||||||||||||| ||||||
Sbjct: 48687 cttcttcttcttcttcctcctcttcctcgtcatcat 48652



to top

>emb|AJ251086.1|ATH251086 Arabidopsis thaliana mRNA for ABI3-interacting protein 1 (aip1 gene)
          Length = 2578

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcat 595
            ||||||||||||||||||||||||||||| ||||||
Sbjct: 2206 cttcttcttcttcttcctcctcttcctcgtcatcat 2171



to top

>gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, complete sequence
          Length = 197114

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 560    cttcttcttcttcttcctcctcttcctcg 588
              |||||||||||||||||||||||||||||
Sbjct: 150619 cttcttcttcttcttcctcctcttcctcg 150591



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 150628 cttcttcttcttcttcttcttcttcctc 150601



to top

>ref|XM_456745.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A09779g)
            partial mRNA
          Length = 3585

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 560  cttcttcttcttcttcctcctcttcctcgacatcatt 596
            |||||||||||||||| || |||||||||||||||||
Sbjct: 1627 cttcttcttcttcttcttcttcttcctcgacatcatt 1591



to top

>emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS767 of Debaryomyces
              hansenii
          Length = 1249565

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 560    cttcttcttcttcttcctcctcttcctcgacatcatt 596
              |||||||||||||||| || |||||||||||||||||
Sbjct: 803905 cttcttcttcttcttcttcttcttcctcgacatcatt 803869



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 854616 tcttcttcttcctcctcttcctc 854638



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 923125 cttcttcttcttcttcctcctc 923104



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 921048 cttcttcttcttcttcctcctc 921027



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 940101 cttcttcgtcttcttcctcttcttcctc 940128



to top

>gb|AC120405.7| Mus musculus chromosome 1, clone RP24-409F22, complete sequence
          Length = 158876

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 8540 cttcttcttcttcttcctcctcttcctc 8567



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 8531 cttcttcttcttcttcttcttcttcctc 8558



to top

>ref|XM_632233.1| Dictyostelium discoideum hypothetical protein (DDB0219204), partial
           mRNA
          Length = 996

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 637 cttcttcttcttcttcctcctcttcctc 610



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           ||||||||||||||||||| |||||
Sbjct: 595 cttcttcttcttcttcctcttcttc 571



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 558 cacttcttcttcttcttcctcctc 581
           |||||||||||||||||| |||||
Sbjct: 642 cacttcttcttcttcttcttcctc 619



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 560 cttcttcttcttcttcctcctctt 583
           ||||||||||||||||||| ||||
Sbjct: 577 cttcttcttcttcttcctcttctt 554



to top

>gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, complete sequence
          Length = 230988

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 109416 cttcttcttcttcttcctcctcttcctc 109389



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 109425 cttcttcttcttcttcttcttcttcctc 109398



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||| ||||||||||| |||||||||||
Sbjct: 109377 cttcctcttcttcttcttcctcttcctc 109350



to top

>gb|AC164310.2| Mus musculus BAC clone RP23-139E15 from chromosome 8, complete sequence
          Length = 204269

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 134032 cttcttcttcttcttcctcctcttcctc 134059



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||||||||| |||||
Sbjct: 134014 cttcttcttcttcttcctcttcttc 134038



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 134011 cttcttcttcttcttcttcctcttc 134035



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| || |||||||||||||||||
Sbjct: 134041 cttcttcctcctcttcctcctcttcctc 134068



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 134005 cttcttcttcttcttcttcttcttcctc 134032



to top

>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete
            sequence
          Length = 162597

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 7857 cttcttcttcttcttcctcctcttcctc 7884



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 28395 cttcttcttcttcttcttcctcttcctc 28422



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 28281 cttcttcttcttcttcttcctcttcctc 28308



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 25124 cttcttcttcttcttcctcctcctcctc 25151



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||| ||||||||
Sbjct: 8307 cttcttcttcttcttcctcttcttcctc 8334



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||| ||||||||
Sbjct: 8067 cttcttcttcttcttcctcttcttcctc 8094



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| ||||||||||||||
Sbjct: 7743 cttcttcttcttcctcctcctcttcctc 7770



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| |||||||||||
Sbjct: 7608 cttcttcttcttcttcttcctcttcctc 7635



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 560  cttcttcttcttcttcctcctc 581
            ||||||||||||||||||||||
Sbjct: 7740 cttcttcttcttcttcctcctc 7761



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 28084 cttcttcttcttcttcctcttcttc 28108



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 28081 cttcttcttcttcttcttcctcttc 28105



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||||||||||||||| ||||||||
Sbjct: 8304 cttcttcttcttcttcttcctcttc 8328



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||||||||||||||| ||||||||
Sbjct: 8064 cttcttcttcttcttcttcctcttc 8088



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 560  cttcttcttcttcttcctcct 580
            |||||||||||||||||||||
Sbjct: 7962 cttcttcttcttcttcctcct 7982



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||||||||| |||||
Sbjct: 28404 cttcttcttcctcttcctcctcctcctc 28431



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| || |||||
Sbjct: 28398 cttcttcttcttcttcctcttcctcctc 28425



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 28389 cttcttcttcttcttcttcttcttcctc 28416



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||| |||||||||||||||||
Sbjct: 28296 cttcctcttcctcttcctcctcttcctc 28323



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 28287 cttcttcttcttcctcttcctcttcctc 28314



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 28275 cttcttcttcttcttcttcttcttcctc 28302



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 28102 cttcttcttcttcctcttcctcttcctc 28129



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 28096 cttcctcttcttcttcttcctcttcctc 28123



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 25127 cttcttcttcttcctcctcctcctcctc 25154



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 25121 cttcttcttcttcttcttcctcctcctc 25148



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 25115 cttcttcttcttcttcttcttcttcctc 25142



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||| ||||| |||||||||||
Sbjct: 8313 cttcttcttcctcttcttcctcttcctc 8340



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 8298 cttcttcttcttcttcttcttcttcctc 8325



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8121 cttcttcctcttcttcctcttcttcctc 8148



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8112 cttcttcctcttcttcctcttcttcctc 8139



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8103 cttcttcctcttcttcctcttcttcctc 8130



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8094 cttcttcctcttcttcctcttcttcctc 8121



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8085 cttcttcctcttcttcctcttcttcctc 8112



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||||||||| ||||||||
Sbjct: 8076 cttcttcctcttcttcctcttcttcctc 8103



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| |||| |||||||||
Sbjct: 7965 cttcttcttcttcctccttctcttcctc 7992



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 7953 cttcttcttcttcttcttcttcttcctc 7980



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 7848 cttcttcttcttcttcttcttcttcctc 7875



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| ||||| |||||
Sbjct: 7737 cttcttcttcttcttcttcctcctcctc 7764



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 7731 cttcttcttcttcttcttcttcttcctc 7758



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| || |||||||||||
Sbjct: 7614 cttcttcttcttcctcttcctcttcctc 7641



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 7602 cttcttcttcttcttcttcttcttcctc 7629



to top

>gb|AC157569.12| Mus musculus chromosome 3, clone RP23-434M21, complete sequence
          Length = 205286

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 65242 cttcttcttcttcttcctcctcttcctc 65269



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||| |||||||||||||||
Sbjct: 65285 cttcttcttctt-ttcctcctcttcctc 65311



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 65233 cttcttcttcttcttcttcttcttcctc 65260



to top

>gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, complete sequence
          Length = 166975

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 57774 cttcttcttcttcttcctcctcttcctc 57801



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 57693 cttcttcttcttcttcctcctcttcctc 57720



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 58198 cttcttcttcttcttcttcctcttcctc 58225



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 58088 cttcttcttcttcttcctcctcctcctc 58115



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 57627 cttcttcttcttcttcctcctcctcctc 57654



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 560   cttcttcttcttcttcctcctc 581
             ||||||||||||||||||||||
Sbjct: 57975 cttcttcttcttcttcctcctc 57996



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 560   cttcttcttcttcttcctcct 580
             |||||||||||||||||||||
Sbjct: 57863 cttcttcttcttcttcctcct 57883



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 57666 cttcttcttcttcttcctcttcttc 57690



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 57663 cttcttcttcttcttcttcctcttc 57687



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||||||||| |||||
Sbjct: 58207 cttcttcttcctcttcctcctcctcctc 58234



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| || |||||
Sbjct: 58201 cttcttcttcttcttcctcttcctcctc 58228



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58192 cttcttcttcttcttcttcttcttcctc 58219



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 58091 cttcttcttcttcctcctcctcctcctc 58118



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 58085 cttcttcttcttcttcttcctcctcctc 58112



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58079 cttcttcttcttcttcttcttcttcctc 58106



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57966 cttcttcttcttcttcttcttcttcctc 57993



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57854 cttcttcttcttcttcttcttcttcctc 57881



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 561   ttcttcttcttcttcctcctcttc 584
             |||||||||||||||||| |||||
Sbjct: 57813 ttcttcttcttcttcctcttcttc 57836



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57765 cttcttcttcttcttcttcttcttcctc 57792



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57684 cttcttcttcttcttcttcttcttcctc 57711



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 57630 cttcttcttcttcctcctcctcctcctc 57657



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 57624 cttcttcttcttcttcttcctcctcctc 57651



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57618 cttcttcttcttcttcttcttcttcctc 57645



to top

>gb|AC102923.10| Mus musculus chromosome 1, clone RP24-262J2, complete sequence
          Length = 159541

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 31380 cttcttcttcttcttcctcctcttcctc 31353



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||| ||||||||||||||||||||
Sbjct: 31287 cttcctcttcttcttcctcctcttc 31263



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 31231 tcttcttcctcctcttcctc 31212



to top

>gb|AC160339.2| Mus musculus BAC clone RP23-410O11 from chromosome 9, complete sequence
          Length = 174612

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 47454 cttcttcttcttcttcctcctcttcctc 47427



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 47463 cttcttcttcttcttcttcttcttcctc 47436



to top

>gb|AC147229.5| Mus musculus BAC clone RP23-236E9 from chromosome 19, complete sequence
          Length = 162400

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 32287 cttcttcttcttcttcctcctcttcctc 32314



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 32278 cttcttcttcttcttcttcttcttcctc 32305



to top

>gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, complete sequence
          Length = 171023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 37036 cttcttcttcttcttcctcctcttcctc 37063



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| || |||||||||||||||||
Sbjct: 37045 cttcttcctcctcttcctcctcttcctc 37072



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 37027 cttcttcttcttcttcttcttcttcctc 37054



to top

>gb|AC112081.8| Rattus norvegicus 7 BAC CH230-192B8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 150311

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 11999 cttcttcttcttcttcctcctcttcctc 11972



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 12008 cttcttcttcttcttcttcttcttcctc 11981



to top

>gb|AC165313.7| Mus musculus chromosome 5, clone RP24-294J23, complete sequence
          Length = 137597

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 90070 cttcttcttcttcttcctcctcttcctc 90097



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 90061 cttcttcttcttcttcttcttcttcctc 90088



to top

>gb|AC159888.2| Mus musculus BAC clone RP24-133O9 from chromosome 12, complete
            sequence
          Length = 181236

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 1465 cttcttcttcttcttcctcctcttcctc 1492



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 54988 cttcttcttcttcttcttcctcttcctc 55015



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 54994 cttcttcttcttcctcttcctcttcctc 55021



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 54982 cttcttcttcttcttcttcttcttcctc 55009



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 1456 cttcttcttcttcttcttcttcttcctc 1483



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| || |||||||||||
Sbjct: 1342 cttcttcttcttcctcttcctcttcctc 1369



to top

>gb|AC165335.3| Mus musculus BAC clone RP24-481H19 from chromosome 5, complete sequence
          Length = 212783

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 71094 cttcttcttcttcttcctcctcttcctc 71067



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 71103 cttcttcttcttcttcttcttcttcctc 71076



to top

>gb|AC140206.2| Mus musculus BAC clone RP24-446O8 from chromosome 16, complete sequence
          Length = 195790

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 58605 cttcttcttcttcttcctcctcttcctc 58578



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 58000 cttcttcttcttcttcttcctcttc 57976



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 57997 cttcttcttcttcttcctcttcttc 57973



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58614 cttcttcttcttcttcttcttcttcctc 58587



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58006 cttcttcttcttcttcttcttcttcctc 57979



to top

>gb|AC125194.4| Mus musculus BAC clone RP23-275K6 from chromosome 18, complete sequence
          Length = 155706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 50437 cttcttcttcttcttcctcctcttcctc 50410



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||| |||||||||||||||||
Sbjct: 50462 tcttcttcctcttcctcctcttcctc 50437



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 50509 cttcttcttcttcttcttcctcttc 50485



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 50506 cttcttcttcttcttcctcttcttc 50482



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||| ||||||||||||||||||||
Sbjct: 50494 cttcctcttcttcttcctcctcttc 50470



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 50515 cttcttcttcttcttcttcttcttcctc 50488



to top

>gb|AC099863.14| Mus musculus chromosome 3, clone RP23-6F2, complete sequence
          Length = 245784

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 163629 cttcttcttcttcttcctcctcttcctc 163656



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 163620 cttcttcttcttcttcttcttcttcctc 163647



to top

>gb|AC147147.2| Pan troglodytes BAC clone CH251-230I19 from Y, complete sequence
          Length = 143402

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 36962 cttcttcttcttcttcctcctcttcctc 36989



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 56139 cttcttcttcttcttcctcttcttc 56163



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 36953 cttcttcttcttcttcttcttcttcctc 36980



to top

>emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chromosome 13, complete
             sequence
          Length = 204148

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 24918 cttcttcttcttcttcctcctcttcctc 24945



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 24993 cttcttcttcttcttcttcctcttcctc 25020



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 24999 cttcttcttcttcctcttcctcttcctc 25026



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 24987 cttcttcttcttcttcttcttcttcctc 25014



to top

>gb|AC146452.3| Pan troglodytes BAC clone CH251-483N3 from Y, complete sequence
          Length = 215209

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 20445 cttcttcttcttcttcctcctcttcctc 20418



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||| |||||
Sbjct: 1268 cttcttcttcttcttcctcttcttc 1244



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 20454 cttcttcttcttcttcttcttcttcctc 20427



to top

>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence
          Length = 186595

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 63245 cttcttcttcttcttcctcctcttcctc 63218



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 63281 cttcttcttcttcttcttcctcttc 63257



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 63278 cttcttcttcttcttcctcttcttc 63254



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 63287 cttcttcttcttcttcttcttcttcctc 63260



to top

>gb|AC124590.4| Mus musculus BAC clone RP23-133P12 from chromosome 6, complete sequence
          Length = 215946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 72781 cttcttcttcttcttcctcctcttcctc 72754



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 72652 cttcttcttcttcttcttcctcttcctc 72625



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 72790 cttcttcttcttcttcttcttcttcctc 72763



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 72658 cttcttcttcttcttcttcttcttcctc 72631



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 72646 cttcttcttcttcctcttcctcttcctc 72619



to top

>gb|AC129335.4| Mus musculus BAC clone RP23-109H7 from chromosome 1, complete sequence
          Length = 201274

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 151249 cttcttcttcttcttcctcctcttcctc 151222



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| ||||||||||||||
Sbjct: 136754 cttcttcttcttcctcctcctcttcctc 136781



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 136751 cttcttcttcttcttcctcctc 136772



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 151258 cttcttcttcttcttcttcttcttcctc 151231



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||||| |||||
Sbjct: 136748 cttcttcttcttcttcttcctcctcctc 136775



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 136742 cttcttcttcttcttcttcttcttcctc 136769



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 41619 tcttcttcctcctcttcctc 41638



to top

>gb|AC122465.4| Mus musculus BAC clone RP24-304I22 from chromosome 13, complete
            sequence
          Length = 142340

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 9587 cttcttcttcttcttcctcctcttcctc 9560



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| |||||||||||
Sbjct: 9512 cttcttcttcttcttcttcctcttcctc 9485



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 9518 cttcttcttcttcttcttcttcttcctc 9491



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| || |||||||||||
Sbjct: 9506 cttcttcttcttcctcttcctcttcctc 9479



to top

>gb|AC121839.3| Mus musculus BAC clone RP24-76E2 from chromosome 13, complete sequence
          Length = 182835

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 68080 cttcttcttcttcttcctcctcttcctc 68053



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 68089 cttcttcttcttcttcttcttcttcctc 68062



to top

>gb|AC137605.3| Mus musculus BAC clone RP23-117H14 from 19, complete sequence
          Length = 180560

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 29783 cttcttcttcttcttcctcctcttcctc 29756



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 29792 cttcttcttcttcttcttcttcttcctc 29765



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 23631 tcttcttcctcctcttcctc 23612



to top

>gb|AC121596.3| Mus musculus BAC clone RP23-299I20 from 14, complete sequence
          Length = 203897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 78592 cttcttcttcttcttcctcctcttcctc 78565



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 78601 cttcttcttcttcttcttcttcttcctc 78574



to top

>gb|AC121790.2| Mus musculus BAC clone RP23-399J19 from 1, complete sequence
          Length = 190623

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 136332 cttcttcttcttcttcctcctcttcctc 136359



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| ||||||||||||||
Sbjct: 150827 cttcttcttcttcctcctcctcttcctc 150800



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 150830 cttcttcttcttcttcctcctc 150809



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 150839 cttcttcttcttcttcttcttcttcctc 150812



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||||| |||||
Sbjct: 150833 cttcttcttcttcttcttcctcctcctc 150806



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 136323 cttcttcttcttcttcttcttcttcctc 136350



to top

>gb|AC121568.3| Mus musculus BAC clone RP23-226F18 from 15, complete sequence
          Length = 207297

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 85593 cttcttcttcttcttcctcctcttcctc 85620



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 55310 cttcttcttcttcttcctcttcttc 55286



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 85584 cttcttcttcttcttcttcttcttcctc 85611



to top

>ref|XM_721456.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05982)
           partial mRNA
          Length = 2109

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 448 cttcttcttcttcttcctcctcttcctc 421



to top

>gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complete sequence
          Length = 144239

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 113179 cttcttcttcttcttcctcctcttcctc 113206



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 113206 cttcttcctcttcttcctcttcttcctc 113233



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 113170 cttcttcttcttcttcttcttcttcctc 113197



to top

>gb|AC118734.11| Mus musculus chromosome 18, clone RP24-170D17, complete sequence
          Length = 211023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 26069 cttcttcttcttcttcctcctcttcctc 26096



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 560   cttcttcttcttcttcctcc 579
             ||||||||||||||||||||
Sbjct: 26194 cttcttcttcttcttcctcc 26213



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 26185 cttcttcttcttcttcttcttcttcctc 26212



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 26060 cttcttcttcttcttcttcttcttcctc 26087



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 25941 cttcttcttcttcctcatcctcttcctc 25968



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 25935 cttcttcttcttcttcttcctcatcctc 25962



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 25929 cttcttcttcttcttcttcttcttcctc 25956



to top

>gb|AC115754.7| Mus musculus chromosome 12, clone RP23-34D20, complete sequence
          Length = 217173

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 39869 cttcttcttcttcttcctcctcttcctc 39896



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 39860 cttcttcttcttcttcttcttcttcctc 39887



to top

>gb|AC156606.12| Mus musculus chromosome 7, clone RP23-78N8, complete sequence
          Length = 200034

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 41408 cttcttcttcttcttcctcctcttcctc 41435



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 41443 tcttcttcttcttcctcctcttcctc 41468



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||| ||| |||||
Sbjct: 41531 cttcttcttcttcttccttctcctcctc 41558



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| || |||||||||||||||||
Sbjct: 41450 cttcttcctcctcttcctcctcttcctc 41477



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| || |||||||||||||||||
Sbjct: 41417 cttcttcctcctcttcctcctcttcctc 41444



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 41399 cttcttcttcttcttcttcttcttcctc 41426



to top

>emb|AL713851.8| Human DNA sequence from clone RP11-526P5 on chromosome 10 Contains two
             novel genes and three CpG islands, complete sequence
          Length = 158779

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 57144 cttcttcttcttcttcctcctcttcctc 57117



to top

>emb|AL646099.4| Human DNA sequence from clone RP11-65B7 on chromosome 13q13.3-14.2,
             complete sequence
          Length = 106772

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 61706 cttcttcttcttcttcctcctcttcctc 61733



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 61688 cttcttcttcttcttcctcttcttc 61712



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 561   ttcttcttcttcttcctcctcttc 584
             ||||||||||||||| ||||||||
Sbjct: 61686 ttcttcttcttcttcttcctcttc 61709



to top

>emb|AL445666.9| Human DNA sequence from clone RP11-262H5 on chromosome 1 Contains the
             3' end of the CENPF gene for centromere protein F
             350/400ka (mitosin), complete sequence
          Length = 65748

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 27852 cttcttcttcttcttcctcctcttcctc 27879



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 27900 cttcttcttcttcttcctcctcctcctc 27927



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 27834 cttcttcttcttcttcctcttcttc 27858



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 27816 cttcttcttcttcttcctcttcttc 27840



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 27813 cttcttcttcttcttcttcctcttc 27837



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 27897 cttcttcttcttcttcttcctcctcctc 27924



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 27891 cttcttcttcttcttcttcttcttcctc 27918



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 27807 cttcttcttcttcttcttcttcttcctc 27834



to top

>gb|AC164436.2| Mus musculus BAC clone RP23-134C5 from chromosome 14, complete sequence
          Length = 220260

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 198249 cttcttcttcttcttcctcctcttcctc 198222



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 198258 cttcttcttcttcttcttcttcttcctc 198231



to top

>gb|AC161606.5| Mus musculus BAC clone RP23-232M18 from chromosome 14, complete sequence
          Length = 223037

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 197320 cttcttcttcttcttcctcctcttcctc 197347



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 197311 cttcttcttcttcttcttcttcttcctc 197338



to top

>gb|AC160551.4| Mus musculus chromosome 5, clone RP23-296C20, complete sequence
          Length = 173331

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 44033 cttcttcttcttcttcctcctcttcctc 44060



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 564    ttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||
Sbjct: 133909 ttcttcttcttcctcctcttcctc 133886



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 564    ttcttcttcttcctcctcttcctc 587
              |||||||||||||||||| |||||
Sbjct: 130208 ttcttcttcttcctcctcctcctc 130185



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 44024 cttcttcttcttcttcttcttcttcctc 44051



to top

>gb|AF330005.1|AF330003S3 Mus musculus USG protein (USG) gene, exons 3 through 6
          Length = 6166

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 4228 cttcttcttcttcttcctcctcttcctc 4201



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 4193 tcttcttcttcttcctcctcttcctc 4168



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||||||||| |||||
Sbjct: 4108 cttcttcttcttcttcctcctcctcctc 4081



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 4237 cttcttcttcttcttcttcttcttcctc 4210



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| || |||||||||||||||||
Sbjct: 4219 cttcttcctcctcttcctcctcttcctc 4192



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| || |||||||||||||||||
Sbjct: 4186 cttcttcctcctcttcctcctcttcctc 4159



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 4117 cttcttcttcttcttcttcttcttcctc 4090



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| ||||| |||||
Sbjct: 4111 cttcttcttcttcttcttcctcctcctc 4084



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| |||||||| |||||
Sbjct: 4105 cttcttcttcttcctcctcctcctcctc 4078



to top

>emb|AL713921.15| Mouse DNA sequence from clone RP23-475A8 on chromosome 11 Contains a
              novel gene and a CpG island, complete sequence
          Length = 214065

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 172365 cttcttcttcttcttcctcctcttcctc 172338



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 172374 cttcttcttcttcttcttcttcttcctc 172347



to top

>gb|AC092897.6| Homo sapiens 3 BAC RP11-292P2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 127044

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 98945 cttcttcttcttcttcctcctcttcctc 98972



to top

>gb|AC154399.5| Mus musculus chromosome 3, clone RP24-295P14, complete sequence
          Length = 165984

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 78691 cttcttcttcttcttcctcctcttcctc 78718



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 78682 cttcttcttcttcttcttcttcttcctc 78709



to top

>gb|AC079097.6| Homo sapiens chromosome 8, clone RP11-98P2, complete sequence
          Length = 159256

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 57877 cttcttcttcttcttcctcctcttcctc 57850



to top

>dbj|BS000574.1| Pan troglodytes chromosome Y clone:PTB-031D23, complete sequences
          Length = 142928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 52511 cttcttcttcttcttcctcctcttcctc 52538



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 71688 cttcttcttcttcttcctcttcttc 71712



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 52502 cttcttcttcttcttcttcttcttcctc 52529



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||||||||||||||||||||||||
Sbjct: 16170427 cttcttcttcttcttcctcctcttcctc 16170400



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||||||||||||||| ||||||||
Sbjct: 18337514 cttcttcttcttcttcctcttcttcctc 18337487



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| |||||||||||
Sbjct: 11371353 cttcttcttcttcttcttcctcttcctc 11371326



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| |||||||||||
Sbjct: 11180703 cttcttcttcttcttcttcctcttcctc 11180730



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| |||||||||||
Sbjct: 3212493 cttcttcttcttcttcttcctcttcctc 3212520



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 22408595 cttcttcttcttcttcttcctcttc 22408571



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 563      cttcttcttcttcctcctcttcctc 587
                |||||||||||||||| ||||||||
Sbjct: 22408496 cttcttcttcttcctcttcttcctc 22408472



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||| ||||||||||
Sbjct: 20283734 cttcttcttcttctccctcctcttc 20283710



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 16151250 cttcttcttcttcttcctcttcttc 16151226



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 14352680 cttcttcttcttcttcttcctcttc 14352704



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 14154939 cttcttcttcttcttcttcctcttc 14154915



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 14154936 cttcttcttcttcttcctcttcttc 14154912



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 14154915 cttcttcttcttcttcttcctcttc 14154891



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 14125150 cttcttcttcttcttcctcttcttc 14125126



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 13530284 cttcttcttcttcttcttcctcttc 13530308



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 13530263 cttcttcttcttcttcctcttcttc 13530287



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 13530260 cttcttcttcttcttcttcctcttc 13530284



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 13330764 cttcttcttcttcttcttcctcttc 13330740



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 13330761 cttcttcttcttcttcctcttcttc 13330737



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 13330740 cttcttcttcttcttcttcctcttc 13330716



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 13300946 cttcttcttcttcttcttcctcttc 13300922



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 13300943 cttcttcttcttcttcctcttcttc 13300919



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 12860685 cttcttcttcttcttcctcttcttc 12860709



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 12860682 cttcttcttcttcttcttcctcttc 12860706



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 12321717 cttcttcttcttcttcctcttcttc 12321741



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 12321714 cttcttcttcttcttcttcctcttc 12321738



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 12138231 cttcttcttcttcttcttcctcttc 12138207



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 12138228 cttcttcttcttcttcctcttcttc 12138204



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 11371389 cttcttcttcttcttcttcctcttc 11371365



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 11371386 cttcttcttcttcttcctcttcttc 11371362



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                ||||||||||||||||||| |||||
Sbjct: 11180670 cttcttcttcttcttcctcttcttc 11180694



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 560      cttcttcttcttcttcctcctcttc 584
                |||||||||||||||| ||||||||
Sbjct: 11180667 cttcttcttcttcttcttcctcttc 11180691



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9865230 cttcttcttcttcttcttcctcttc 9865254



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 9665622 cttcttcttcttcttcctcttcttc 9665598



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9665553 cttcttcttcttcttcttcctcttc 9665529



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9635776 cttcttcttcttcttcttcctcttc 9635752



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 9635773 cttcttcttcttcttcctcttcttc 9635749



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 9160051 cttcttcttcttcttcctcttcttc 9160075



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9160048 cttcttcttcttcttcttcctcttc 9160072



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9130273 cttcttcttcttcttcttcctcttc 9130297



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 9130252 cttcttcttcttcttcctcttcttc 9130276



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9130249 cttcttcttcttcttcttcctcttc 9130273



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 9130177 cttcttcttcttcttcctcttcttc 9130201



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 9130174 cttcttcttcttcttcttcctcttc 9130198



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8933973 cttcttcttcttcttcctcttcttc 8933949



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8933898 cttcttcttcttcttcttcctcttc 8933874



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8904119 cttcttcttcttcttcttcctcttc 8904095



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8904116 cttcttcttcttcttcctcttcttc 8904092



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8426463 cttcttcttcttcttcctcttcttc 8426487



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8426460 cttcttcttcttcttcttcctcttc 8426484



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8396685 cttcttcttcttcttcttcctcttc 8396709



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8396610 cttcttcttcttcttcctcttcttc 8396634



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8197049 cttcttcttcttcttcctcttcttc 8197025



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8196992 cttcttcttcttcttcttcctcttc 8196968



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 8167222 cttcttcttcttcttcttcctcttc 8167198



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 8167219 cttcttcttcttcttcctcttcttc 8167195



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 5038582 cttcttcttcttcttcttcctcttc 5038558



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 5038579 cttcttcttcttcttcctcttcttc 5038555



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 4569136 cttcttcttcttcttcttcctcttc 4569160



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 4569073 cttcttcttcttcttcctcttcttc 4569097



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 4569070 cttcttcttcttcttcttcctcttc 4569094



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 4409692 cttcttcttcttcttcttcctcttc 4409668



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 4409689 cttcttcttcttcttcctcttcttc 4409665



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 4409632 cttcttcttcttcttcttcctcttc 4409608



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 3472829 cttcttcttcttcttcttcctcttc 3472805



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 3472826 cttcttcttcttcttcctcttcttc 3472802



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 563     cttcttcttcttcctcctcttcctc 587
               ||||||||||||| |||||||||||
Sbjct: 3472793 cttcttcttcttcttcctcttcctc 3472769



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 3212463 cttcttcttcttcttcctcttcttc 3212487



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 3212460 cttcttcttcttcttcttcctcttc 3212484



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 2058821 cttcttcttcttcttcctcttcttc 2058845



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 2058818 cttcttcttcttcttcttcctcttc 2058842



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 2005160 cttcttcttcttcttcttcctcttc 2005136



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 2005157 cttcttcttcttcttcctcttcttc 2005133



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 1383688 cttcttcttcttcttcttcctcttc 1383664



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 1383685 cttcttcttcttcttcctcttcttc 1383661



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               |||||||||||||||| ||||||||
Sbjct: 1383604 cttcttcttcttcttcttcctcttc 1383580



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 560     cttcttcttcttcttcctcctcttc 584
               ||||||||||||||||||| |||||
Sbjct: 1383601 cttcttcttcttcttcctcttcttc 1383577



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 913345 cttcttcttcttcttcttcctcttc 913369



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 559      acttcttcttcttcttcctcctcttcct 586
                |||| ||||||||||||||| |||||||
Sbjct: 19452891 acttgttcttcttcttcctcttcttcct 19452918



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||| ||||||||||| ||||||||
Sbjct: 18337505 cttcttcctcttcttcctcttcttcctc 18337478



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||| ||||||||||| ||||||||
Sbjct: 18337496 cttcttcctcttcttcctcttcttcctc 18337469



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||| ||||||||||| ||||||||
Sbjct: 18337487 cttcttcctcttcttcctcttcttcctc 18337460



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                ||||||| ||||||||||| ||||||||
Sbjct: 18337478 cttcttcctcttcttcctcttcttcctc 18337451



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 563      cttcttcttcttcctcctcttcct 586
                ||||||||||||||||||| ||||
Sbjct: 16684068 cttcttcttcttcctcctcctcct 16684045



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 568      tcttcttcctcctcttcctc 587
                ||||||||||||||||||||
Sbjct: 16470920 tcttcttcctcctcttcctc 16470939



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 16170436 cttcttcttcttcttcttcttcttcctc 16170409



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 14352674 cttcttcttcttcttcttcttcttcctc 14352701



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 14154945 cttcttcttcttcttcttcttcttcctc 14154918



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 13530254 cttcttcttcttcttcttcttcttcctc 13530281



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 13330770 cttcttcttcttcttcttcttcttcctc 13330743



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 12860676 cttcttcttcttcttcttcttcttcctc 12860703



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 12321708 cttcttcttcttcttcttcttcttcctc 12321735



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 12138237 cttcttcttcttcttcttcttcttcctc 12138210



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 560      cttcttcttcttcttcctcctcttcctc 587
                |||||||||||||||| || ||||||||
Sbjct: 11180661 cttcttcttcttcttcttcttcttcctc 11180688



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 9865224 cttcttcttcttcttcttcttcttcctc 9865251



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               ||||||| |||||||| |||||||||||
Sbjct: 9665655 cttcttcctcttcttcttcctcttcctc 9665628



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 9665559 cttcttcttcttcttcttcttcttcctc 9665532



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 9130243 cttcttcttcttcttcttcttcttcctc 9130270



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               ||||||| |||||||| |||||||||||
Sbjct: 8934006 cttcttcctcttcttcttcctcttcctc 8933979



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 8933904 cttcttcttcttcttcttcttcttcctc 8933877



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 8396679 cttcttcttcttcttcttcttcttcctc 8396706



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               ||||||| |||||||| |||||||||||
Sbjct: 8396577 cttcttcctcttcttcttcctcttcctc 8396604



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               ||||||| |||||||| |||||||||||
Sbjct: 8197082 cttcttcctcttcttcttcctcttcctc 8197055



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 8196998 cttcttcttcttcttcttcttcttcctc 8196971



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 5038588 cttcttcttcttcttcttcttcttcctc 5038561



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 4569130 cttcttcttcttcttcttcttcttcctc 4569157



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 4409638 cttcttcttcttcttcttcttcttcctc 4409611



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 3472835 cttcttcttcttcttcttcttcttcctc 3472808



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 3212454 cttcttcttcttcttcttcttcttcctc 3212481



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 1383694 cttcttcttcttcttcttcttcttcctc 1383667



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 1383610 cttcttcttcttcttcttcttcttcctc 1383583



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 913339 cttcttcttcttcttcttcttcttcctc 913366



to top

>gb|AC055710.10| Homo sapiens 3 BAC RP11-307E22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 169964

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 158084 cttcttcttcttcttcctcctcttcctc 158111



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 158075 cttcttcttcttcttcttcttcttcctc 158102



to top

>gb|AC024908.22| Homo sapiens 10 BAC RP11-446F3 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 158349

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 3122 cttcttcttcttcttcctcctcttcctc 3149



to top

>gb|DQ393822.1| Melampsora lini microsatellite Ml-27 sequence
          Length = 456

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 117 cttcttcttcttcttcctcctcttcctc 90



to top

>gb|AC101817.13| Mus musculus chromosome 15, clone RP24-359I22, complete sequence
          Length = 149843

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 139677 cttcttcttcttcttcctcctcttcctc 139650



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 77500 cttcttcttcttcttcttcctcttcctc 77473



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 139686 cttcttcttcttcttcttcttcttcctc 139659



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 77494 cttcttcttcttcctcttcctcttcctc 77467



to top

>gb|AC000052.16| Homo sapiens Chromosome 22q11.2 BAC Clone 77h2 In CES Region, complete
             sequence
          Length = 190363

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 11428 cttcttcttcttcttcctcctcttcctc 11401



to top

>gb|AC004019.20| Homo sapiens Chromosome 22q11.2 BAC Clone 357f7 In CES Region, complete
             sequence
          Length = 260409

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 83596 cttcttcttcttcttcctcctcttcctc 83569



to top

>gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosome 19, complete sequence
          Length = 215073

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 127486 cttcttcttcttcttcctcctcttcctc 127459



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 127522 cttcttcttcttcttcttcctcttc 127498



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||||||||| |||||
Sbjct: 127519 cttcttcttcttcttcctcttcttc 127495



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 127528 cttcttcttcttcttcttcttcttcctc 127501



to top

>gb|AC115775.12| Mus musculus chromosome 8, clone RP23-125P1, complete sequence
          Length = 189510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 43458 cttcttcttcttcttcctcctcttcctc 43485



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||| |||||
Sbjct: 107756 ttcttcttcttcttcctcctcctcctc 107782



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 43521 cttcttcttcttcttcctcttcttc 43545



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||| ||||||||||||||||||||
Sbjct: 43500 cttcctcttcttcttcctcctcttc 43524



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| |||||||| |||||
Sbjct: 107758 cttcttcttcttcctcctcctcctcctc 107785



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 43449 cttcttcttcttcttcttcttcttcctc 43476



to top

>gb|AC111002.5| Homo sapiens BAC clone RP11-196C8 from 2, complete sequence
          Length = 35829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 20659 cttcttcttcttcttcctcctcttcctc 20632



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 20668 cttcttcttcttcttcttcttcttcctc 20641



to top

>gb|AC104638.11| Homo sapiens 3 BAC RP11-689C17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 34051

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 31360 cttcttcttcttcttcctcctcttcctc 31387



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||| |||||||||||||||
Sbjct: 31411 cttcttcttcttgttcctcctcttcctc 31438



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| ||||||||
Sbjct: 31267 cttcttcttcttcttcctcttcttcctc 31294



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 31249 cttcttcttcttcttcctcttcttc 31273



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 31246 cttcttcttcttcttcttcctcttc 31270



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||| |||||||||||
Sbjct: 31273 cttcttcttcctcttcttcctcttcctc 31300



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 31240 cttcttcttcttcttcttcttcttcctc 31267



to top

>gb|AC157988.5| Mus musculus chromosome 3, clone RP23-149E4, complete sequence
          Length = 216259

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 32760 cttcttcttcttcttcctcctcttcctc 32733



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 32769 cttcttcttcttcttcttcttcttcctc 32742



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 32721 cttcctcttcttcttcttcctcttcctc 32694



to top

>emb|BX510350.14| Mouse DNA sequence from clone RP23-123H13 on chromosome 2, complete
             sequence
          Length = 73642

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 14782 cttcttcttcttcttcctcctcttcctc 14809



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 14773 cttcttcttcttcttcttcttcttcctc 14800



to top

>emb|AL928568.17| Mouse DNA sequence from clone RP23-396N8 on chromosome 2, complete
             sequence
          Length = 98566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 63600 cttcttcttcttcttcctcctcttcctc 63573



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 63491 cttcttcttcttcttcctcctcctcctc 63464



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||| |||||
Sbjct: 63310 tcttcttcttcttcctcctcctcctc 63285



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||| |||||||||||||||||
Sbjct: 63261 tcttcttcctcttcctcctcttcctc 63236



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||| |||||||||||||||||
Sbjct: 63225 tcttcttcctcttcctcctcttcctc 63200



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 63636 cttcttcttcttcttcttcctcttc 63612



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 63633 cttcttcttcttcttcctcttcttc 63609



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 563   cttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||||||
Sbjct: 63360 cttcttcttcttcttcctcttcctc 63336



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 63642 cttcttcttcttcttcttcttcttcctc 63615



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 63518 cttcctcttcttcttcttcctcttcctc 63491



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 63488 cttcttcttcttcctcctcctcctcctc 63461



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 63357 cttcttcttcttcctcttcctcttcctc 63330



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 63336 cttcctcttcttcttcttcctcttcctc 63309



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| || ||||||||||||||
Sbjct: 63306 cttcttcttcctcctcctcctcttcctc 63279



to top

>gb|AC144942.4| Mus musculus BAC clone RP23-402N21 from 10, complete sequence
          Length = 200875

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 135914 cttcttcttcttcttcctcctcttcctc 135941



to top

>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete
            sequence
          Length = 168760

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 4566 cttcttcttcttcttcctcctcttcctc 4593



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 4557 cttcttcttcttcttcttcttcttcctc 4584



to top

>gb|AC155159.2| Mus musculus BAC clone RP24-482D1 from 18, complete sequence
          Length = 190752

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 45877 cttcttcttcttcttcctcctcttcctc 45904



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||| |||||||||||||||||
Sbjct: 45852 tcttcttcctcttcctcctcttcctc 45877



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||| ||||||||||||||||||||
Sbjct: 45820 cttcctcttcttcttcctcctcttc 45844



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 45808 cttcttcttcttcttcctcttcttc 45832



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 45805 cttcttcttcttcttcttcctcttc 45829



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 45799 cttcttcttcttcttcttcttcttcctc 45826



to top

>gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complete sequence
          Length = 164883

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 155848 cttcttcttcttcttcctcctcttcctc 155875



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| |||||||||||
Sbjct: 155725 cttcttcttcttcttcttcctcttcctc 155752



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| |||||||||||
Sbjct: 155629 cttcttcttcttcttcttcctcttcctc 155656



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 99306 cttcttcttcttcttcctcctcctcctc 99333



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 155839 cttcttcttcttcttcttcttcttcctc 155866



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| || |||||||||||
Sbjct: 155731 cttcttcttcttcctcttcctcttcctc 155758



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 155719 cttcttcttcttcttcttcttcttcctc 155746



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||| ||||||||||| |||||
Sbjct: 155638 cttcttcttcctcttcctcctcctcctc 155665



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| || |||||
Sbjct: 155632 cttcttcttcttcttcctcttcctcctc 155659



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 155623 cttcttcttcttcttcttcttcttcctc 155650



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 99309 cttcttcttcttcctcctcctcctcctc 99336



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 99303 cttcttcttcttcttcttcctcctcctc 99330



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 99297 cttcttcttcttcttcttcttcttcctc 99324



to top

>emb|CT571252.9| Mouse DNA sequence from clone RP24-91J7 on chromosome 12, complete
            sequence
          Length = 189925

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 9397 cttcttcttcttcttcctcctcttcctc 9370



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| |||||
Sbjct: 167070 cttcttcttcttcctcctcctcctc 167094



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||| || ||||||||||||||
Sbjct: 167073 cttcttcttcctcctcctcctcttcctc 167100



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| || |||||||||||
Sbjct: 9520 cttcttcttcttcctcttcctcttcctc 9493



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 9406 cttcttcttcttcttcttcttcttcctc 9379



to top

>emb|AM087210.1| Phascogale tapoatafa partial adra2b gene for alpha-2B adrenergic
           receptor
          Length = 1149

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 855 cttcttcttcttcttcctcctcttcctc 828



to top

>gb|AC123620.14| Mus musculus chromosome 12, clone RP23-53J21, complete sequence
          Length = 182783

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 48346 cttcttcttcttcttcctcctcttcctc 48319



to top

>emb|AL772216.15| Mouse DNA sequence from clone RP23-153M22 on chromosome 2, complete
              sequence
          Length = 212233

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 111337 cttcttcttcttcttcctcctcttcctc 111364



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 111328 cttcttcttcttcttcttcttcttcctc 111355



to top

>gb|AC116589.5| Mus musculus BAC clone RP24-65K2 from 13, complete sequence
          Length = 213661

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 158678 cttcttcttcttcttcctcctcttcctc 158651



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| ||||||||||||||
Sbjct: 23289 cttcttcttcttcctcctcctcttcctc 23262



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 158708 cttcttcttcttcttcctcctc 158687



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 560   cttcttcttcttcttcctcctc 581
             ||||||||||||||||||||||
Sbjct: 23292 cttcttcttcttcttcctcctc 23271



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||| |||||||||||
Sbjct: 158705 cttcttcttcttcctcctcctcttc 158681



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||| ||||||||||||||||||||
Sbjct: 3301 cttcctcttcttcttcctcctcttc 3325



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 158717 cttcttcttcttcttcttcttcttcctc 158690



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||||| |||||
Sbjct: 158711 cttcttcttcttcttcttcctcctcctc 158684



to top

>gb|AC132334.3| Mus musculus BAC clone RP24-228N8 from 6, complete sequence
          Length = 150109

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 119483 cttcttcttcttcttcctcctcttcctc 119456



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| |||||||||||
Sbjct: 119205 cttcttcttcttcttcttcctcttcctc 119178



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 119492 cttcttcttcttcttcttcttcttcctc 119465



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 119211 cttcttcttcttcttcttcttcttcctc 119184



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| || |||||
Sbjct: 119202 cttcttcttcttcttcctcttcctcctc 119175



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||| ||||||||||| |||||
Sbjct: 119196 cttcttcttcctcttcctcctcctcctc 119169



to top

>gb|AC127698.5| Mus musculus BAC clone RP24-113N24 from 3, complete sequence
          Length = 174669

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 39672 cttcttcttcttcttcctcctcttcctc 39699



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 39663 cttcttcttcttcttcttcttcttcctc 39690



to top

>gb|AC112259.4| Mus musculus BAC clone RP23-179F7 from 12, complete sequence
          Length = 190525

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 43135 cttcttcttcttcttcctcctcttcctc 43162



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 560    cttcttcttcttcttcctcctcttcct 586
              ||||||||||||||||||| |||||||
Sbjct: 187060 cttcttcttcttcttcctcttcttcct 187086



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 187057 cttcttcttcttcttcttcctcttc 187081



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 187051 cttcttcttcttcttcttcttcttcctc 187078



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 43126 cttcttcttcttcttcttcttcttcctc 43153



to top

>gb|AC134614.4| Mus musculus BAC clone RP23-148D12 from 14, complete sequence
          Length = 209278

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 197073 cttcttcttcttcttcctcctcttcctc 197100



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||| |||||
Sbjct: 112528 cttcttcttcttcttcctcctcctcctc 112501



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 197064 cttcttcttcttcttcttcttcttcctc 197091



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 112537 cttcttcttcttcttcttcttcttcctc 112510



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||||| |||||
Sbjct: 112531 cttcttcttcttcttcttcctcctcctc 112504



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| |||||||| |||||
Sbjct: 112525 cttcttcttcttcctcctcctcctcctc 112498



to top

>gb|AC134571.4| Mus musculus BAC clone RP23-435E17 from 3, complete sequence
          Length = 198578

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 96594 cttcttcttcttcttcctcctcttcctc 96567



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 560    cttcttcttcttcttcctcctc 581
              ||||||||||||||||||||||
Sbjct: 162517 cttcttcttcttcttcctcctc 162496



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 96603 cttcttcttcttcttcttcttcttcctc 96576



to top

>gb|AC123548.4| Mus musculus BAC clone RP23-441J16 from 6, complete sequence
          Length = 178488

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 22764 cttcttcttcttcttcctcctcttcctc 22737



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 22486 cttcttcttcttcttcttcctcttcctc 22459



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 22773 cttcttcttcttcttcttcttcttcctc 22746



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 22492 cttcttcttcttcttcttcttcttcctc 22465



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| || |||||
Sbjct: 22483 cttcttcttcttcttcctcttcctcctc 22456



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||||||||| |||||
Sbjct: 22477 cttcttcttcctcttcctcctcctcctc 22450



to top

>emb|AL772171.7| Mouse DNA sequence from clone RP23-36B3 on chromosome 4, complete
             sequence
          Length = 209864

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 37567 cttcttcttcttcttcctcctcttcctc 37594



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||||||||| |||||
Sbjct: 37549 cttcttcttcttcttcctcttcttc 37573



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 37546 cttcttcttcttcttcttcctcttc 37570



to top

>gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, complete sequence
          Length = 193445

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 3948 cttcttcttcttcttcctcctcttcctc 3975



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 10100 tcttcttcctcctcttcctc 10119



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 3939 cttcttcttcttcttcttcttcttcctc 3966



to top

>emb|AL808126.10| Mouse DNA sequence from clone RP23-37B4 on chromosome 2, complete
             sequence
          Length = 94874

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 38023 cttcttcttcttcttcctcctcttcctc 37996



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 38032 cttcttcttcttcttcttcttcttcctc 38005



to top

>emb|AL929001.7| Mouse DNA sequence from clone RP23-324H1 on chromosome 2, complete
             sequence
          Length = 147727

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 22968 cttcttcttcttcttcctcctcttcctc 22941



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 22977 cttcttcttcttcttcttcttcttcctc 22950



to top

>emb|AL158800.6|CNS01RGM Human chromosome 14 DNA sequence BAC R-359N5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 163979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 66160 cttcttcttcttcttcctcctcttcctc 66187



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 66151 cttcttcttcttcttcttcttcttcctc 66178



to top

>emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chromosome X, complete
             sequence
          Length = 264395

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 36687 cttcttcttcttcttcctcctcttcctc 36660



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 36696 cttcttcttcttcttcttcttcttcctc 36669



to top

>emb|AL672251.10| Mouse DNA sequence from clone RP23-16O15 on chromosome 2, complete
              sequence
          Length = 204214

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 152749 cttcttcttcttcttcctcctcttcctc 152776



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 152740 cttcttcttcttcttcttcttcttcctc 152767



to top

>gb|AC107237.7| Mus musculus chromosome 3, clone RP23-475B9, complete sequence
          Length = 173716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 67792 cttcttcttcttcttcctcctcttcctc 67765



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 67801 cttcttcttcttcttcttcttcttcctc 67774



to top

>emb|AL845498.9| Mouse DNA sequence from clone RP23-222D20 on chromosome 2, complete
             sequence
          Length = 154935

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 48850 cttcttcttcttcttcctcctcttcctc 48823



to top

>emb|AL844162.9| Mouse DNA sequence from clone RP23-160O12 on chromosome 2, complete
             sequence
          Length = 80190

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 55622 cttcttcttcttcttcctcctcttcctc 55595



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 55631 cttcttcttcttcttcttcttcttcctc 55604



to top

>emb|AL731826.12| Mouse DNA sequence from clone RP23-123O12 on chromosome 2, complete
             sequence
          Length = 194661

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 27126 cttcttcttcttcttcctcctcttcctc 27099



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||| |||||||||||||||||
Sbjct: 27011 cttcttcctcttcttcctcctcttc 26987



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 186824 tcttcttcctcctcttcctc 186843



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 174783 tcttcttcctcctcttcctc 174764



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 27135 cttcttcttcttcttcttcttcttcctc 27108



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27065 cttcttcctcttcttcctcttcttcctc 27038



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27056 cttcttcctcttcttcctcttcttcctc 27029



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27047 cttcttcctcttcttcctcttcttcctc 27020



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27038 cttcttcctcttcttcctcttcttcctc 27011



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27029 cttcttcctcttcttcctcttcttcctc 27002



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 27020 cttcttcctcttcttcctcttcttcctc 26993



to top

>emb|AL671993.7| Mouse DNA sequence from clone RP23-428E5 on chromosome X, complete
              sequence
          Length = 194106

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 179893 cttcttcttcttcttcctcctcttcctc 179920



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| || |||||||||||||||||
Sbjct: 179902 cttcttcctcctcttcctcctcttcctc 179929



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 35909 tcttcttcctcctcttcctc 35890



to top

>emb|AL732459.5| Mouse DNA sequence from clone RP23-115J4 on chromosome X, complete
              sequence
          Length = 201897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 179665 cttcttcttcttcttcctcctcttcctc 179638



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 67811 cttcttcttcttcttcttcctcttcctc 67784



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| |||||
Sbjct: 179788 cttcttcttcttcctcctcctcctc 179764



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| |||||||| |||||
Sbjct: 179788 cttcttcttcttcctcctcctcctcctc 179761



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 179674 cttcttcttcttcttcttcttcttcctc 179647



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 67817 cttcttcttcttcttcttcttcttcctc 67790



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 67805 cttcttcttcttcctcttcctcttcctc 67778



to top

>gb|AC101660.25| Mus musculus chromosome 15, clone RP23-4I22, complete sequence
          Length = 188464

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 16896 cttcttcttcttcttcctcctcttcctc 16869



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||| ||||||||||
Sbjct: 105788 cttcttcttcttcttccccctcttcctc 105761



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 102487 cttcttcttcttcttcttcctcttc 102463



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||||||||| |||||
Sbjct: 102484 cttcttcttcttcttcctcttcttc 102460



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 102493 cttcttcttcttcttcttcttcttcctc 102466



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 560    cttcttcttcttcttcctcctctt 583
              ||||||||||| ||||||||||||
Sbjct: 102273 cttcttcttctccttcctcctctt 102250



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 16905 cttcttcttcttcttcttcttcttcctc 16878



to top

>gb|AC118599.24| Mus musculus chromosome 5, clone RP23-459G5, complete sequence
          Length = 194003

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||||
Sbjct: 5383 cttcttcttcttcttcctcctcttcctc 5410



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||||||||| |||||
Sbjct: 5511 cttcttcttcttcttcctcctcctcctc 5538



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||| |||| |||||||||||||||||
Sbjct: 5589 cttctccttcctcttcctcctcttcctc 5616



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||| |||||||| |||||
Sbjct: 5514 cttcttcttcttcctcctcctcctcctc 5541



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| ||||| |||||
Sbjct: 5508 cttcttcttcttcttcttcctcctcctc 5535



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 5502 cttcttcttcttcttcttcttcttcctc 5529



to top

>gb|AC162441.11| Mus musculus chromosome 1, clone RP23-2E23, complete sequence
          Length = 225487

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||||
Sbjct: 223128 cttcttcttcttcttcctcctcttcctc 223155



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 223119 cttcttcttcttcttcttcttcttcctc 223146



to top

>dbj|AB018492.1| Homo sapiens DNA, trinucleotide repeats region, clone GAA33
          Length = 421

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 266 cttcttcttcttcttcctcctcttcctc 293



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           |||||||||||||||| || ||||||||
Sbjct: 257 cttcttcttcttcttcttcttcttcctc 284



to top

>dbj|AB018525.1| Homo sapiens DNA, trinucleotide repeats region, clone GAA C65
          Length = 421

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||||
Sbjct: 266 cttcttcttcttcttcctcctcttcctc 293



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           |||||||||||||||| || ||||||||
Sbjct: 257 cttcttcttcttcttcttcttcttcctc 284



to top

>emb|AL844557.3| Mouse DNA sequence from clone RP23-203N14 on chromosome 2, complete
             sequence
          Length = 122538

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||||
Sbjct: 73134 cttcttcttcttcttcctcctcttcctc 73161



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 73125 cttcttcttcttcttcttcttcttcctc 73152



to top

>gb|AC152418.5| Mus musculus BAC clone RP23-7L11 from chromosome 7, complete sequence
          Length = 249571

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 18763 cttcttcttcttcttcctcctcttcct 18789



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 18754 cttcttcttcttcttcttcttcttcctc 18781



to top

>gb|AC120870.8| Mus musculus chromosome 1, clone RP23-15D1, complete sequence
          Length = 233914

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 90281 cttcttcttcttcttcctcctcttcct 90307



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             ||||||| |||||||||||||||||||
Sbjct: 90239 cttcttcctcttcttcctcctcttcct 90265



to top

>ref|XM_324419.1| Neurospora crassa OR74A hypothetical protein (NCU05063.1) partial
           mRNA
          Length = 1038

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 561 ttcttcttcttcttcctcctcttcctc 587
           |||||||||||||||||||||||||||
Sbjct: 615 ttcttcttcttcttcctcctcttcctc 641



to top

>ref|XM_951344.1| Neurospora crassa OR74A hypothetical protein (NCU05063.1) partial
           mRNA
          Length = 1038

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 561 ttcttcttcttcttcctcctcttcctc 587
           |||||||||||||||||||||||||||
Sbjct: 615 ttcttcttcttcttcctcctcttcctc 641



to top

>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence
          Length = 191700

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 84372 cttcttcttcttcttcctcctcttcct 84346



to top

>gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, complete sequence
          Length = 262581

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||||
Sbjct: 109452 ttcttcttcttcttcctcctcttcctc 109478



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 564    ttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||
Sbjct: 109322 ttcttcttcttcctcctcttcctc 109345



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 72892 cttcttcttcttcttcttcctcttcctc 72919



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 564    ttcttcttcttcctcctcttcctc 587
              |||||||||||||||||| |||||
Sbjct: 109361 ttcttcttcttcctcctcctcctc 109384



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| || |||||||||||||||||
Sbjct: 109327 cttcttcctcctcttcctcctcttcctc 109354



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 72898 cttcttcttcttcctcttcctcttcctc 72925



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 72886 cttcttcttcttcttcttcttcttcctc 72913



to top

>gb|AC154710.2| Mus musculus BAC clone RP24-357L12 from chromosome 14, complete sequence
          Length = 163421

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||||
Sbjct: 161762 ttcttcttcttcttcctcctcttcctc 161736



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||||||||||||
Sbjct: 22990 cttcttcctcttcttcctcctcttcctc 23017



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 23077 cttcttcttcttcttcttcttcttcctc 23104



to top

>gb|AC092920.7| Homo sapiens 3 BAC RP11-255G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164878

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||||
Sbjct: 76206 ttcttcttcttcttcctcctcttcctc 76232



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||||
Sbjct: 76164 ttcttcttcttcttcctcctcttcctc 76190



to top

>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence
          Length = 185947

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 58303 cttcttcttcttcttcctcctcttcct 58277



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 58176 cttcttcttcttcttcctcctcctcctc 58149



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58312 cttcttcttcttcttcttcttcttcctc 58285



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 58185 cttcttcttcttcttcttcttcttcctc 58158



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 58179 cttcttcttcttcttcttcctcctcctc 58152



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 58173 cttcttcttcttcctcctcctcctcctc 58146



to top

>gb|AC102790.7| Mus musculus chromosome 19, clone RP23-321D22, complete sequence
          Length = 242249

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||||
Sbjct: 127584 ttcttcttcttcttcctcctcttcctc 127610



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 127466 cttcttcttcttcttcttcctcttc 127490



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 560    cttcttcttcttcttcctcctctt 583
              ||||||||||||||||||| ||||
Sbjct: 127469 cttcttcttcttcttcctcttctt 127492



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 561    ttcttcttcttcttcctcctcttc 584
              |||||||||||||||||| |||||
Sbjct: 127446 ttcttcttcttcttcctcttcttc 127469



to top

>emb|AL669946.9| Mouse DNA sequence from clone RP23-71G18 on chromosome 11 Contains the 3'
              end of a novel gene, the Nsg2 gene neuron specific gene
              family, a novel gene and a CpG island, complete sequence
          Length = 177182

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 560    cttcttcttcttcttcctcctcttcct 586
              |||||||||||||||||||||||||||
Sbjct: 175756 cttcttcttcttcttcctcctcttcct 175730



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 175765 cttcttcttcttcttcttcttcttcctc 175738



to top

>gb|AC106857.8| Homo sapiens chromosome 8, clone RP11-262O21, complete sequence
          Length = 159454

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 10639 cttcttcttcttcttcctcctcttcct 10613



to top

>gb|AC022666.14| Homo sapiens, clone RP11-30K7, complete sequence
          Length = 150721

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 560    cttcttcttcttcttcctcctcttcct 586
              |||||||||||||||||||||||||||
Sbjct: 134417 cttcttcttcttcttcctcctcttcct 134443



to top

>emb|BX842600.1| Neurospora crassa DNA linkage group II BAC clone B15P20
          Length = 74452

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 561  ttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||||||||||||||
Sbjct: 1147 ttcttcttcttcttcctcctcttcctc 1121



to top

>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence
          Length = 193119

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 560    cttcttcttcttcttcctcctcttcct 586
              |||||||||||||||||||||||||||
Sbjct: 191378 cttcttcttcttcttcctcctcttcct 191404



to top

>emb|CT573019.12| Mouse DNA sequence from clone RP24-94G12 on chromosome 14, complete
             sequence
          Length = 136188

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||||
Sbjct: 32426 ttcttcttcttcttcctcctcttcctc 32400



to top

>gb|AC149277.11| Mus musculus BAC clone RP24-213J23 from chromosome 7, complete sequence
          Length = 198579

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 560   cttcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||||
Sbjct: 57666 cttcttcttcttcttcctcctcttcct 57640



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 57675 cttcttcttcttcttcttcttcttcctc 57648



to top

>gb|AC109606.11| Mus musculus strain C57BL/6J chromosome 5 clone rp23-113m20, complete
             sequence
          Length = 210959

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||||
Sbjct: 74739 ttcttcttcttcttcctcctcttcctc 74713



to top

>gb|AC137515.3| Mus musculus BAC clone RP23-258C20 from 1, complete sequence
          Length = 215582

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||||
Sbjct: 24601 ttcttcttcttcttcctcctcttcctc 24575



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 61113 cttcttcttcttcttcttcctcttcctc 61086



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 564   ttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||
Sbjct: 24725 ttcttcttcttcctcctcttcctc 24702



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 61119 cttcttcttcttcttcttcttcttcctc 61092



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 61107 cttcttcttcttcctcttcctcttcctc 61080



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| || |||||||||||||||||
Sbjct: 24720 cttcttcctcctcttcctcctcttcctc 24693



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 564   ttcttcttcttcctcctcttcctc 587
             |||||||||||||||||| |||||
Sbjct: 24686 ttcttcttcttcctcctcctcctc 24663



to top

>gb|AC154329.3| Mus musculus BAC clone RP23-266K11 from chromosome 13, complete sequence
          Length = 188096

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 560    cttcttcttcttcttcctcctcttcct 586
              |||||||||||||||||||||||||||
Sbjct: 133429 cttcttcttcttcttcctcctcttcct 133403



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 145548 cttcttcttcttcttcttcctcttc 145524



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||||||||| |||||
Sbjct: 145545 cttcttcttcttcttcctcttcttc 145521



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 145554 cttcttcttcttcttcttcttcttcctc 145527



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 133438 cttcttcttcttcttcttcttcttcctc 133411



to top

>emb|AL929446.5| Mouse DNA sequence from clone RP23-177M10 on chromosome 11,
           complete sequence
          Length = 118812

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 560 cttcttcttcttcttcctcctcttcct 586
           |||||||||||||||||||||||||||
Sbjct: 574 cttcttcttcttcttcctcctcttcct 548



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           |||||||||||||||| || ||||||||
Sbjct: 583 cttcttcttcttcttcttcttcttcctc 556



to top

>ref|NM_202851.1| Arabidopsis thaliana electron carrier AT4G20830 transcript variant
           AT4G20830.2 mRNA, complete cds
          Length = 1863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 66  ttcttcttcttcttcctcctcttcct 91



to top

>ref|NM_118201.2| Arabidopsis thaliana electron carrier AT4G20830 transcript variant
           AT4G20830.1 mRNA, complete cds
          Length = 1886

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 73  ttcttcttcttcttcctcctcttcct 98



to top

>ref|XM_511299.1| PREDICTED: Pan troglodytes similar to Zinc finger and BTB domain
           containing protein 4 (KAISO-like zinc finger protein 1)
           (KAISO-L1) (LOC454462), mRNA
          Length = 1370

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 563 cttcttcttcttcctcctcttcctcg 588
           ||||||||||||||||||||||||||
Sbjct: 577 cttcttcttcttcctcctcttcctcg 602



to top

>ref|XM_518365.1| PREDICTED: Pan troglodytes similar to HLA-B associated transcript 8
           BAT8 isoform a; G9A histone methyltransferase; ankyrin
           repeat-containing protein; NG36 protein; chromosome 6
           open reading frame 30 (LOC462572), mRNA
          Length = 3837

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 995 tcttcttcttcttcctcctcttcctc 970



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||| ||||||||||||||
Sbjct: 1021 cttcttcctcttcctcctcctcttcctc 994



to top

>gb|AY439179.1|AY439178S2 Drosophila virilis troponin T (TpnT) gene, exons 5 through 10A, 10B,
            and 11 and complete cds, alternatively spliced
          Length = 4138

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 4113 tcttcttcttcttcctcctcttcctc 4088



to top

>gb|AC158909.6| Mus musculus chromosome 1, clone RP23-118K4, complete sequence
          Length = 218810

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 91732 tcttcttcttcttcctcctcttcctc 91757



to top

>gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG22, G9, HSP70-2,
             HSP70-1, HSP70-HOM, snRNP, G7A, NG37, NG23, and MutSH5
             genes, complete cds
          Length = 180283

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 28494 tcttcttcttcttcctcctcttcctc 28469



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 28520 cttcttcctcttcctcctcctcttcctc 28493



to top

>gb|AF109906.1|MMHC310M6 Mus musculus MHC class III region RD gene, partial cds; Bf, C2, G9A,
             NG22, G9, HSP70, HSP70, HSC70t, and smRNP genes, complete
             cds; G7A gene, partial cds; and unknown genes
          Length = 158405

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 54517 tcttcttcttcttcctcctcttcctc 54492



to top

>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 213379

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 140404 tcttcttcttcttcctcctcttcctc 140379



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 140542 tcttcttcttcctcctcttcctc 140520



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 140494 tcttcttcttcctcctcttcctc 140472



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 140449 tcttcttcttcctcctcttcctc 140427



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||||||||
Sbjct: 197038 cttcttcttcttcctcttcttcctc 197014



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||| ||||| |||||||||||
Sbjct: 197035 cttcttcttcctcttcttcctcttcctc 197008



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 565    tcttcttcttcctcctcttc 584
              ||||||||||||||||||||
Sbjct: 140557 tcttcttcttcctcctcttc 140538



to top

>ref|XM_715405.1| Candida albicans SC5314 putative transcription factor (CaO19_2748),
            mRNA
          Length = 2925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1877 tcttcttcttcttcctcctcttcctc 1852



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 560  cttcttcttcttcttcctcctc 581
            ||||||||||||||||||||||
Sbjct: 1849 cttcttcttcttcttcctcctc 1828



to top

>ref|XM_715174.1| Candida albicans SC5314 putative transcription factor (CaO19_10262),
            mRNA
          Length = 2925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1877 tcttcttcttcttcctcctcttcctc 1852



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 560  cttcttcttcttcttcctcctc 581
            ||||||||||||||||||||||
Sbjct: 1849 cttcttcttcttcttcctcctc 1828



to top

>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence
          Length = 230097

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 560   cttcttcttcttcttcctcctcttcc 585
             ||||||||||||||||||||||||||
Sbjct: 48924 cttcttcttcttcttcctcctcttcc 48899



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 182107 tcttcttcctcctcttcctc 182126



to top

>gb|AC158521.2| Mus musculus BAC clone RP23-404M10 from chromosome 14, complete
             sequence
          Length = 205501

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 560   cttcttcttcttcttcctcctcttcc 585
             ||||||||||||||||||||||||||
Sbjct: 61473 cttcttcttcttcttcctcctcttcc 61498



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 61464 cttcttcttcttcttcttcttcttcctc 61491



to top

>gb|AY422088.1| Astatotilapia burtoni neuroD (nrd) mRNA, complete cds
          Length = 1744

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 313 tcttcttcttcttcctcctcttcctc 288



to top

>emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chromosome 16, complete
             sequence
          Length = 233599

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 74254 tcttcttcttcttcctcctcttcctc 74229



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| ||||||||||||||
Sbjct: 74295 cttcttcttcttcctcctcctcttcctc 74268



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 563   cttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||||||
Sbjct: 74152 cttcttcttcttcttcctcttcctc 74128



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 74296 tcttcttcttcttcctcctc 74277



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| |||||||||||||| ||||||||
Sbjct: 74134 cttcctcttcttcttcctcttcttcctc 74107



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||| |||||||||||
Sbjct: 74128 cttcttcttcctcttcttcctcttcctc 74101



to top

>ref|XM_386228.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06052.1)
            partial mRNA
          Length = 2442

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1196 tcttcttcttcttcctcctcttcctc 1171



to top

>gb|BC079005.1| Rattus norvegicus eukaryotic translation initiation factor 3, subunit
            7 (zeta), mRNA (cDNA clone MGC:93918 IMAGE:7113045),
            complete cds
          Length = 1870

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1723 tcttcttcttcttcctcctcttcctc 1698



to top

>gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome 13, complete sequence
          Length = 193255

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 179250 tcttcttcttcttcctcctcttcctc 179225



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 179131 cttcttcctcttcttcctcttcttcctc 179104



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 179122 cttcttcctcttcttcctcttcttcctc 179095



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| |||||||||||||| |||||
Sbjct: 179113 cttcttcctcttcttcctcctcctcctc 179086



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 561    ttcttcttcttcttcctcctcttc 584
              ||||||||||||||| ||||||||
Sbjct: 179052 ttcttcttcttcttcttcctcttc 179029



to top

>ref|XM_807566.1| Trypanosoma cruzi strain CL Brener flagellar radial spoke component
            (Tc00.1047053504089.50) partial mRNA
          Length = 1791

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1241 tcttcttcttcttcctcctcttcctc 1216



to top

>gb|AC124455.6| Mus musculus BAC clone RP24-129J9 from chromosome 15, complete sequence
          Length = 167059

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 560   cttcttcttcttcttcctcctcttcc 585
             ||||||||||||||||||||||||||
Sbjct: 68662 cttcttcttcttcttcctcctcttcc 68687



to top

>gb|AC104920.10| Mus musculus chromosome 10, clone RP23-360H23, complete sequence
          Length = 212273

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 74028 tcttcttcttcttcctcctcttcctc 74003



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| ||||||||
Sbjct: 74213 cttcttcttcttcttcctcttcttcctc 74186



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| |||||||||||||||||
Sbjct: 73985 cttcttcttcctcttcctcctcttcctc 73958



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| |||||||||||||||||
Sbjct: 73874 cttcttcttcctcttcctcctcttcctc 73847



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||||||||||||
Sbjct: 73811 cttcttcctcttcttcctcctcttcctc 73784



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||| |||||||||||||||||
Sbjct: 74160 tcttcttcctcttcctcctcttcctc 74135



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||| ||||||||||||||||||||
Sbjct: 73923 tcttcctcttcttcctcctcttcctc 73898



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 74216 cttcttcttcttcttcttcctcttc 74192



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 74222 cttcttcttcttcttcttcttcttcctc 74195



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||| |||||||||||
Sbjct: 74207 cttcttcttcctcttcttcctcttcctc 74180



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 557   acacttcttcttcttcttcctcctcttc 584
             ||||||||||||| |||||||| |||||
Sbjct: 74117 acacttcttcttcctcttcctcttcttc 74090



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 74102 cttcctcttcttcttcttcctcttcctc 74075



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| ||||||||||| |||||||||||
Sbjct: 74081 cttcctcttcttcttcttcctcttcctc 74054



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 73820 cttcttcctcttcttcctcttcttcctc 73793



to top

>ref|XM_721940.1| Plasmodium yoelii yoelii str. 17XNL DNA repair protein RAD54
            (PY00810) partial mRNA
          Length = 3494

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 3190 tcttcttcttcttcctcctcttcctc 3165



to top

>ref|XM_664868.1| Plasmodium berghei strain ANKA hypothetical protein (PB300519.00.0)
           partial mRNA
          Length = 330

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 98  tcttcttcttcttcctcctcttcctc 73



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 568 tcttcttcctcctcttcctc 587
           ||||||||||||||||||||
Sbjct: 116 tcttcttcctcctcttcctc 97



to top

>ref|XM_675000.1| Plasmodium berghei strain ANKA hypothetical protein (PB001194.00.0)
            partial mRNA
          Length = 2847

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 2522 tcttcttcttcttcctcctcttcctc 2497



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 568  tcttcttcctcctcttcctc 587
            ||||||||||||||||||||
Sbjct: 2540 tcttcttcctcctcttcctc 2521



to top

>ref|XM_661959.1| Cryptosporidium hominis TU502 trehalose synthase (Chro.80565) partial
            mRNA
          Length = 4197

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 3289 tcttcttcttcttcctcctcttcctc 3314



to top

>ref|NM_001004283.1| Rattus norvegicus eukaryotic translation initiation factor 3, subunit
            7 (zeta) (Eif3s7), mRNA
          Length = 1870

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1723 tcttcttcttcttcctcctcttcctc 1698



to top

>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
             NEU1 gene for sialidase 1 (lysosomal sialidase), the
             C6orf29 gene for chromosome 6 open reading frame 29, the
             BAT8 gene for HLA-B associated transcript 8, a novel
             transcript DAQB-331I12.5, the ZBTB12 gene (previously
             C6orf46) for zinc finger and BTB domain containing 12, the
             C2 gene for complement component 2, the Bf gene for
             B-factor, properdin, the RDBP gene for RD RNA binding
             protein, the SKIV2L gene for superkiller viralicidic
             activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
             homolog Z (C. elegans), the STK19 gene for
             serine/threonine kinase 19, the 5' end of the C4A gene for
             complement component 4A and 8 CpG isalnds, complete
             sequence
          Length = 153464

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 43657 tcttcttcttcttcctcctcttcctc 43682



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 43631 cttcttcctcttcctcctcctcttcctc 43658



to top

>emb|X69838.1|HSG9A H.sapiens mRNA for G9a
          Length = 3391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 355 tcttcttcttcttcctcctcttcctc 330



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 381 cttcttcctcttcctcctcctcttcctc 354



to top

>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             gene for  chromosome 6 open reading frame 28, the HSPA1L
             gene for heat shock 70kDa protein 1-like, the HSPA1A gene
             for heat shock 70kDa protein 1A, the HSPA1B gene for heat
             shock 70kDa protein 1B, the gene for chromosome 6 open
             reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene forchromosome 6 open reading frame
             29, the gene for  HLA-B associated transcript 8, the gene
             for chromosome 6 open reading frame 46 and eight CpG
             islands, complete sequence
          Length = 113582

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 97380 tcttcttcttcttcctcctcttcctc 97405



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 97354 cttcttcctcttcctcctcctcttcctc 97381



to top

>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
              MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
              protein, the gene for chromosome 6 open reading frame 27,
              the VARS2 gene for valyl-tRNA synthetase 2, the gene for
              chromosome 6 open reading frame 28, the HSPA1L gene for
              heat shock 70kDa protein 1-like, the HSPA1A gene for heat
              shock 70kDa protein 1A, the HSPA1B gene for heat shock
              70kDa protein 1B, the gene for chromosome 6 open reading
              frame 48, the NEU1 gene for sialidase 1 (lysosomal
              sialidase), the gene for chromosome 6 open reading frame
              29, the BAT8 gene for HLA-B associated transcript 8, the
              gene for chromosome 6 open reading frame 46 and nine CpG
              islands, complete sequence
          Length = 179894

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 153591 tcttcttcttcttcctcctcttcctc 153616



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||| ||||||||||||||
Sbjct: 153565 cttcttcctcttcctcctcctcttcctc 153592



to top

>emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chromosome 9 Contains a
             pseudogene similar to part of serine/threonine kinase 33
             (STK33), complete sequence
          Length = 69362

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 560   cttcttcttcttcttcctcctcttcc 585
             ||||||||||||||||||||||||||
Sbjct: 55265 cttcttcttcttcttcctcctcttcc 55240



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||| ||||||||||||||| |||||
Sbjct: 55372 cttctttttcttcttcctcctcctcctc 55345



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 55274 cttcttcttcttcttcttcttcttcctc 55247



to top

>ref|NM_145830.1| Mus musculus euchromatic histone lysine N-methyltransferase 2
            (Ehmt2), transcript variant long, mRNA
          Length = 4026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1091 tcttcttcttcttcctcctcttcctc 1066



to top

>ref|NM_147151.1| Mus musculus euchromatic histone lysine N-methyltransferase 2
           (Ehmt2), transcript variant short, mRNA
          Length = 3757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 920 tcttcttcttcttcctcctcttcctc 895



to top

>emb|AL354795.17| Human DNA sequence from clone RP11-174B4 on chromosome 9q21.2-22.1
            Contains the TRPM6 gene for transient receptor potential
            cation channel, subfamily  M, member 6 (CHAK2, FLJ20087,
            FLJ22628) and 2 CpG islands, complete sequence
          Length = 195290

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 558  cacttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||||| |||||||||||
Sbjct: 1763 cacttcttcttcttcttcttcctcttcctc 1734



to top

>gb|AY096621.1| Arabidopsis thaliana unknown protein (At5g55040) mRNA, complete cds
          Length = 2782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 560 cttcttcttcttcttcctcctcttcc 585
           ||||||||||||||||||||||||||
Sbjct: 460 cttcttcttcttcttcctcctcttcc 435



to top

>gb|AY074282.1| Arabidopsis thaliana unknown protein (At5g55040) mRNA, complete cds
          Length = 3235

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 560 cttcttcttcttcttcctcctcttcc 585
           ||||||||||||||||||||||||||
Sbjct: 570 cttcttcttcttcttcctcctcttcc 545



to top

>gb|BC058357.1| Mus musculus euchromatic histone lysine N-methyltransferase 2, mRNA
           (cDNA clone IMAGE:6822432), partial cds
          Length = 3905

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 925 tcttcttcttcttcctcctcttcctc 900



to top

>emb|AL161553.2|ATCHRIV53 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 53
          Length = 197568

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 561    ttcttcttcttcttcctcctcttcct 586
              ||||||||||||||||||||||||||
Sbjct: 159670 ttcttcttcttcttcctcctcttcct 159695



to top

>emb|AL080254.1|ATF21C20 Arabidopsis thaliana DNA chromosome 4, BAC clone F21C20 (ESSA project)
          Length = 69563

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 561   ttcttcttcttcttcctcctcttcct 586
             ||||||||||||||||||||||||||
Sbjct: 64187 ttcttcttcttcttcctcctcttcct 64212



to top

>emb|AJ315532.1|HSA315532 Homo sapiens mRNA for NG36/G9a protein
          Length = 3633

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 935 tcttcttcttcttcctcctcttcctc 910



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 961 cttcttcctcttcctcctcctcttcctc 934



to top

>gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, complete sequence
          Length = 203826

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 18451 tcttcttcttcttcctcctcttcctc 18426



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| ||||||||
Sbjct: 185536 cttcttcttcttcttcctcttcttcctc 185509



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 565   tcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||
Sbjct: 18478 tcttcttcttcctcctcttcctc 18456



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||| ||||||||||||||||||||
Sbjct: 18325 tcttcctcttcttcctcctcttcctc 18300



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||| ||||||||||||||||||||
Sbjct: 18193 tcttcctcttcttcctcctcttcctc 18168



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||| ||||||||||||||
Sbjct: 18151 tcttcttcttcctcctcctcttcctc 18126



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 185539 cttcttcttcttcttcttcctcttc 185515



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 185545 cttcttcttcttcttcttcttcttcctc 185518



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 185527 cttcttcctcttcttcctcttcttcctc 185500



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 185518 cttcttcctcttcttcctcttcttcctc 185491



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 18529 tcttcttcctcctcttcctc 18510



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 18502 tcttcttcctcctcttcctc 18483



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| |||||||||||||| |||||
Sbjct: 18048 cttcttcctcttcttcctcctcctcctc 18021



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||| || |||||||||||||||||||
Sbjct: 17317 cttctcctccttcttcctcctcttcctc 17290



to top

>emb|CR936237.6| Human DNA sequence from clone DAAP-66K18 on chromosome 6, complete
             sequence
          Length = 40906

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 32646 tcttcttcttcttcctcctcttcctc 32671



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 32620 cttcttcctcttcctcctcctcttcctc 32647



to top

>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 154687

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 558   cacttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||| |||||
Sbjct: 92647 cacttcttcttcttcttcctcctcctcctc 92618



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 92642 cttcttcttcttcctcctcctcctcctc 92615



to top

>emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chromosome 6, complete
             sequence
          Length = 108340

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 82245 tcttcttcttcttcctcctcttcctc 82220



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 82271 cttcttcctcttcctcctcctcttcctc 82244



to top

>emb|CR759784.6| Human DNA sequence from clone DAMC-303C24 on chromosome 6, complete
             sequence
          Length = 63128

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 48463 tcttcttcttcttcctcctcttcctc 48488



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 48437 cttcttcctcttcctcctcctcttcctc 48464



to top

>emb|BX005460.8| Human DNA sequence from clone DASS-36P22 on chromosome 6, complete
             sequence
          Length = 36497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 35353 tcttcttcttcttcctcctcttcctc 35378



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 35327 cttcttcctcttcctcctcctcttcctc 35354



to top

>emb|CR388219.12| Human DNA sequence from clone DADB-122G4 on chromosome 6, complete
            sequence
          Length = 71590

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 4248 tcttcttcttcttcctcctcttcctc 4273



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||| ||||||||||||||
Sbjct: 4222 cttcttcctcttcctcctcctcttcctc 4249



to top

>gb|AY133533.1| Arabidopsis thaliana At4g20830/F21C20_180 mRNA, complete cds
          Length = 1623

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 40  ttcttcttcttcttcctcctcttcct 65



to top

>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete
             Sequence, complete sequence
          Length = 221899

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 13816 tcttcttcttcttcctcctcttcctc 13791



to top

>gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 map 17, complete sequence
          Length = 223005

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 194838 tcttcttcttcttcctcctcttcctc 194813



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 44913 tcttcttcttcttcctcctc 44894



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 44850 tcttcttcttcttcctcctc 44831



to top

>ref|XM_631518.1| Dictyostelium discoideum AX4 hypothetical protein (DDB0188041),
           partial mRNA
          Length = 591

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 503 tcttcttcttcttcctcctcttcctc 478



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| || |||||||||||||||||
Sbjct: 496 cttcttcctcctcttcctcctcttcctc 469



to top

>gb|AY062595.1| Arabidopsis thaliana Unknown protein (F21C20.180:F21C20.190) mRNA,
           complete cds
          Length = 4231

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 66  ttcttcttcttcttcctcctcttcct 91



to top

>dbj|AK154246.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630011O04
            product:HLA-B associated transcript 8, full insert
            sequence
          Length = 3938

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1114 tcttcttcttcttcctcctcttcctc 1089



to top

>gb|AC118231.9| Mus musculus chromosome 5, clone RP23-462J24, complete sequence
          Length = 186083

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 3884 tcttcttcttcttcctcctcttcctc 3859



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||| ||||||||
Sbjct: 3664 cttcttcttcttcttcctcttcttcctc 3637



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||||||||||||||| ||||||||
Sbjct: 3667 cttcttcttcttcttcttcctcttc 3643



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 3673 cttcttcttcttcttcttcttcttcctc 3646



to top

>gb|AF424621.1|AF424621 Arabidopsis thaliana AT4g20830/F21C20_180 mRNA, complete cds
          Length = 1863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 66  ttcttcttcttcttcctcctcttcct 91



to top

>gb|BC020970.1| Homo sapiens euchromatic histone-lysine N-methyltransferase 2, mRNA
           (cDNA clone IMAGE:3912870), partial cds
          Length = 3957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 900 tcttcttcttcttcctcctcttcctc 875



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 926 cttcttcctcttcctcctcctcttcctc 899



to top

>gb|BC018718.1| Homo sapiens euchromatic histone-lysine N-methyltransferase 2, mRNA
           (cDNA clone MGC:31802 IMAGE:4123580), complete cds
          Length = 3963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 923 tcttcttcttcttcctcctcttcctc 898



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 949 cttcttcctcttcctcctcctcttcctc 922



to top

>gb|BC002686.1| Homo sapiens euchromatic histone-lysine N-methyltransferase 2, mRNA
           (cDNA clone IMAGE:3607648), partial cds
          Length = 3484

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 435 tcttcttcttcttcctcctcttcctc 410



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 461 cttcttcctcttcctcctcctcttcctc 434



to top

>gb|BC009351.1| Homo sapiens euchromatic histone-lysine N-methyltransferase 2, mRNA
           (cDNA clone IMAGE:4138717), partial cds
          Length = 3972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 932 tcttcttcttcttcctcctcttcctc 907



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 958 cttcttcctcttcctcctcctcttcctc 931



to top

>gb|AC159280.2| Mus musculus BAC clone RP23-347A2 from chromosome 13, complete sequence
          Length = 200540

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 193313 tcttcttcttcttcctcctcttcctc 193338



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| |||||||||||
Sbjct: 5178 cttcttcttcttcttcttcctcttcctc 5205



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 562   tcttcttcttcttcctcctcttc 584
             |||||||||||||||||||||||
Sbjct: 32840 tcttcttcttcttcctcctcttc 32862



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             ||||||||||||| |||||||||||
Sbjct: 32897 cttcttcttcttcctcctcctcttc 32921



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 561    ttcttcttcttcttcctcctcttc 584
              ||||||||||||||| ||||||||
Sbjct: 193511 ttcttcttcttcttcttcctcttc 193534



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| |||||||||||||| |||||
Sbjct: 193450 cttcttcctcttcttcctcctcctcctc 193477



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 193441 cttcttcctcttcttcctcttcttcctc 193468



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| ||||||||||| ||||||||
Sbjct: 193432 cttcttcctcttcttcctcttcttcctc 193459



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 32896 tcttcttcttcttcctcctc 32915



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 32742 tcttcttcttcttcctcctc 32761



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 5172 cttcttcttcttcttcttcttcttcctc 5199



to top

>ref|NM_025256.4| Homo sapiens euchromatic histone-lysine N-methyltransferase 2
           (EHMT2), transcript variant NG36/G9a-SPI, mRNA
          Length = 3892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 945 tcttcttcttcttcctcctcttcctc 920



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 971 cttcttcctcttcctcctcctcttcctc 944



to top

>ref|NM_006709.2| Homo sapiens euchromatic histone-lysine N-methyltransferase 2
           (EHMT2), transcript variant NG36/G9a, mRNA
          Length = 3994

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 945 tcttcttcttcttcctcctcttcctc 920



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||| ||||| ||||||||||||||
Sbjct: 971 cttcttcctcttcctcctcctcttcctc 944



to top

>emb|BX827154.1|CNS0A4MY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZF05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 55  ttcttcttcttcttcctcctcttcct 80



to top

>emb|BX827481.1|CNS0A48P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS60ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1820

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 561 ttcttcttcttcttcctcctcttcct 586
           ||||||||||||||||||||||||||
Sbjct: 55  ttcttcttcttcttcctcctcttcct 80



to top

>dbj|AB088213.1| Homo sapiens KIF1Bbeta mRNA for kinesin family member 1Bbeta isoform
            IV, complete cds
          Length = 8572

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 559  acttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||||||||||
Sbjct: 2090 acttcttcttcttcttcctcctcttc 2065



to top

>dbj|AB088212.1| Homo sapiens KIF1Bbeta mRNA for kinesin family member 1Bbeta isoform
            III, complete cds
          Length = 8614

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 559  acttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||||||||||
Sbjct: 2132 acttcttcttcttcttcctcctcttc 2107



to top

>dbj|AB088211.1| Homo sapiens KIF1Bbeta mRNA for kinesin family member 1Bbeta isoform
            II, complete cds
          Length = 8650

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 559  acttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||||||||||
Sbjct: 2168 acttcttcttcttcttcctcctcttc 2143



to top

>dbj|AB088210.1| Homo sapiens KIF1Bbeta mRNA for kinesin family member 1Bbeta isoform
            I, complete cds
          Length = 8692

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 559  acttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||||||||||
Sbjct: 2210 acttcttcttcttcttcctcctcttc 2185



to top

>gb|AY211285.1| Eleutherodactylus noblei USNM534195 cellular myelocytomatosis (c-myc)
            gene, exons 2 and 3 and partial cds
          Length = 1220

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1003 tcttcttcttcttcctcctcttcctc 978



to top

>gb|AC154651.2| Mus musculus BAC clone RP24-261K2 from chromosome 9, complete sequence
          Length = 173354

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 558    cacttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||||| |||||||||||
Sbjct: 104566 cacttcttcttcttcttcttcctcttcctc 104537



to top

>gb|AC154187.2| Mus musculus BAC clone RP24-444N2 from chromosome 17, complete
           sequence
          Length = 224908

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 214 tcttcttcttcttcctcctcttcctc 189



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| ||||||||
Sbjct: 55299 cttcttcttcttcttcctcttcttcctc 55326



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 55296 cttcttcttcttcttcttcctcttc 55320



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| |||||||||||||| |||||
Sbjct: 55308 cttcttcctcttcttcctcctcctcctc 55335



to top

>gb|AC007220.4|AC007220 Homo sapiens chromosome 16 clone RP11-396B14, complete sequence
          Length = 172945

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 107221 tcttcttcttcttcctcctcttcctc 107246



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| || |||||||||||||||||
Sbjct: 107228 cttcttcctcctcttcctcctcttcctc 107255



to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 54304 tcttcttcttcttcctcctcttcctc 54279



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| |||||||||||
Sbjct: 2217306 cttcttcttcttcttcttcctcttcctc 2217333



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               ||||||||||||| || |||||||||||
Sbjct: 2217312 cttcttcttcttcctcttcctcttcctc 2217339



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 560     cttcttcttcttcttcctcctcttcctc 587
               |||||||||||||||| || ||||||||
Sbjct: 2217300 cttcttcttcttcttcttcttcttcctc 2217327



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||| ||||||||||||||
Sbjct: 54330 cttcttcctcttcctcctcctcttcctc 54303



to top

>dbj|AK196027.1| Mus musculus cDNA, clone:Y1G0120H08, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000043876, based on BLAT search
          Length = 163

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 92  tcttcttcttcttcctcctcttcctc 67



to top

>dbj|AB017059.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K13P22
          Length = 19971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 560  cttcttcttcttcttcctcctcttcc 585
            ||||||||||||||||||||||||||
Sbjct: 9932 cttcttcttcttcttcctcctcttcc 9957



to top

>gb|AC154591.2| Mus musculus BAC clone RP23-370M19 from 16, complete sequence
          Length = 196385

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 44587 tcttcttcttcttcctcctcttcctc 44612



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| ||||||||||||||
Sbjct: 44546 cttcttcttcttcctcctcctcttcctc 44573



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 563   cttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||||||
Sbjct: 44689 cttcttcttcttcttcctcttcctc 44713



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 561    ttcttcttcttcttcctcctcttc 584
              ||||||||| ||||||||||||||
Sbjct: 163425 ttcttcttcctcttcctcctcttc 163402



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| ||||| |||||||||||
Sbjct: 44713 cttcttcttcctcttcttcctcttcctc 44740



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||| |||||||||||||| ||||||||
Sbjct: 44707 cttcctcttcttcttcctcttcttcctc 44734



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 562   tcttcttcttcttcctcctc 581
             ||||||||||||||||||||
Sbjct: 44545 tcttcttcttcttcctcctc 44564



to top

>emb|BX664748.8| Zebrafish DNA sequence from clone DKEY-3N7 in linkage group 4, complete
              sequence
          Length = 206047

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 184947 tcttcttcttcttcctcctcttcctc 184972



to top

>gb|AC123718.9| Mus musculus chromosome 1, clone RP23-401A11, complete sequence
          Length = 225702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 173414 tcttcttcttcttcctcctcttcctc 173389



to top

>dbj|AP001024.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-832N8, complete
              sequence
          Length = 183444

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 171976 tcttcttcttcttcctcctcttcctc 172001



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              ||||||||||||||||||| |||||
Sbjct: 171959 cttcttcttcttcttcctcttcttc 171983



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 171956 cttcttcttcttcttcttcctcttc 171980



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| || |||||||||||||||||
Sbjct: 171983 cttcttcctcctcttcctcctcttcctc 172010



to top

>emb|AL160231.4|CNS01RGW Human chromosome 14 DNA sequence BAC R-355C3 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 194173

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 31404 tcttcttcttcttcctcctcttcctc 31429



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 561   ttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||| |||||
Sbjct: 31306 ttcttcttcttcttcctcctcctcctc 31332



to top

>emb|AL133163.3|CNS01DU4 Human chromosome 14 DNA sequence BAC R-561B11 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 183491

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 174299 tcttcttcttcttcctcctcttcctc 174324



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||| |||||
Sbjct: 174201 ttcttcttcttcttcctcctcctcctc 174227



to top

>emb|CT025759.14| Mouse DNA sequence from clone RP24-317H19 on chromosome 17, complete
              sequence
          Length = 171682

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 133227 tcttcttcttcttcctcctcttcctc 133202



to top

>gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, complete sequence
          Length = 206249

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 157734 tcttcttcttcttcctcctcttcctc 157709



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| ||||||||
Sbjct: 157514 cttcttcttcttcttcctcttcttcctc 157487



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 157517 cttcttcttcttcttcttcctcttc 157493



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 157523 cttcttcttcttcttcttcttcttcctc 157496



to top

>emb|CT009715.15| Mouse DNA sequence from clone RP23-85E24 on chromosome 17, complete
             sequence
          Length = 178948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||||||||||
Sbjct: 74943 tcttcttcttcttcctcctcttcctc 74918



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||| ||||||||
Sbjct: 130028 cttcttcttcttcttcctcttcttcctc 130055



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||| ||||||||
Sbjct: 130025 cttcttcttcttcttcttcctcttc 130049



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| |||||||||||||| |||||
Sbjct: 130037 cttcttcctcttcttcctcctcctcctc 130064



to top

>gb|AC139294.4| Mus musculus BAC clone RP24-239E14 from 14, complete sequence
          Length = 183363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 146322 tcttcttcttcttcctcctcttcctc 146297



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||| |||||
Sbjct: 90543 cttcttcttcttcttcctcctcctcctc 90516



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 44578 cttcttcttcttcttcttcctcttcctc 44551



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 146349 tcttcttcttcctcctcttcctc 146327



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||| ||||||||||||||||||||
Sbjct: 146196 tcttcctcttcttcctcctcttcctc 146171



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||| ||||||||||||||||||||
Sbjct: 146064 tcttcctcttcttcctcctcttcctc 146039



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||| ||||||||||||||
Sbjct: 146022 tcttcttcttcctcctcctcttcctc 145997



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 146400 tcttcttcctcctcttcctc 146381



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 146373 tcttcttcctcctcttcctc 146354



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||| |||||||||||||| |||||
Sbjct: 145919 cttcttcctcttcttcctcctcctcctc 145892



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||| || |||||||||||||||||||
Sbjct: 145188 cttctcctccttcttcctcctcttcctc 145161



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 90552 cttcttcttcttcttcttcttcttcctc 90525



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| ||||| |||||
Sbjct: 90546 cttcttcttcttcttcttcctcctcctc 90519



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||| || ||||||||||||||
Sbjct: 90537 cttcttcttcctcctcctcctcttcctc 90510



to top

>gb|AC147986.3| Mus musculus BAC clone RP24-404L1 from 5, complete sequence
          Length = 177652

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 126249 tcttcttcttcttcctcctcttcctc 126274



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 93173 cttcttcttcttcttcttcctcttcctc 93200



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 565    tcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||
Sbjct: 126089 tcttcttcttcctcctcttcctc 126111



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 93179 cttcttcttcttcctcttcctcttcctc 93206



to top

>gb|AC149608.4| Mus musculus BAC clone RP23-436E6 from 8, complete sequence
          Length = 196473

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||||||||
Sbjct: 127196 tcttcttcttcttcctcctcttcctc 127171



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 561   ttcttcttcttcttcctcctct 582
             ||||||||||||||||||||||
Sbjct: 21282 ttcttcttcttcttcctcctct 21303



to top

>dbj|AB209433.1| Homo sapiens mRNA for HLA-B associated transcript 8 BAT8 isoform a
            variant protein
          Length = 4009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1027 tcttcttcttcttcctcctcttcctc 1002



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            ||||||| ||||| ||||||||||||||
Sbjct: 1053 cttcttcctcttcctcctcctcttcctc 1026



to top

>dbj|AB077210.1| Mus musculus mRNA for G9a long, complete cds
          Length = 4026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 1091 tcttcttcttcttcctcctcttcctc 1066



to top

>dbj|AB077209.1| Mus musculus mRNA for G9a short, complete cds
          Length = 3757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           ||||||||||||||||||||||||||
Sbjct: 920 tcttcttcttcttcctcctcttcctc 895



to top

>gb|U51583.1|RNU51583 Rattus norvegicus zinc finger homeodomain enhancer-binding protein-1
            (Zfhep-1) mRNA, partial cds
          Length = 3403

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 562  tcttcttcttcttcctcctcttcctc 587
            ||||||||||||||||||||||||||
Sbjct: 3148 tcttcttcttcttcctcctcttcctc 3123



to top

>dbj|AB017133.1| Homo sapiens KIAA0591/KIF1Bbeta mRNA, complete cds
          Length = 8776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 559  acttcttcttcttcttcctcctcttc 584
            ||||||||||||||||||||||||||
Sbjct: 2294 acttcttcttcttcttcctcctcttc 2269



to top

>emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 278H24 of library Caltech CITB-BAC from chromosome
             11 of Mus musculus (mouse)
          Length = 150493

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 558   cacttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||| |||||
Sbjct: 93513 cacttcttcttcttcttcctcctcctcctc 93542



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| |||||||| |||||
Sbjct: 93518 cttcttcttcttcctcctcctcctcctc 93545



to top

>gb|BT020470.1| Arabidopsis thaliana At2g33510 gene, complete cds
          Length = 625

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 479 cttcttcttcttcttcctcctcttc 455



to top

>ref|NM_117871.3| Arabidopsis thaliana unknown protein AT4G17620 transcript variant
           AT4G17620.1 mRNA, complete cds
          Length = 1873

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 425 cttcttcttcttcttcctcctcttc 401



to top

>ref|NM_001036577.1| Arabidopsis thaliana unknown protein AT4G17620 transcript variant
           AT4G17620.2 mRNA, complete cds
          Length = 1873

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 425 cttcttcttcttcttcctcctcttc 401



to top

>ref|NM_128911.2| Arabidopsis thaliana unknown protein AT2G33510 mRNA, complete cds
          Length = 789

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 487 cttcttcttcttcttcctcctcttc 463



to top

>gb|AC168073.4| Mus musculus BAC clone RP23-60N8 from chromosome 7, complete sequence
          Length = 238764

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||||||||||||
Sbjct: 177464 cttcttcttcttcttcctcctcttc 177440



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 564    ttcttcttcttcctcctcttc 584
              |||||||||||||||||||||
Sbjct: 164284 ttcttcttcttcctcctcttc 164264



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 177473 cttcttcttcttcttcttcttcttcctc 177446



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| ||||| ||||||||
Sbjct: 177461 cttcttcttcttcctcctcttcttcctc 177434



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| ||| |||||||
Sbjct: 164195 cttcttcttcttcttcttccccttcctc 164168



to top

>ref|XM_642257.1| Dictyostelium discoideum hypothetical protein (DDB0189585), partial
           mRNA
          Length = 4299

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 970 cttcttcttcttcttcctcctcttc 946



to top

>gb|AC121821.3| Mus musculus chromosome 18 clone RP23-461O23, complete sequence
          Length = 175131

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||||||||||||
Sbjct: 29260 cttcttcttcttcttcctcctcttc 29284



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| ||||| ||||||||
Sbjct: 29263 cttcttcttcttcctcctcttcttcctc 29290



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 29251 cttcttcttcttcttcttcttcttcctc 29278



to top

>gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, complete sequence
          Length = 164932

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 562   tcttcttcttcttcctcctcttcct 586
             |||||||||||||||||||||||||
Sbjct: 95118 tcttcttcttcttcctcctcttcct 95094



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 565   tcttcttcttcctcctcttcct 586
             ||||||||||||||||||||||
Sbjct: 97726 tcttcttcttcctcctcttcct 97747



to top

>ref|XM_636763.1| Dictyostelium discoideum hypothetical protein (DDB0205024), partial
            mRNA
          Length = 9312

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||||||||||||||||||||||||
Sbjct: 2914 cttcttcttcttcttcctcctcttc 2890



to top

>ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (DDB0204625), partial
           mRNA
          Length = 2352

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 436 cttcttcttcttcttcctcctcttc 412



to top

>ref|XM_635128.1| Dictyostelium discoideum hypothetical protein (DDB0216408), partial
           mRNA
          Length = 4086

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 922 cttcttcttcttcttcctcctcttc 898



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 564 ttcttcttcttcctcctcttc 584
           |||||||||||||||||||||
Sbjct: 801 ttcttcttcttcctcctcttc 781



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           ||||||||||||| ||||| ||||||||
Sbjct: 919 cttcttcttcttcctcctcttcttcctc 892



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 561 ttcttcttcttcttcctcctcttc 584
           |||||||||||| |||||||||||
Sbjct: 492 ttcttcttcttcctcctcctcttc 469



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 560 cttcttcttcttcttcctcctcttcctc 587
           |||| ||||||||||| |||||||||||
Sbjct: 331 cttcatcttcttcttcgtcctcttcctc 304



to top

>ref|XM_635037.1| Dictyostelium discoideum hypothetical protein (DDB0204841), partial
           mRNA
          Length = 1854

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 350 cttcttcttcttcttcctcctcttc 374



to top

>ref|XM_629896.1| Dictyostelium discoideum hypothetical protein (DDB0184122), partial
           mRNA
          Length = 1503

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 196 cttcttcttcttcttcctcctcttc 172



to top

>gb|AC166346.5| Mus musculus BAC clone RP24-83P13 from chromosome 16, complete
            sequence
          Length = 199678

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 560  cttcttcttcttcttcctcctcttc 584
            |||||||||||||||||||||||||
Sbjct: 3775 cttcttcttcttcttcctcctcttc 3751



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 47684 tcttcttcctcctcttcctc 47665



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 560  cttcttcttcttcttcctcctcttcctc 587
            |||||||||||||||| || ||||||||
Sbjct: 3784 cttcttcttcttcttcttcttcttcctc 3757



to top

>gb|AC166832.2| Mus musculus BAC clone RP23-220N17 from chromosome 16, complete
             sequence
          Length = 172644

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||||||||||||
Sbjct: 34508 cttcttcttcttcttcctcctcttc 34484



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| |||||||||||
Sbjct: 16289 cttcttcttcttcttcttcctcttcctc 16316



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 78421 tcttcttcctcctcttcctc 78402



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 34517 cttcttcttcttcttcttcttcttcctc 34490



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| || |||||||||||
Sbjct: 16295 cttcttcttcttcctcttcctcttcctc 16322



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 16283 cttcttcttcttcttcttcttcttcctc 16310



to top

>gb|AC117643.15| Mus musculus chromosome 8, clone RP23-237I20, complete sequence
          Length = 186799

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||
Sbjct: 135128 cttcttcttcttcctcctcttcctc 135152



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 560    cttcttcttcttcttcctcc 579
              ||||||||||||||||||||
Sbjct: 134946 cttcttcttcttcttcctcc 134965



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 134937 cttcttcttcttcttcttcttcttcctc 134964



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 560    cttcttcttcttcttcctcc 579
              ||||||||||||||||||||
Sbjct: 134819 cttcttcttcttcttcctcc 134838



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 134810 cttcttcttcttcttcttcttcttcctc 134837



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 568   tcttcttcctcctcttcctc 587
             ||||||||||||||||||||
Sbjct: 67800 tcttcttcctcctcttcctc 67819



to top

>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete
              sequence
          Length = 249995

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||||||||||||
Sbjct: 154734 cttcttcttcttcttcctcctcttc 154710



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||| ||||||||||||||
Sbjct: 186240 tcttcttcttcctcctcctcttcctc 186265



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||| ||||||||||||||
Sbjct: 186216 tcttcttcttcctcctcctcttcctc 186241



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 562    tcttcttcttcttcctcctcttcctc 587
              ||||||||||| ||||||||||||||
Sbjct: 186171 tcttcttcttcctcctcctcttcctc 186196



to top

>gb|AC161219.4| Mus musculus chromosome 7, clone RP23-83E16, complete sequence
          Length = 211735

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 551   tgctccacacttcttcttcttcttcctcctcttcctc 587
             ||||||||  |||||||||||||||||||||| ||||
Sbjct: 25121 tgctccacttttcttcttcttcttcctcctctccctc 25157



to top

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 560    cttcttcttcttcttcctcctcttc 584
              |||||||||||||||||||||||||
Sbjct: 100653 cttcttcttcttcttcctcctcttc 100677



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 561    ttcttcttcttcttcctcctcttcctc 587
              ||||||||||||||||||||| |||||
Sbjct: 100487 ttcttcttcttcttcctcctcctcctc 100513



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 100644 cttcttcttcttcttcttcttcttcctc 100671



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||| || |||||||||||||||||||
Sbjct: 100520 cttctcctccttcttcctcctcttcctc 100547



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              ||||||||||||| |||||||| |||||
Sbjct: 100489 cttcttcttcttcctcctcctcctcctc 100516



to top

>gb|AY228561.1| Perdix perdix clone LEI30 microsatellite sequence
          Length = 212

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 560 cttcttcttcttcttcctcctcttc 584
           |||||||||||||||||||||||||
Sbjct: 119 cttcttcttcttcttcctcctcttc 95



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 562 tcttcttcttcttcctcctcttcctc 587
           |||||||||||||||||||| |||||
Sbjct: 84  tcttcttcttcttcctcctcctcctc 59



to top

>gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, complete sequence
          Length = 222681

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 563   cttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||||||||
Sbjct: 22783 cttcttcttcttcctcctcttcctc 22807



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||||||||| ||||||||
Sbjct: 50655 cttcttcttcttcttcctcttcttcctc 50682



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||| ||||||||
Sbjct: 50652 cttcttcttcttcttcttcctcttc 50676



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| |||||||||||||| |||||
Sbjct: 50664 cttcttcctcttcttcctcctcctcctc 50691



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 50646 cttcttcttcttcttcttcttcttcctc 50673



to top

>gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, complete sequence
          Length = 206840

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 561   ttcttcttcttcttcctcctcttcc 585
             |||||||||||||||||||||||||
Sbjct: 96548 ttcttcttcttcttcctcctcttcc 96524



to top

>gb|AC163489.5| Mus musculus chromosome 8, clone RP24-354I15, complete sequence
          Length = 157478

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||
Sbjct: 141326 cttcttcttcttcctcctcttcctc 141302



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 141644 cttcttcttcttcttcttcttcttcctc 141617



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 560    cttcttcttcttcttcctcc 579
              ||||||||||||||||||||
Sbjct: 141635 cttcttcttcttcttcctcc 141616



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 560    cttcttcttcttcttcctcctcttcctc 587
              |||||||||||||||| || ||||||||
Sbjct: 141517 cttcttcttcttcttcttcttcttcctc 141490



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 560    cttcttcttcttcttcctcc 579
              ||||||||||||||||||||
Sbjct: 141508 cttcttcttcttcttcctcc 141489



to top

>gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, complete sequence
          Length = 190734

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 560   cttcttcttcttcttcctcctcttc 584
             |||||||||||||||||||||||||
Sbjct: 71900 cttcttcttcttcttcctcctcttc 71876



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 562   tcttcttcttcttcctcctcttc 584
             |||||||||||||||||||||||
Sbjct: 71880 tcttcttcttcttcctcctcttc 71858



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 568    tcttcttcctcctcttcctc 587
              ||||||||||||||||||||
Sbjct: 164044 tcttcttcctcctcttcctc 164063



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             |||||||||||||||| || ||||||||
Sbjct: 71909 cttcttcttcttcttcttcttcttcctc 71882



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||||||||| ||||| ||||||||
Sbjct: 71879 cttcttcttcttcctcctcttcttcctc 71852



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 71861 cttcttcctcttcttcctcttcttcctc 71834



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 71852 cttcttcctcttcttcctcttcttcctc 71825



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 71843 cttcttcctcttcttcctcttcttcctc 71816



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 71834 cttcttcctcttcttcctcttcttcctc 71807



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 560   cttcttcttcttcttcctcctcttcctc 587
             ||||||| ||||||||||| ||||||||
Sbjct: 71825 cttcttcctcttcttcctcttcttcctc 71798



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156078

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 563    cttcttcttcttcctcctcttcctc 587
              |||||||||||||||||||||||||
Sbjct: 103057 cttcttcttcttcctcctcttcctc 103081



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 562   tcttcttcttcttcctcctcttcctc 587
             |||||||||||||||||||| |||||
Sbjct: 99772 tcttcttcttcttcctcctcctcctc 99797



to top

>ref|XM_957490.1| Neurospora crassa OR74A hypothetical protein (NCU06321.1) partial
            mRNA
          Length = 3336

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 560  cttcttcttcttcttcctcctcttcctcg 588
            ||||||||||||| |||||||||||||||
Sbjct: 2551 cttcttcttcttcctcctcctcttcctcg 2523



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 562  tcttcttcttcttcctcctc 581
            ||||||||||||||||||||
Sbjct: 2552 tcttcttcttcttcctcctc 2533



to top

>ref|XM_326175.1| Neurospora crassa OR74A hypothetical protein (NCU06321.1) partial
            mRNA
          Length = 3336

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 560  cttcttcttcttcttcctcctcttcctcg 588
            ||||||||||||| |||||||||||||||
Sbjct: 2551 cttcttcttcttcctcctcctcttcctcg 2523



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 562  tcttcttcttcttcctcctc 581
            ||||||||||||||||||||
Sbjct: 2552 tcttcttcttcttcctcctc 2533


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,142,539
Number of Sequences: 3902068
Number of extensions: 8142539
Number of successful extensions: 965684
Number of sequences better than 10.0: 11598
Number of HSP's better than 10.0 without gapping: 11655
Number of HSP's successfully gapped in prelim test: 53
Number of HSP's that attempted gapping in prelim test: 588238
Number of HSP's gapped (non-prelim): 335141
length of query: 628
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 605
effective length of database: 17,143,297,704
effective search space: 10371695110920
effective search space used: 10371695110920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top