| Clone Name | rbasd22d02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY245455.1| Hordeum vulgare subsp. vulgare thioredoxin h isoform 2 mRNA, complete cds Length = 369 Score = 729 bits (368), Expect = 0.0 Identities = 368/368 (100%) Strand = Plus / Minus Query: 170 ttactgggccgccgcgtgaagcccaaccttggcggtcagttcctccttgatagctccgac 229 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 369 ttactgggccgccgcgtgaagcccaaccttggcggtcagttcctccttgatagctccgac 310 Query: 230 aaccctgtccttgacgtctccttccttcatgaacaggaacgttggcatggcctcgacact 289 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 309 aaccctgtccttgacgtctccttccttcatgaacaggaacgttggcatggcctcgacact 250 Query: 290 gaattgctcagcaatgggcttcagttcatccacgtcgaccttgaggaaaacagcatttgg 349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 249 gaattgctcagcaatgggcttcagttcatccacgtcgaccttgaggaaaacagcatttgg 190 Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 189 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 130 Query: 410 tgcagtgaagtcaatcaccaccagcttcttggcggtgttggcctcctcgatctgcatggt 469 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 tgcagtgaagtcaatcaccaccagcttcttggcggtgttggcctcctcgatctgcatggt 70 Query: 470 ccactgctccaggctgtggaccgagatcacctccgccgccactgccgccgccgttgccga 529 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 69 ccactgctccaggctgtggaccgagatcacctccgccgccactgccgccgccgttgccga 10 Query: 530 cgccgcca 537 |||||||| Sbjct: 9 cgccgcca 2
>gb|AF420472.2| Triticum aestivum thioredoxin H mRNA, complete cds Length = 547 Score = 597 bits (301), Expect = e-167 Identities = 378/403 (93%), Gaps = 3/403 (0%) Strand = Plus / Minus Query: 129 agcggcaattttatttaggcgaatactacaccaataggtaattactgggccgccgcgtga 188 ||||||||||||||||||||||||||||| || ||||| |||||| ||| |||||||| Sbjct: 457 agcggcaattttatttaggcgaatactactccgctaggtgattactaggcagccgcgtgg 398 Query: 189 agcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtccttgacgtct 248 ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 397 agcccaaccttggtcgtcagctcctccttgatagctccgacaaccctgtccttgacgtct 338 Query: 249 ccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagcaatgggc 308 |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| Sbjct: 337 ccttccttcatgaacaggaaggttggcatggcctcgacgctgaattgctcagcaatgggc 278 Query: 309 ttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatca 368 ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 277 ttcagttcatcaacgtcgaccttgaggaaaacagcagctgggaacttcttggcgagatca 218 Query: 369 gcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcacc 428 || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 217 gcaaaaattggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcacc 158 Query: 429 accagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctgtgg 488 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 157 accagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccaggctgtgg 98 Query: 489 accgagatcacctccgccg---ccactgccgccgccgttgccg 528 || |||||||||||| ||| |||| ||||||||||| |||| Sbjct: 97 acggagatcacctcccccggccccaccgccgccgccgtcgccg 55 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 90 acaagtagcaagcagtacacagcat 114 ||||| ||||||||||||||||||| Sbjct: 512 acaagaagcaagcagtacacagcat 488
>emb|AJ001903.1|TDAJ1903 Triticum durum mRNA for thioredoxin H Length = 630 Score = 597 bits (301), Expect = e-167 Identities = 378/403 (93%), Gaps = 3/403 (0%) Strand = Plus / Minus Query: 129 agcggcaattttatttaggcgaatactacaccaataggtaattactgggccgccgcgtga 188 ||||||||||||||||||||||||||||| || ||||| |||||| ||| |||||||| Sbjct: 487 agcggcaattttatttaggcgaatactactccgctaggtgattactaggcagccgcgtgg 428 Query: 189 agcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtccttgacgtct 248 ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 427 agcccaaccttggtcgtcagctcctccttgatagctccgacaaccctgtccttgacgtct 368 Query: 249 ccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagcaatgggc 308 |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| Sbjct: 367 ccttccttcatgaacaggaaggttggcatggcctcgacgctgaattgctcagcaatgggc 308 Query: 309 ttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatca 368 ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 307 ttcagttcatcaacgtcgaccttgaggaaaacagcagctgggaacttcttggcgagatca 248 Query: 369 gcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcacc 428 || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 247 gcaaaaattggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcacc 188 Query: 429 accagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctgtgg 488 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 187 accagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccaggctgtgg 128 Query: 489 accgagatcacctccgccg---ccactgccgccgccgttgccg 528 || |||||||||||| ||| |||| ||||||||||| |||| Sbjct: 127 acggagatcacctcccccggccccaccgccgccgccgtcgccg 85 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 90 acaagtagcaagcagtacacagcat 114 ||||| ||||||||||||||||||| Sbjct: 542 acaagaagcaagcagtacacagcat 518
>emb|AJ009762.1|TAE9762 Triticum aestivum mRNA for thioredoxin H Length = 596 Score = 587 bits (296), Expect = e-164 Identities = 388/418 (92%), Gaps = 3/418 (0%) Strand = Plus / Minus Query: 122 cttcttgagcggcaattttatttaggcgaatactacaccaataggtaattactgggccgc 181 |||||||||| |||||||||||||||||||||||| || ||||| ||||||||||||| Sbjct: 483 cttcttgagccacaattttatttaggcgaatactactccgctaggtgattactgggccgc 424 Query: 182 cgcgtgaagcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtcctt 241 |||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||| Sbjct: 423 cgcgtgtagcccaaccttgttcgtcagttcctccttgatagctcccacaaccctgtcctt 364 Query: 242 gacgtctccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagc 301 ||| ||||||||||| ||||||||||| |||||||||||||| || ||||||||||| || Sbjct: 363 gacatctccttccttaatgaacaggaaggttggcatggcctcaacgctgaattgctccgc 304 Query: 302 aatgggcttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggc 361 |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| Sbjct: 303 aatgggcttcagttcatcgacatcgaccttgaggaaaacagcatttgggaacttcttggc 244 Query: 362 gagatcagcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtc 421 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 243 gagatcagcgaaaactggagccatgatgcggcatggtccacaccatgatgcagtgaagtc 184 Query: 422 aatcaccaccagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccag 481 || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 183 aaccaccaccagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccag 124 Query: 482 gctgtggaccgagatcacct---ccgccgccactgccgccgccgttgccgacgccgcc 536 | ||||||| |||||||||| ||||| |||| |||||||||||||||| ||||||| Sbjct: 123 ggtgtggacggagatcacctcccccgcccccaccgccgccgccgttgccgtcgccgcc 66 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 88 caacaagtagcaagcagtacacag 111 ||||||||| |||||||||||||| Sbjct: 533 caacaagtaacaagcagtacacag 510
>emb|X69915.1|TATHIORDH T.aestivum mRNA for thioredoxine H Length = 670 Score = 585 bits (295), Expect = e-164 Identities = 372/397 (93%), Gaps = 3/397 (0%) Strand = Plus / Minus Query: 126 ttgagcggcaattttatttaggcgaatactacaccaataggtaattactgggccgccgcg 185 ||||||||||||||||||||||||||| |||| || ||||| ||||||||||||| | Sbjct: 502 ttgagcggcaattttatttaggcgaatgctactccggtaggtgattactgggccgc---g 446 Query: 186 tgaagcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtccttgacg 245 || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 445 tgtagcccaaccttggtcgtcagttcctccttgatagctccgacaaccctgtccttgaca 386 Query: 246 tctccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagcaatg 305 ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| Sbjct: 385 tctccttccttcatgaacaggaaggttggcatggcctccacgctgaattgctcagcaatg 326 Query: 306 ggcttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgaga 365 |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 325 ggcttcagttcatcaacgtcgaccttgaggaaaacagcagctgggaacttcttggcgaga 266 Query: 366 tcagcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatc 425 |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 265 tcagcgaaaattggagccataatgcggcatggtccgcaccatgatgcagtgaagtcaatc 206 Query: 426 accaccagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctg 485 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 205 accaccagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccaggctg 146 Query: 486 tggaccgagatcacctccgccgccactgccgccgccg 522 ||||| |||||||||||| ||||| || ||||||||| Sbjct: 145 tggacggagatcacctcccccgcccctaccgccgccg 109 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 566 gcttatttctcacgcgcactttg 588 ||||||||||||||||||||||| Sbjct: 34 gcttatttctcacgcgcactttg 12 Score = 40.1 bits (20), Expect = 8.5 Identities = 34/38 (89%), Gaps = 3/38 (7%) Strand = Plus / Minus Query: 74 tatccataaaccaacaacaagtagcaagcagtacacag 111 ||||||||||| ||||||||| |||||||||||||| Sbjct: 567 tatccataaac---caacaagtaacaagcagtacacag 533
>gb|AF286593.2| Triticum aestivum cultivar Soissons thioredoxin H mRNA, complete cds Length = 531 Score = 551 bits (278), Expect = e-154 Identities = 381/414 (92%), Gaps = 6/414 (1%) Strand = Plus / Minus Query: 126 ttgagcggcaattttatttaggcgaatactacaccaataggtaattactgggccgccgcg 185 ||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| | Sbjct: 434 ttgagcggcaattttatttaggccaatactacaccgctaggtgattactgggccgc---g 378 Query: 186 tgaagcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtccttgacg 245 || |||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 377 tgtagcccaaccttgttcgtcagttcctccttgatagctccgacaaccctgtccttgacg 318 Query: 246 tctccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagcaatg 305 ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| Sbjct: 317 tctccttccttcatgaacaggaaggttggcatggcctccacgctgaattgctcagcaatg 258 Query: 306 ggcttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgaga 365 | |||||||||||| || ||||||||||||||||||||| ||||||||||||||||||| Sbjct: 257 gacttcagttcatcaacatcgaccttgaggaaaacagcagctgggaacttcttggcgaga 198 Query: 366 tcagcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatc 425 |||||||||| ||||||||| |||||||| ||||| ||||| ||||||||||||||||| Sbjct: 197 tcagcgaaaattggagccataatgcggcagggtccacaccacgatgcagtgaagtcaatg 138 Query: 426 accaccagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctg 485 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 137 accaccagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccaggctg 78 Query: 486 tggaccgagatcacct---ccgccgccactgccgccgccgttgccgacgccgcc 536 ||||| |||||||||| ||||| |||| |||||||||||||||| ||||||| Sbjct: 77 tggacggagatcacctcccccgcccccaccgccgccgccgttgccgtcgccgcc 24 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 47 cacactagcttggatcaagcatcgcagtatccataaaccaacaa 90 ||||||||||||||| ||||| |||| ||||||||||||||||| Sbjct: 526 cacactagcttggattaagcaacgcattatccataaaccaacaa 483
>emb|AJ404845.1|TAE404845 Triticum aestivum mRNA for thioredoxin h Length = 629 Score = 551 bits (278), Expect = e-154 Identities = 381/414 (92%), Gaps = 6/414 (1%) Strand = Plus / Minus Query: 126 ttgagcggcaattttatttaggcgaatactacaccaataggtaattactgggccgccgcg 185 ||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| | Sbjct: 533 ttgagcggcaattttatttaggccaatactacaccgctaggtgattactgggccgc---g 477 Query: 186 tgaagcccaaccttggcggtcagttcctccttgatagctccgacaaccctgtccttgacg 245 || |||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 476 tgtagcccaaccttgttcgtcagttcctccttgatagctccgacaaccctgtccttgacg 417 Query: 246 tctccttccttcatgaacaggaacgttggcatggcctcgacactgaattgctcagcaatg 305 ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| Sbjct: 416 tctccttccttcatgaacaggaaggttggcatggcctccacgctgaattgctcagcaatg 357 Query: 306 ggcttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgaga 365 | |||||||||||| || ||||||||||||||||||||| ||||||||||||||||||| Sbjct: 356 gacttcagttcatcaacatcgaccttgaggaaaacagcagctgggaacttcttggcgaga 297 Query: 366 tcagcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatc 425 |||||||||| ||||||||| |||||||| ||||| ||||| ||||||||||||||||| Sbjct: 296 tcagcgaaaattggagccataatgcggcagggtccacaccacgatgcagtgaagtcaatg 237 Query: 426 accaccagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctg 485 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 236 accaccagcttcttggcggcgttggcctcctcgatctgcatggtccactgctccaggctg 177 Query: 486 tggaccgagatcacct---ccgccgccactgccgccgccgttgccgacgccgcc 536 ||||| |||||||||| ||||| |||| |||||||||||||||| ||||||| Sbjct: 176 tggacggagatcacctcccccgcccccaccgccgccgccgttgccgtcgccgcc 123 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 47 cacactagcttggatcaagcatcgcagtatccataaaccaacaa 90 ||||||||||||||| ||||| |||| ||||||||||||||||| Sbjct: 625 cacactagcttggattaagcaacgcattatccataaaccaacaa 582 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 566 gcttatttctcacgcgcactttgttg 591 |||||||||||||||||||||||||| Sbjct: 61 gcttatttctcacgcgcactttgttg 36
>ref|XM_475666.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 366 Score = 331 bits (167), Expect = 2e-87 Identities = 263/295 (89%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 333 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 274 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggcttcagttcatccacgtc 325 ||| |||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| Sbjct: 273 gaatgttggcatagcctcaacactgaattgctcagcaataggcttcagttcatcgacgtc 214 Query: 326 gaccttgaggaaaacagcatttgggaacttcttggcgagatcagcgaaaactggagccat 385 ||||| || ||||||||||||| | |||||| || ||||| || ||||||||||| || Sbjct: 213 aaccttcagaaaaacagcatttgtgtgcttctttgctagatcggcaaaaactggagcaat 154 Query: 386 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagcttcttggcggt 445 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct: 153 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcacaaccagcttcttggcgct 94 Query: 446 gttggcctcctcgatctgcatggtccactgctccaggctgtggaccgagatcacc 500 |||||||||||||||||| |||||||||| || |||||||||| || ||||||| Sbjct: 93 gttggcctcctcgatctggatggtccactcgtcgaggctgtggatcgcgatcacc 39
>dbj|AK106758.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-D09, full insert sequence Length = 3740 Score = 331 bits (167), Expect = 2e-87 Identities = 263/295 (89%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 478 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 419 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggcttcagttcatccacgtc 325 ||| |||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| Sbjct: 418 gaatgttggcatagcctcaacactgaattgctcagcaataggcttcagttcatcgacgtc 359 Query: 326 gaccttgaggaaaacagcatttgggaacttcttggcgagatcagcgaaaactggagccat 385 ||||| || ||||||||||||| | |||||| || ||||| || ||||||||||| || Sbjct: 358 aaccttcagaaaaacagcatttgtgtgcttctttgctagatcggcaaaaactggagcaat 299 Query: 386 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagcttcttggcggt 445 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct: 298 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcacaaccagcttcttggcgct 239 Query: 446 gttggcctcctcgatctgcatggtccactgctccaggctgtggaccgagatcacc 500 |||||||||||||||||| |||||||||| || |||||||||| || ||||||| Sbjct: 238 gttggcctcctcgatctggatggtccactcgtcgaggctgtggatcgcgatcacc 184
>dbj|AK059385.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G10, full insert sequence Length = 682 Score = 331 bits (167), Expect = 2e-87 Identities = 263/295 (89%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 447 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 388 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggcttcagttcatccacgtc 325 ||| |||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| Sbjct: 387 gaatgttggcatagcctcaacactgaattgctcagcaataggcttcagttcatcgacgtc 328 Query: 326 gaccttgaggaaaacagcatttgggaacttcttggcgagatcagcgaaaactggagccat 385 ||||| || ||||||||||||| | |||||| || ||||| || ||||||||||| || Sbjct: 327 aaccttcagaaaaacagcatttgtgtgcttctttgctagatcggcaaaaactggagcaat 268 Query: 386 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagcttcttggcggt 445 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct: 267 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcacaaccagcttcttggcgct 208 Query: 446 gttggcctcctcgatctgcatggtccactgctccaggctgtggaccgagatcacc 500 |||||||||||||||||| |||||||||| || |||||||||| || ||||||| Sbjct: 207 gttggcctcctcgatctggatggtccactcgtcgaggctgtggatcgcgatcacc 153
>dbj|AB053294.1| Oryza sativa (japonica cultivar-group) RTRXH2 mRNA for thioredoxin h, complete cds Length = 740 Score = 331 bits (167), Expect = 2e-87 Identities = 263/295 (89%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 448 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 389 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggcttcagttcatccacgtc 325 ||| |||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| Sbjct: 388 gaatgttggcatagcctcaacactgaattgctcagcaataggcttcagttcatcgacgtc 329 Query: 326 gaccttgaggaaaacagcatttgggaacttcttggcgagatcagcgaaaactggagccat 385 ||||| || ||||||||||||| | |||||| || ||||| || ||||||||||| || Sbjct: 328 aaccttcagaaaaacagcatttgtgtgcttctttgctagatcggcaaaaactggagcaat 269 Query: 386 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagcttcttggcggt 445 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct: 268 gatgcggcatggtccgcaccatgatgcagtgaagtcaatcacaaccagcttcttggcgct 209 Query: 446 gttggcctcctcgatctgcatggtccactgctccaggctgtggaccgagatcacc 500 |||||||||||||||||| |||||||||| || |||||||||| || ||||||| Sbjct: 208 gttggcctcctcgatctggatggtccactcgtcgaggctgtggatcgcgatcacc 154
>gb|BT009180.1| Triticum aestivum clone wl1n.pk0120.d6:fis, full insert mRNA sequence Length = 720 Score = 281 bits (142), Expect = 1e-72 Identities = 238/270 (88%) Strand = Plus / Minus Query: 231 accctgtccttgacgtctccttccttcatgaacaggaacgttggcatggcctcgacactg 290 ||||||||||||||||| || ||| ||||||||||||| |||||||||||||| || ||| Sbjct: 488 accctgtccttgacgtcgccctccctcatgaacaggaatgttggcatggcctctacgctg 429 Query: 291 aattgctcagcaatgggcttcagttcatccacgtcgaccttgaggaaaacagcatttggg 350 |||||||||||||||| ||||| ||||||||| || || || ||||||||| |||||||| Sbjct: 428 aattgctcagcaatggtcttcatttcatccacatcaactttcaggaaaacaacatttggg 369 Query: 351 aacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatgat 410 |||||||||| | |||||| |||| |||||||||| |||||| || ||||||| | Sbjct: 368 gacttcttggccatatcagcaaaaattggagccatggcgcggcacggaggacaccatgtt 309 Query: 411 gcagtgaagtcaatcaccaccagcttcttggcggtgttggcctcctcgatctgcatggtc 470 ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || Sbjct: 308 gcagtgaagtcaatcaccaccagcttcttggcgctgttggcctcctcgatctggatgctc 249 Query: 471 cactgctccaggctgtggaccgagatcacc 500 |||| |||||||||||||| || ||||||| Sbjct: 248 cactcctccaggctgtggatcgcgatcacc 219 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 139 ttatttaggcgaatactaca 158 |||||||||||||||||||| Sbjct: 582 ttatttaggcgaatactaca 563
>emb|AJ890020.1| Zea mays mRNA for thioredoxin h1 protein (trxh1 gene), cultivar A69Y, from endosperm tissue Length = 573 Score = 274 bits (138), Expect = 3e-70 Identities = 237/270 (87%) Strand = Plus / Minus Query: 231 accctgtccttgacgtctccttccttcatgaacaggaacgttggcatggcctcgacactg 290 ||||||||||||||||| || ||| ||||||||||||| |||||||||||||| || ||| Sbjct: 329 accctgtccttgacgtcgccctccctcatgaacaggaatgttggcatggcctctacgctg 270 Query: 291 aattgctcagcaatgggcttcagttcatccacgtcgaccttgaggaaaacagcatttggg 350 |||||||||||||||| ||||| |||||| || || || || ||||||||| |||||||| Sbjct: 269 aattgctcagcaatggtcttcatttcatcgacatcaactttcaggaaaacaacatttggg 210 Query: 351 aacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatgat 410 |||||||||| | |||||| |||| |||||||||| |||||| || ||||||| | Sbjct: 209 gacttcttggccatatcagcaaaaattggagccatggcgcggcacggaggacaccatgtt 150 Query: 411 gcagtgaagtcaatcaccaccagcttcttggcggtgttggcctcctcgatctgcatggtc 470 ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || Sbjct: 149 gcagtgaagtcaatcaccaccagcttcttggcgctgttggcctcctcgatctggatgctc 90 Query: 471 cactgctccaggctgtggaccgagatcacc 500 |||| |||||||||||||| || ||||||| Sbjct: 89 cactcctccaggctgtggatcgcgatcacc 60
>gb|AC130601.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0108E17, complete sequence Length = 139829 Score = 143 bits (72), Expect = 8e-31 Identities = 108/120 (90%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||||||||| ||||| ||||| || ||||||||||||| | |||||| || ||||| Sbjct: 34359 cttcagttcatcgacgtcaaccttcagaaaaacagcatttgtgtgcttctttgctagatc 34300 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcac 427 || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 34299 ggcaaaaactggagcaatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcac 34240 Score = 111 bits (56), Expect = 3e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 34571 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 34512 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggct 309 ||| |||||||| ||||| |||||||||||||||||||| |||| Sbjct: 34511 gaatgttggcatagcctcaacactgaattgctcagcaataggct 34468 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 429 accagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctgtgg 488 ||||||||||||||| ||||||||||||||||||| |||||||||| || ||||||||| Sbjct: 33130 accagcttcttggcgctgttggcctcctcgatctggatggtccactcgtcgaggctgtgg 33071 Query: 489 accgagatcacc 500 | || ||||||| Sbjct: 33070 atcgcgatcacc 33059
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 143 bits (72), Expect = 8e-31 Identities = 108/120 (90%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||||||||| ||||| ||||| || ||||||||||||| | |||||| || ||||| Sbjct: 24965506 cttcagttcatcgacgtcaaccttcagaaaaacagcatttgtgtgcttctttgctagatc 24965447 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcac 427 || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 24965446 ggcaaaaactggagcaatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcac 24965387 Score = 111 bits (56), Expect = 3e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 206 cagttcctccttgatagctccgacaaccctgtccttgacgtctccttccttcatgaacag 265 |||||| ||||| ||||| |||||||||||||| || || ||||| |||||||| ||||| Sbjct: 24965718 cagttcatccttcatagcaccgacaaccctgtctttaacatctccctccttcataaacag 24965659 Query: 266 gaacgttggcatggcctcgacactgaattgctcagcaatgggct 309 ||| |||||||| ||||| |||||||||||||||||||| |||| Sbjct: 24965658 gaatgttggcatagcctcaacactgaattgctcagcaataggct 24965615 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 429 accagcttcttggcggtgttggcctcctcgatctgcatggtccactgctccaggctgtgg 488 ||||||||||||||| ||||||||||||||||||| |||||||||| || ||||||||| Sbjct: 24964277 accagcttcttggcgctgttggcctcctcgatctggatggtccactcgtcgaggctgtgg 24964218 Query: 489 accgagatcacc 500 | || ||||||| Sbjct: 24964217 atcgcgatcacc 24964206 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 505 ccgccactgccgccgccgttgccg 528 ||||||| |||||||||||||||| Sbjct: 5953507 ccgccaccgccgccgccgttgccg 5953484
>emb|AJ844021.1| Plantago major mRNA for thioredoxin 1 (trx1 gene) Length = 600 Score = 93.7 bits (47), Expect = 7e-16 Identities = 113/135 (83%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||||||||| || ||||||||||| || | | ||| ||| |||||| ||||| || Sbjct: 288 cttcagttcatcaacatcgaccttgagaaacataacatgtggtgtcttcttcgcgagctc 229 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcac 427 ||| || | ||| || |||| |||||||||||| ||||| || |||||||||||||| || Sbjct: 228 agccaagattggggcgatgaagcggcatggtccacaccacgaagcagtgaagtcaataac 169 Query: 428 caccagcttcttggc 442 ||||||||||||||| Sbjct: 168 caccagcttcttggc 154
>gb|U59380.1|BNU59380 Brassica napus thioredoxin-h-like-2 (THL-2) mRNA, partial cds Length = 580 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| ||||| |||||||||||||| || |||||||||||| ||||||||| Sbjct: 184 gaacttcttggccagatctgcgaaaactggagcaatcatgcggcatggtgggcaccatga 125 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| || ||||| | |||||| |||| Sbjct: 124 agcagtgaaatctatcacaatcagcttgttgg 93
>ref|XM_476912.1| Oryza sativa (japonica cultivar-group), mRNA Length = 600 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 306 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 247 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 246 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 190
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Plus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 4606976 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 4607035 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 4607036 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 4607092
>dbj|AP003753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1339_B08 Length = 119212 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Plus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 72316 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 72375 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 72376 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 72432
>dbj|AK121423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133N23, full insert sequence Length = 733 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 307 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 248 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 247 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 191
>dbj|AK059196.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-A03, full insert sequence Length = 600 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 306 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 247 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 246 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 190
>dbj|AP004384.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0506C07 Length = 123451 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Plus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 14349 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 14408 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 14409 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 14465
>dbj|D21836.1|RICTH Oryza sativa (japonica cultivar-group) mRNA for thioredoxin h, complete cds Length = 687 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 269 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 210 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 209 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 153
>gb|U92541.1|OSU92541 Oryza sativa thioredoxin h mRNA, complete cds Length = 601 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 298 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 239 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 238 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 182
>dbj|D26547.1|RICRTH Oryza sativa gene for thioredoxin h, complete cds Length = 2906 Score = 58.0 bits (29), Expect = 4e-05 Identities = 95/117 (81%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 |||||| ||||| || || ||||| ||||| |||||| |||||||| |||||| || Sbjct: 2333 cttcagctcatcaacatcaaccttcaggaagacagcaccagggaactttttggcgtattc 2274 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaat 424 |||||| ||||| || |||| |||||| || || ||||| || |||||||||||||| Sbjct: 2273 agcgaacactggggcgatgaagcggcaagggccacaccaggaagcagtgaagtcaat 2217
>ref|NM_101829.2| Arabidopsis thaliana ATTRX4; thiol-disulfide exchange intermediate AT1G19730 (ATTRX4) mRNA, complete cds Length = 652 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 222 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 163 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||| | |||||| |||| Sbjct: 162 agcagtgaaatcaatcacaatcagcttgttgg 131
>gb|BT017986.1| Zea mays clone EL01N0525F08.c mRNA sequence Length = 687 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 389 gcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||| |||||||| | |||||||||||||| ||||||||||| Sbjct: 187 gcggcatggaccgcaccaggcggcagtgaagtcaatgaccaccagctt 140
>emb|Z35473.1|ATTHIRED1 A.thaliana (GREN) mRNA for thioredoxin Length = 642 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 211 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 152 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||| | |||||| |||| Sbjct: 151 agcagtgaaatcaatcacaatcagcttgttgg 120
>gb|BT004710.1| Arabidopsis thaliana At1g19730 gene, complete cds Length = 360 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 171 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 112 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||| | |||||| |||| Sbjct: 111 agcagtgaaatcaatcacaatcagcttgttgg 80
>gb|AY088698.1| Arabidopsis thaliana clone 9219 mRNA, complete sequence Length = 590 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 222 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 163 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||| | |||||| |||| Sbjct: 162 agcagtgaaatcaatcacaatcagcttgttgg 131
>dbj|AK118542.1| Arabidopsis thaliana At1g19730 mRNA for putative thioredoxin, complete cds, clone: RAFL19-77-A10 Length = 556 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 193 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 134 Query: 410 tgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||| | |||||| |||| Sbjct: 133 agcagtgaaatcaatcacaatcagcttgttgg 102
>gb|AY104876.1| Zea mays PCO064560 mRNA sequence Length = 756 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 389 gcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||| |||||||| | |||||||||||||| ||||||||||| Sbjct: 243 gcggcatggaccgcaccaggcggcagtgaagtcaatgaccaccagctt 196
>ref|NM_009513.1| Mus musculus vesicular membrane protein p24 (Vmp), mRNA Length = 2103 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||||||||||||||| ||||| |||||| Sbjct: 34 ccgccgccactgccgccgccgctgccgccgccgc 1
>gb|AC024609.2| Arabidopsis thaliana chromosome I BAC F14P1 genomic sequence, complete sequence Length = 90341 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 38998 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 38939 Query: 410 tgcagtgaagtcaatcac 427 |||||||| |||||||| Sbjct: 38938 agcagtgaaatcaatcac 38921
>emb|BX841902.1|CNS09Y73 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL20ZE03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 702 Score = 52.0 bits (26), Expect = 0.002 Identities = 59/70 (84%) Strand = Plus / Minus Query: 372 aaaactggagccatgatgcggcatggtccgcaccatgatgcagtgaagtcaatcaccacc 431 |||| |||||| || |||||||||||| |||||||| |||||||| |||||||| | | Sbjct: 183 aaaattggagcaatcatgcggcatggtggacaccatgaagcagtgaaatcaatcacaatc 124 Query: 432 agcttcttgg 441 ||||| |||| Sbjct: 123 agcttgttgg 114
>gb|AC007797.7|AC007797 Arabidopsis thaliana chromosome I BAC F6F9 genomic sequence, complete sequence Length = 119942 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 99264 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 99205 Query: 410 tgcagtgaagtcaatcac 427 |||||||| |||||||| Sbjct: 99204 agcagtgaaatcaatcac 99187
>gb|U35828.1|ATU35828 Arabidopsis thaliana thioredoxin h (TRX4) gene, partial cds Length = 829 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Minus Query: 350 gaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccatga 409 |||||||||||| | ||| ||||| |||||| || |||||||||||| |||||||| Sbjct: 569 gaacttcttggccaaatcgttgaaaattggagcaatcatgcggcatggtggacaccatga 510 Query: 410 tgcagtgaagtcaatcac 427 |||||||| |||||||| Sbjct: 509 agcagtgaaatcaatcac 492
>dbj|D83206.1|MUSP2000 Mouse mRNA for P24 protein, complete cds Length = 2103 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||||||||||||||| ||||| |||||| Sbjct: 34 ccgccgccactgccgccgccgctgccgccgccgc 1
>gb|AY245454.1| Hordeum vulgare subsp. vulgare thioredoxin h isoform 1 mRNA, complete cds Length = 357 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 348 gggaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccat 407 ||||||||||||||| ||||| || ||||| || |||| || ||||| |||||||| Sbjct: 173 gggaacttcttggcgtactcagcaaagactggggctatgacacgacatggaccgcaccag 114 Query: 408 gatgcagtgaagtcaatcaccaccagctt 436 || |||||||| ||||| | ||||||||| Sbjct: 113 gaagcagtgaaatcaatgatcaccagctt 85
>gb|AY072771.1| Triticum aestivum cultivar Soissons thioredoxin H mRNA, complete cds Length = 598 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 348 gggaacttcttggcgagatcagcgaaaactggagccatgatgcggcatggtccgcaccat 407 ||||||||||||||| ||||| || ||||| || |||| || || || |||||||| Sbjct: 173 gggaacttcttggcgtactcagcaaagactggggctatgacacgacaaggaccgcaccag 114 Query: 408 gatgcagtgaagtcaatcaccaccagctt 436 || |||||||||||||| | ||||||||| Sbjct: 113 gaagcagtgaagtcaatgatcaccagctt 85
>gb|AF076786.1|AF076786 Oryctolagus cuniculus serum amyloid A-activating factor SAF-8 mRNA, partial cds Length = 1235 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 ||||||||||||||||||| ||||| ||||||| Sbjct: 739 gccgccactgccgccgccgctgccgccgccgcc 707
>gb|AC146718.2| Oryza sativa chromosome 3 B1130H05 genomic sequence, complete sequence Length = 49565 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| ||||||||||| |||| |||||||| Sbjct: 16311 ccgccgccacggccgccgccgtagccgccgccgcca 16346
>gb|AY532770.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiA) gene, complete cds Length = 1101 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 |||||||||||||||||||||||| Sbjct: 235 cctccgccgccactgccgccgccg 212
>gb|AY532768.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiA) gene, complete cds Length = 1115 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 |||||||||||||||||||||||| Sbjct: 235 cctccgccgccactgccgccgccg 212
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| ||||||||||| |||| |||||||| Sbjct: 26169515 ccgccgccacggccgccgccgtagccgccgccgcca 26169480 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgccgttgccgacgccgcca 537 |||| |||||||| |||||||||||| |||| |||||||| Sbjct: 33769636 caccaccgccgccgctgccgccgccgccgccgccgccgcca 33769676 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 500 ctccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||| |||||||||||| |||| ||||||| Sbjct: 27696800 ctccgccgcctctgccgccgccgccgccgccgccgcc 27696764 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 24044564 ccgccgccactgccgccgccg 24044544 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 513 gccgccgccgttgccgacgccgcc 536 |||||||||||||||| ||||||| Sbjct: 31186588 gccgccgccgttgccgtcgccgcc 31186611 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgcc 518 |||||||||||||||||||| Sbjct: 23373908 cctccgccgccactgccgcc 23373889 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 503 cgccgccactgccgccgccgttgccgac 530 ||||||||||||||||| || ||||||| Sbjct: 19994949 cgccgccactgccgccgtcgctgccgac 19994922 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 511 ctgccgccgccgttgccgacgccg 534 |||||||||||||||||| ||||| Sbjct: 11317894 ctgccgccgccgttgccgtcgccg 11317917 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgc 520 ||||||||||||||| |||||||| Sbjct: 1134161 cacctccgccgccaccgccgccgc 1134138
>emb|AJ890021.1| Zea mays mRNA for thioredoxin h2 protein (trxh2 gene), cultivar A69Y, from endosperm tissue Length = 556 Score = 48.1 bits (24), Expect = 0.035 Identities = 42/48 (87%) Strand = Plus / Minus Query: 389 gcggcatggtccgcaccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||| |||||||| | ||||||||||| || ||||||||||| Sbjct: 132 gcggcatggaccgcaccaggcggcagtgaagtcgatgaccaccagctt 85
>emb|Z70677.1|RCTHIORXN R.communis mRNA for thioredoxin Length = 603 Score = 48.1 bits (24), Expect = 0.035 Identities = 87/108 (80%) Strand = Plus / Minus Query: 308 cttcagttcatccacgtcgaccttgaggaaaacagcatttgggaacttcttggcgagatc 367 ||||||||||||||| || ||||| ||||| | ||||||| | |||||||| || || Sbjct: 235 cttcagttcatccacatccaccttcaggaaggtaacatttggcagtttcttggccagctc 176 Query: 368 agcgaaaactggagccatgatgcggcatggtccgcaccatgatgcagt 415 ||| || | ||||| |||| ||||||||||| |||||||| ||||| Sbjct: 175 agccaagaagggagcaatgaaacggcatggtccacaccatgaagcagt 128
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||||||| |||||||||||| | |||||| Sbjct: 2683952 ccgccgccactgccaccgccgttgccgcccccgcca 2683987 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 513 gccgccgccgttgccgacgccgcc 536 ||||||||||||| |||||||||| Sbjct: 2345798 gccgccgccgttggcgacgccgcc 2345821
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| ||||||||||| |||| |||||||| Sbjct: 26260824 ccgccgccacggccgccgccgtagccgccgccgcca 26260789 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgccgttgccgacgccgcca 537 |||| |||||||| |||||||||||| |||| |||||||| Sbjct: 33860108 caccaccgccgccgctgccgccgccgccgccgccgccgcca 33860148 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 500 ctccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||| |||||||||||| |||| ||||||| Sbjct: 27788123 ctccgccgcctctgccgccgccgccgccgccgccgcc 27788087 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 23957753 ccgccgccactgccgccgccg 23957733 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 513 gccgccgccgttgccgacgccgcc 536 |||||||||||||||| ||||||| Sbjct: 31277111 gccgccgccgttgccgtcgccgcc 31277134 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgcc 518 |||||||||||||||||||| Sbjct: 23366936 cctccgccgccactgccgcc 23366917 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 503 cgccgccactgccgccgccgttgccgac 530 ||||||||||||||||| || ||||||| Sbjct: 19987977 cgccgccactgccgccgtcgctgccgac 19987950 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 511 ctgccgccgccgttgccgacgccg 534 |||||||||||||||||| ||||| Sbjct: 11314657 ctgccgccgccgttgccgtcgccg 11314680 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgc 520 ||||||||||||||| |||||||| Sbjct: 1134159 cacctccgccgccaccgccgccgc 1134136
>gb|AF195951.1|AF195951 Homo sapiens signal recognition particle 68 mRNA, complete cds Length = 1860 Score = 48.1 bits (24), Expect = 0.035 Identities = 36/40 (90%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccgttgccgacgccgcc 536 |||| ||||||||||||||||||||| |||| ||||||| Sbjct: 64 caccgccgccgccactgccgccgccgccgccgccgccgcc 25
>dbj|AK070016.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023037K17, full insert sequence Length = 854 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| ||||||||||| |||| |||||||| Sbjct: 518 ccgccgccacggccgccgccgtagccgccgccgcca 483
>gb|AF076785.1|AF076785 Oryctolagus cuniculus serum amyloid A-activating factor SAF-5 mRNA, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgc 535 ||||||||||||||||||| ||||| |||||| Sbjct: 905 gccgccactgccgccgccgctgccgccgccgc 874
>gb|AF076784.1|AF076784 Oryctolagus cuniculus serum amyloid A-activating factor SAF-1 mRNA, complete cds Length = 2535 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgc 535 ||||||||||||||||||| ||||| |||||| Sbjct: 1365 gccgccactgccgccgccgctgccgccgccgc 1334
>gb|AF010579.1|AF010579 Oryza sativa glycine-rich protein (OSGRP1) mRNA, complete cds Length = 713 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| ||||||||||| |||| |||||||| Sbjct: 427 ccgccgccacggccgccgccgtagccgccgccgcca 392
>ref|NM_121057.1| Arabidopsis thaliana carbohydrate transporter/ sugar porter/ transporter AT5G10190 mRNA, complete cds Length = 1762 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 943 catttgggaacttcttggcgaga 921
>ref|NM_021998.4| Homo sapiens zinc finger protein 6 (ZNF6), mRNA Length = 4182 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 180 ccgccgccgctgccgccgccgctgccgccgccgcc 146
>gb|AC124494.4| Mus musculus BAC clone RP23-464P12 from chromosome 13, complete sequence Length = 204177 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 495 atcacctccgccgccactgccgccgcc 521 ||||||||||||||| ||||||||||| Sbjct: 53991 atcacctccgccgccgctgccgccgcc 54017
>emb|CR702752.2|CNS0G570 Tetraodon nigroviridis full-length cDNA Length = 619 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR695907.2|CNS0FZWV Tetraodon nigroviridis full-length cDNA Length = 619 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR695119.2|CNS0FZAZ Tetraodon nigroviridis full-length cDNA Length = 619 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR694305.2|CNS0FYOD Tetraodon nigroviridis full-length cDNA Length = 619 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR690979.2|CNS0FW3Z Tetraodon nigroviridis full-length cDNA Length = 619 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR675457.2|CNS0FK5J Tetraodon nigroviridis full-length cDNA Length = 676 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 196 caccatgatgctgtgaagtccaccaccaccagctt 162
>emb|CR672989.2|CNS0FI8Z Tetraodon nigroviridis full-length cDNA Length = 607 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 140 caccatgatgctgtgaagtccaccaccaccagctt 106
>emb|CR672909.2|CNS0FI6R Tetraodon nigroviridis full-length cDNA Length = 664 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 184 caccatgatgctgtgaagtccaccaccaccagctt 150
>emb|CR671232.2|CNS0FGW6 Tetraodon nigroviridis full-length cDNA Length = 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>emb|CR668685.2|CNS0FEXF Tetraodon nigroviridis full-length cDNA Length = 638 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 159 caccatgatgctgtgaagtccaccaccaccagctt 125
>emb|CR667868.2|CNS0FEAQ Tetraodon nigroviridis full-length cDNA Length = 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>emb|CR667674.2|CNS0FE5C Tetraodon nigroviridis full-length cDNA Length = 649 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>emb|CR667509.2|CNS0FE0R Tetraodon nigroviridis full-length cDNA Length = 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>emb|CR666951.2|CNS0FDL9 Tetraodon nigroviridis full-length cDNA Length = 663 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 184 caccatgatgctgtgaagtccaccaccaccagctt 150
>emb|CR666893.2|CNS0FDJN Tetraodon nigroviridis full-length cDNA Length = 669 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 190 caccatgatgctgtgaagtccaccaccaccagctt 156
>emb|CR665884.2|CNS0FCRM Tetraodon nigroviridis full-length cDNA Length = 663 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 184 caccatgatgctgtgaagtccaccaccaccagctt 150
>emb|CR659374.2|CNS0F7QS Tetraodon nigroviridis full-length cDNA Length = 639 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>emb|CR658254.2|CNS0F6VO Tetraodon nigroviridis full-length cDNA Length = 646 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 167 caccatgatgctgtgaagtccaccaccaccagctt 133
>emb|CR647452.2|CNS0EYJM Tetraodon nigroviridis full-length cDNA Length = 650 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 402 caccatgatgcagtgaagtcaatcaccaccagctt 436 ||||||||||| |||||||| | |||||||||||| Sbjct: 170 caccatgatgctgtgaagtccaccaccaccagctt 136
>gb|BC006349.2| Homo sapiens zinc finger protein 6 (CMPX1), mRNA (cDNA clone IMAGE:4111424), partial cds Length = 1490 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 139 ccgccgccgctgccgccgccgctgccgccgccgcc 105
>emb|Z82216.1|HS75N13 Human DNA sequence from clone RP1-75N13 on chromosome Xq21.1, complete sequence Length = 141851 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 8338 ccgccgccgctgccgccgccgctgccgccgccgcc 8304
>emb|AL512665.11| Human DNA sequence from clone RP11-88H9 on chromosome 1 Contains the 5' end of the KCND3 gen for potassium voltage-gated channel Shal-related subfamily member 3, two novel genes and two CpG islands, complete sequence Length = 169599 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||||||||||||| ||||| ||||||| Sbjct: 22316 ccgccgccactgccgccgccactgccgccgccgcc 22350 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgcc 521 |||||||||||||||||||| Sbjct: 22304 ccgccgccactgccgccgcc 22323
>gb|AY113893.1| Arabidopsis thaliana unknown protein (At5g10190) mRNA, complete cds Length = 1498 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 871 catttgggaacttcttggcgaga 849
>gb|AF360162.1| Arabidopsis thaliana unknown protein (At5g10190) mRNA, complete cds Length = 1778 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 943 catttgggaacttcttggcgaga 921
>emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18D22 (ESSA project) Length = 57180 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 5247 catttgggaacttcttggcgaga 5225
>gb|AC003001.1| Homo sapiens chromosome X, clone HRPC928E24, complete sequence Length = 101981 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 69644 ccgccgccgctgccgccgccgctgccgccgccgcc 69610
>gb|AC113339.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar Nipponbare clone OSJNBb0047B19, from chromosome 10, complete sequence Length = 137015 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 506 cgccactgccgccgccgttgccgacgc 532 ||||||||||||||||||||| ||||| Sbjct: 122677 cgccactgccgccgccgttgcagacgc 122703
>dbj|AK138096.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130091L15 product:unclassifiable, full insert sequence Length = 4167 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 465 atggtccactgctccaggctgtg 487 ||||||||||||||||||||||| Sbjct: 2019 atggtccactgctccaggctgtg 1997
>ref|XM_943315.1| PREDICTED: Homo sapiens hypothetical protein LOC648416 (LOC648416), mRNA Length = 1538 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 266 ccgccgccgctgccgccgccgctgccgccgccgcc 232
>ref|XM_931182.1| PREDICTED: Homo sapiens hypothetical protein LOC642944 (LOC642944), mRNA Length = 1538 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 266 ccgccgccgctgccgccgccgctgccgccgccgcc 232
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 506 cgccactgccgccgccgttgccgacgc 532 ||||||||||||||||||||| ||||| Sbjct: 7679683 cgccactgccgccgccgttgcagacgc 7679709 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 2175931 cctccgccgccaccgccgccgccgt 2175955 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgc 526 ||||||||||| | |||||||||||||| Sbjct: 17410924 cctccgccgccgccgccgccgccgttgc 17410897 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccg 522 |||||||||||||||||||| Sbjct: 11982094 cgccgccactgccgccgccg 11982113
>emb|BX830941.1|CNS0A1MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS40ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1719 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 926 catttgggaacttcttggcgaga 904
>emb|BX832764.1|CNS09ZPO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1667 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 918 catttgggaacttcttggcgaga 896
>emb|BX832100.1|CNS09ZOJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH51ZD03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1699 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 919 catttgggaacttcttggcgaga 897
>emb|BX830966.1|CNS09YM4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS43ZA01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1641 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 893 catttgggaacttcttggcgaga 871
>ref|NM_001009262.1| Felis catus melanoma antigen 2 (LOC493792), mRNA Length = 1535 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 377 ccgccgccgctgccgccgccgctgccgccgccgcc 411
>gb|AY052501.1| Felis catus melanoma antigen 2 mRNA, complete cds Length = 1535 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||| |||||||||||| ||||| ||||||| Sbjct: 377 ccgccgccgctgccgccgccgctgccgccgccgcc 411
>emb|AJ429230.1|VCA429230 Volvox carteri f. nagariensis mRNA for pherophorin-dz1 protein Length = 3030 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcc 536 |||||| ||| |||||||||||||||| ||||||| Sbjct: 697 ccgccgtcaccgccgccgccgttgccgccgccgcc 731
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 506 cgccactgccgccgccgttgccgacgc 532 ||||||||||||||||||||| ||||| Sbjct: 7683882 cgccactgccgccgccgttgcagacgc 7683908 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 2175882 cctccgccgccaccgccgccgccgt 2175906 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgc 526 ||||||||||| | |||||||||||||| Sbjct: 17419964 cctccgccgccgccgccgccgccgttgc 17419937 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccg 522 |||||||||||||||||||| Sbjct: 11989434 cgccgccactgccgccgccg 11989453
>emb|AL824711.14| Mouse DNA sequence from clone RP23-112I20 on chromosome X, complete sequence Length = 118199 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 498 acctccgccgccactgccgccgc 520 ||||||||||||||||||||||| Sbjct: 104495 acctccgccgccactgccgccgc 104473
>emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, BAC clone T31P16 (ESSA project) Length = 80088 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 catttgggaacttcttggcgaga 365 ||||||||||||||||||||||| Sbjct: 65149 catttgggaacttcttggcgaga 65127
>emb|AL928620.5| Mouse DNA sequence from clone RP23-319M16 on chromosome 2, complete sequence Length = 82646 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 465 atggtccactgctccaggctgtg 487 ||||||||||||||||||||||| Sbjct: 61540 atggtccactgctccaggctgtg 61562
>emb|AL773526.11| Mouse DNA sequence from clone RP23-181M13 on chromosome X, complete sequence Length = 175563 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 498 acctccgccgccactgccgccgc 520 ||||||||||||||||||||||| Sbjct: 42451 acctccgccgccactgccgccgc 42473
>ref|XM_468287.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1206 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||| | |||||||||||||||| |||||| Sbjct: 92 ccgccgccgccgccgccgccgttgccgtcgccgc 59
>gb|AY532736.1| Zea diploperennis isolate d1 chitinase (chiB) gene, complete cds Length = 1122 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 239 caccaccgccgccactgccgccgccg 214
>ref|NM_014230.2| Homo sapiens signal recognition particle 68kDa (SRP68), mRNA Length = 2515 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 96 caccgccgccgccactgccgccgccg 71
>ref|XM_847223.1| PREDICTED: Canis familiaris similar to LINE-1 reverse transcriptase homolog (LOC609877), mRNA Length = 966 Score = 44.1 bits (22), Expect = 0.55 Identities = 28/30 (93%) Strand = Plus / Minus Query: 422 aatcaccaccagcttcttggcggtgttggc 451 |||||||||||| ||||||| ||||||||| Sbjct: 834 aatcaccaccagattcttggtggtgttggc 805
>gb|BC020238.1| Homo sapiens signal recognition particle 68kDa, mRNA (cDNA clone MGC:31966 IMAGE:4876712), complete cds Length = 1963 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 66 caccgccgccgccactgccgccgccg 41
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB Length = 1683333 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||| ||||||||||| ||||| |||||| Sbjct: 1442736 ccgccgccattgccgccgccgctgccgccgccgc 1442769
>dbj|AK126258.1| Homo sapiens cDNA FLJ44270 fis, clone TLIVE2008229, highly similar to SIGNAL RECOGNITION PARTICLE 68 KDA PROTEIN Length = 2386 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 77 caccgccgccgccactgccgccgccg 52
>dbj|AK074698.1| Homo sapiens cDNA FLJ90217 fis, clone MAMMA1002234, highly similar to SIGNAL RECOGNITION PARTICLE 68 KD PROTEIN Length = 2491 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 72 caccgccgccgccactgccgccgccg 47
>gb|AY012601.1| Drosophila borealis no on or off transient A (nonA) gene, exon 2 and partial cds Length = 478 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 ||||||||||||||| |||||||||| Sbjct: 268 cacctccgccgccaccgccgccgccg 243
>ref|NM_001014630.1| Drosophila melanogaster Rim CG33547-RA (Rim), mRNA Length = 9997 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccga 529 ||||||||||||||||||| |||||| Sbjct: 2976 gccgccactgccgccgccgctgccga 2951
>gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0049O12, from chromosome 2, complete sequence Length = 155154 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||| | |||||||||||||||| |||||| Sbjct: 125318 ccgccgccgccgccgccgccgttgccgtcgccgc 125351
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||| ||||||||||| |||||| ||||| Sbjct: 23974479 ccgccgccattgccgccgccgatgccgatgccgc 23974512 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 23668871 ccgccgccaccgccaccgccgttgccgccgccgc 23668904 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||||| |||||||||| Sbjct: 26172276 cctccgccgccaccgccgccgccg 26172299 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||| |||||||||||||||||| Sbjct: 24242860 cctcccccgccactgccgccgccg 24242837 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgc 526 ||||||||||| | |||||||||||||| Sbjct: 23768438 cctccgccgccgccgccgccgccgttgc 23768411 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 513 gccgccgccgttgccgacgccgcc 536 ||||||||||| |||||||||||| Sbjct: 17723244 gccgccgccgtcgccgacgccgcc 17723221 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 501 tccgccgccactgccgccgc 520 |||||||||||||||||||| Sbjct: 6989757 tccgccgccactgccgccgc 6989738 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgcc 521 |||||||||||||||||||| Sbjct: 4894872 ccgccgccactgccgccgcc 4894853
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 ||||||||||||||| |||||||||| Sbjct: 7178450 cacctccgccgccaccgccgccgccg 7178425 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgccgacg 531 ||||||||||| | ||||||||||| ||||||| Sbjct: 19376532 cctccgccgcctccgccgccgccgtcgccgacg 19376500 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||||| |||||||||||||| Sbjct: 9729354 ccgccgccaccgccgccgccgttgc 9729330 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttg 525 ||||||||||||||||||||| Sbjct: 848077 ccgccactgccgccgccgttg 848097
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.55 Identities = 28/30 (93%) Strand = Plus / Plus Query: 494 gatcacctccgccgccactgccgccgccgt 523 |||| ||||||||||||| ||||||||||| Sbjct: 20107005 gatctcctccgccgccaccgccgccgccgt 20107034
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||| | |||||||||||||||| |||||| Sbjct: 34379788 ccgccgccgccgccgccgccgttgccgtcgccgc 34379755 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 18879992 ccgccgccactgccgccgccg 18880012 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||| | | |||||||||||||| |||||||| Sbjct: 33623430 ccgccgccgccggcgccgccgttgccgccgccgcca 33623395 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||| |||||||||||| Sbjct: 22076652 cctccgccgcccctgccgccgccg 22076629 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 500 ctccgccgccactgccgccg 519 |||||||||||||||||||| Sbjct: 8849966 ctccgccgccactgccgccg 8849947
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 515 cgccgccgttgccgacgccgcc 536 |||||||||||||||||||||| Sbjct: 10792912 cgccgccgttgccgacgccgcc 10792933 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 515 cgccgccgttgccgacgccgcc 536 |||||||||||||||||||||| Sbjct: 10782802 cgccgccgttgccgacgccgcc 10782823 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccgt 523 ||||||||||||||||||||| Sbjct: 65701 cgccgccactgccgccgccgt 65721 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||||| |||||||||| Sbjct: 40914595 cctccgccgccaccgccgccgccg 40914572 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||| |||||||||||| Sbjct: 37297336 cctccgccgccgctgccgccgccg 37297313 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgt 523 |||||||||||||||||||| Sbjct: 36797577 gccgccactgccgccgccgt 36797596 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 513 gccgccgccgttgccgacgccgcc 536 |||||||||||||||| ||||||| Sbjct: 30142056 gccgccgccgttgccgtcgccgcc 30142079 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 508 ccactgccgccgccgttgccgacgccgc 535 ||||| ||||||||||||||| |||||| Sbjct: 7945882 ccacttccgccgccgttgccgccgccgc 7945855
>gb|AC018665.9| Homo sapiens chromosome 17, clone RP11-449J21, complete sequence Length = 184393 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 114644 caccgccgccgccactgccgccgccg 114619
>gb|AC007811.5|AC007811 Drosophila melanogaster, chromosome 3R, region 90C-90D, BAC clone BACR45M04, complete sequence Length = 171569 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccga 529 ||||||||||||||||||| |||||| Sbjct: 142399 gccgccactgccgccgccgctgccga 142424
>gb|AC040980.14| Homo sapiens chromosome 17, clone RP11-685I11, complete sequence Length = 139484 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 |||| ||||||||||||||||||||| Sbjct: 1085 caccgccgccgccactgccgccgccg 1060
>dbj|AP002820.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0702D12 Length = 137332 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 515 cgccgccgttgccgacgccgcc 536 |||||||||||||||||||||| Sbjct: 115726 cgccgccgttgccgacgccgcc 115747 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 515 cgccgccgttgccgacgccgcc 536 |||||||||||||||||||||| Sbjct: 105616 cgccgccgttgccgacgccgcc 105637
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgcc 527 ||||||||| |||||||||||||||| Sbjct: 3630338 ccgccgccattgccgccgccgttgcc 3630313 Score = 44.1 bits (22), Expect = 0.55 Identities = 28/30 (93%) Strand = Plus / Minus Query: 505 ccgccactgccgccgccgttgccgacgccg 534 |||||| ||||||||||||||||| ||||| Sbjct: 3630263 ccgccattgccgccgccgttgccgccgccg 3630234 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgcc 527 ||||||||| |||||||||||||||| Sbjct: 3630218 ccgccgccattgccgccgccgttgcc 3630193 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgcc 527 ||||||||| |||||||||||||||| Sbjct: 3630182 ccgccgccattgccgccgccgttgcc 3630157
>dbj|AP004810.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1068H08 Length = 152794 Score = 44.1 bits (22), Expect = 0.55 Identities = 28/30 (93%) Strand = Plus / Plus Query: 494 gatcacctccgccgccactgccgccgccgt 523 |||| ||||||||||||| ||||||||||| Sbjct: 95279 gatctcctccgccgccaccgccgccgccgt 95308
>dbj|AP004240.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1548_F12 Length = 118814 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||| | |||||||||||||||| |||||| Sbjct: 77435 ccgccgccgccgccgccgccgttgccgtcgccgc 77402
>dbj|AP004011.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1381_H04 Length = 130961 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 ||||||||||||||| |||||||||| Sbjct: 30555 cacctccgccgccaccgccgccgccg 30530
>dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0592C05 Length = 150478 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccg 522 ||||||||||||||| |||||||||| Sbjct: 130529 cacctccgccgccaccgccgccgccg 130504
>dbj|AK121943.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107F03, full insert sequence Length = 2924 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 563 ccgccgccaccgccaccgccgttgccgccgccgc 596
>dbj|AK111522.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002M11, full insert sequence Length = 2776 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 556 ccgccgccaccgccaccgccgttgccgccgccgc 589
>dbj|AK073606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048N17, full insert sequence Length = 1943 Score = 44.1 bits (22), Expect = 0.55 Identities = 28/30 (93%) Strand = Plus / Minus Query: 494 gatcacctccgccgccactgccgccgccgt 523 |||| ||||||||||||| ||||||||||| Sbjct: 1520 gatctcctccgccgccaccgccgccgccgt 1491
>dbj|AK065485.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013003G01, full insert sequence Length = 2519 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||| ||||||||||| |||||| ||||| Sbjct: 550 ccgccgccattgccgccgccgatgccgatgccgc 517
>gb|AE003719.3| Drosophila melanogaster chromosome 3R, section 57 of 118 of the complete sequence Length = 212941 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccga 529 ||||||||||||||||||| |||||| Sbjct: 173370 gccgccactgccgccgccgctgccga 173395
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Plus Query: 513 gccgccgccgttgccgacgccg 534 |||||||||||||||||||||| Sbjct: 41457 gccgccgccgttgccgacgccg 41478
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||| ||||||||||| |||||| ||||| Sbjct: 23902685 ccgccgccattgccgccgccgatgccgatgccgc 23902718 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 23597058 ccgccgccaccgccaccgccgttgccgccgccgc 23597091 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||||| |||||||||| Sbjct: 26100452 cctccgccgccaccgccgccgccg 26100475 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||| |||||||||||||||||| Sbjct: 24171066 cctcccccgccactgccgccgccg 24171043 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgc 526 ||||||||||| | |||||||||||||| Sbjct: 23696637 cctccgccgccgccgccgccgccgttgc 23696610 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 513 gccgccgccgttgccgacgccgcc 536 ||||||||||| |||||||||||| Sbjct: 17677615 gccgccgccgtcgccgacgccgcc 17677592 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 501 tccgccgccactgccgccgc 520 |||||||||||||||||||| Sbjct: 6989636 tccgccgccactgccgccgc 6989617 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgcc 521 |||||||||||||||||||| Sbjct: 4894854 ccgccgccactgccgccgcc 4894835
>emb|AL772425.7|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396_C02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157690 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 37539 ccgccgccaccgccaccgccgttgccgccgccgc 37506
>emb|AL844878.4|CNS08CB1 Oryza sativa chromosome 12, . BAC OSJNBb0036A19 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 128795 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 |||||||||| ||| |||||||||||| |||||| Sbjct: 86751 ccgccgccaccgccaccgccgttgccgccgccgc 86718
>emb|AL928774.3|CNS08CC4 Oryza sativa chromosome 12, . BAC OSJNBa0078O17 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 176388 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccgc 535 ||||||||| ||||||||||| |||||| ||||| Sbjct: 112917 ccgccgccattgccgccgccgatgccgatgccgc 112884
>gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, complete sequence Length = 188708 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 505 ccgccactgccgccgccgttgccgacgccgcca 537 ||||| |||||||||||| ||||| |||||||| Sbjct: 99621 ccgccgctgccgccgccgctgccgccgccgcca 99589
>ref|NM_123664.2| Arabidopsis thaliana ATTRX3; thiol-disulfide exchange intermediate AT5G42980 (ATTRX3) mRNA, complete cds Length = 686 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 252 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 212
>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone OSJNBa0072P02, complete sequence Length = 157488 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgttgccgacg 531 ||||||||||| | ||||||||||| ||||||| Sbjct: 95758 cctccgccgcctccgccgccgccgtcgccgacg 95726
>ref|XM_549808.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1182 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccgt 523 ||||||||||||||||||||| Sbjct: 703 cgccgccactgccgccgccgt 723
>ref|XM_523416.1| PREDICTED: Pan troglodytes AT-binding transcription factor 1 (LOC468024), mRNA Length = 13500 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 12959 ccgccgccactgccgccgccg 12939 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 12944 ccgccgccactgccgccgccg 12924
>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence Length = 190146 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 176378 ccgccgccactgccgccgccg 176358
>gb|AC167202.8| Mus musculus BAC RP24-243A15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 180658 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 149781 tgctccaggctgtggaccgag 149761
>ref|XM_470064.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1656 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccgttgccgacgccgcca 537 |||| |||||||| |||||||||||| |||| |||||||| Sbjct: 166 caccaccgccgccgctgccgccgccgccgccgccgccgcca 126
>ref|NM_194764.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0013J21.23), mRNA Length = 1233 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 272 cctccgccgccaccgccgccgccgt 296
>ref|XM_450572.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2073 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||||| |||||||||||||| Sbjct: 626 ccgccgccaccgccgccgccgttgc 602
>ref|XM_527027.1| PREDICTED: Pan troglodytes similar to Transcriptional activator protein PUR-alpha (Purine-rich single-stranded DNA-binding protein alpha) (LOC471649), mRNA Length = 969 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 137 ccgccgccactgccgccgccg 117
>ref|XM_469388.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1431 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 500 ctccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||| |||||||||||| |||| ||||||| Sbjct: 723 ctccgccgcctctgccgccgccgccgccgccgccgcc 687
>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence Length = 223663 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 108 acagcattcatagtcttcttg 128 ||||||||||||||||||||| Sbjct: 99743 acagcattcatagtcttcttg 99723
>gb|BT019388.1| Homo sapiens purine-rich element binding protein A mRNA, complete cds Length = 969 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 137 ccgccgccactgccgccgccg 117
>gb|AY023143.1| Oryza sativa microsatellite MRG5468 containing (GCC)X8, closest to marker S10045, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 500 ctccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||| |||||||||||| |||| ||||||| Sbjct: 88 ctccgccgcctctgccgccgccgccgccgccgccgcc 124
>gb|AC145780.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0069P02 map near S13580, complete sequence Length = 88044 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 51107 ccgccgccactgccgccgccg 51127
>gb|AC079843.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0013J21, complete sequence Length = 155290 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 154071 cctccgccgccaccgccgccgccgt 154095
>gb|AC137759.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0008H02, complete sequence Length = 143438 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccg 534 |||||||||| ||||||||||| |||| ||||| Sbjct: 81547 ccgccgccaccgccgccgccgtcgccggcgccg 81515
>ref|XM_871926.1| PREDICTED: Bos taurus similar to Calcitonin receptor precursor (CT-R), transcript variant 4 (LOC613317), mRNA Length = 780 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 626 ccgccgccactgccgccgccg 646
>ref|XM_871828.1| PREDICTED: Bos taurus similar to Calcitonin receptor precursor (CT-R), transcript variant 3 (LOC613317), mRNA Length = 738 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 584 ccgccgccactgccgccgccg 604
>ref|XM_863925.1| PREDICTED: Bos taurus similar to Calcitonin receptor precursor (CT-R), transcript variant 2 (LOC613317), mRNA Length = 798 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 626 ccgccgccactgccgccgccg 646
>ref|NM_008989.1| Mus musculus purine rich element binding protein A (Pura), mRNA Length = 1609 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 655 ccgccgccactgccgccgccg 635
>gb|BC071219.1| Mus musculus transducin-like enhancer of split 2, homolog of Drosophila E(spl), mRNA (cDNA clone IMAGE:5062200), partial cds Length = 2576 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 660 tgctccaggctgtggaccgag 680
>ref|NM_019634.2| Mus musculus tetraspanin 7 (Tspan7), mRNA Length = 1791 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 10 ccgccgccactgccgccgccg 30
>ref|NM_005859.3| Homo sapiens purine-rich element binding protein A (PURA), mRNA Length = 2614 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 196 ccgccgccactgccgccgccg 176
>ref|NM_004985.3| Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), transcript variant b, mRNA Length = 5312 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 44 ccgccgccactgccgccgccg 24
>ref|NM_033360.2| Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), transcript variant a, mRNA Length = 5436 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 44 ccgccgccactgccgccgccg 24
>gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome 6, complete sequence Length = 172616 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 73008 ccgccgccactgccgccgccg 72988
>gb|AC124459.5| Mus musculus BAC clone RP24-140E5 from chromosome 19, complete sequence Length = 170323 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttgccgacgccgcca 537 ||||| |||||||||||| ||||| |||||||| Sbjct: 4607 ccgccgctgccgccgccgctgccgccgccgcca 4639
>gb|AC131191.4| Mus musculus BAC clone RP24-464B16 from chromosome 18, complete sequence Length = 136832 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 16258 ccgccgccactgccgccgccg 16278
>gb|AC130714.3| Mus musculus BAC clone RP23-367L18 from chromosome 18, complete sequence Length = 193184 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 121697 ccgccgccactgccgccgccg 121717
>gb|AF282406.1| Ovis aries DNA binding protein pur-alpha mRNA, complete cds Length = 1113 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 151 ccgccgccactgccgccgccg 131
>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 264561 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 76458 tgctccaggctgtggaccgag 76438
>ref|XM_987682.1| PREDICTED: Mus musculus purine rich element binding protein A, transcript variant 2 (Pura), mRNA Length = 5320 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 83 ccgccgccactgccgccgccg 63
>ref|XM_987644.1| PREDICTED: Mus musculus purine rich element binding protein A, transcript variant 1 (Pura), mRNA Length = 5296 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 59 ccgccgccactgccgccgccg 39
>ref|XM_987720.1| PREDICTED: Mus musculus purine rich element binding protein A, transcript variant 3 (Pura), mRNA Length = 5560 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 323 ccgccgccactgccgccgccg 303
>ref|XM_001001431.1| PREDICTED: Mus musculus hypothetical protein LOC668437 (LOC668437), mRNA Length = 774 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 165 ccgccgccactgccgccgccg 185 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttgccgacgccgcc 536 ||||| |||||||||||| ||||| ||||||| Sbjct: 52 ccgccgctgccgccgccgctgccgccgccgcc 83
>ref|XM_990556.1| PREDICTED: Mus musculus purine rich element binding protein A (Pura), mRNA Length = 5410 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 172 ccgccgccactgccgccgccg 152
>ref|XM_001001534.1| PREDICTED: Mus musculus similar to vesicular membrane protein p24 (LOC672808), mRNA Length = 681 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 314 ccgccgccactgccgccgccg 294
>ref|XM_544078.2| PREDICTED: Canis familiaris similar to G protein-coupled receptor 7 (LOC486949), mRNA Length = 996 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 94 ccgccgccactgccgccgccg 114
>ref|XM_862219.1| PREDICTED: Canis familiaris similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2), transcript variant 4 (LOC477709), mRNA Length = 2384 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 ||||||||||||||||||| |||| ||||||| Sbjct: 123 gccgccactgccgccgccgccgccgccgccgcc 155
>ref|XM_862210.1| PREDICTED: Canis familiaris similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2), transcript variant 3 (LOC477709), mRNA Length = 1430 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 ||||||||||||||||||| |||| ||||||| Sbjct: 123 gccgccactgccgccgccgccgccgccgccgcc 155
>ref|XM_534902.2| PREDICTED: Canis familiaris similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2), transcript variant 2 (LOC477709), mRNA Length = 2357 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 ||||||||||||||||||| |||| ||||||| Sbjct: 123 gccgccactgccgccgccgccgccgccgccgcc 155
>gb|AC135594.4| Oryza sativa chromosome 3 BAC OSJNBa0024F18 genomic sequence, complete sequence Length = 159795 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgccgttgccgacgccgcca 537 |||| |||||||| |||||||||||| |||| |||||||| Sbjct: 103604 caccaccgccgccgctgccgccgccgccgccgccgccgcca 103564
>gb|BC062961.1| Mus musculus transducin-like enhancer of split 2, homolog of Drosophila E(spl), mRNA (cDNA clone IMAGE:5695416), partial cds Length = 2760 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 559 tgctccaggctgtggaccgag 579
>gb|BC063484.1| Homo sapiens cDNA clone IMAGE:5242449, partial cds Length = 1344 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 57 gccgccactgccgccgccgctgccg 81
>gb|AC023600.19| Homo sapiens 3 BAC RP11-754J20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 185326 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 434 gccgccactgccgccgccgctgccg 458
>ref|XM_814975.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053509287.240) partial mRNA Length = 10392 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 4873 ccgccgccactgccgccgccg 4893
>ref|XM_815354.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053508139.20) partial mRNA Length = 10380 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 4864 ccgccgccactgccgccgccg 4884
>ref|XM_544287.2| PREDICTED: Canis familiaris similar to Transcriptional activator protein PUR-alpha (Purine-rich single-stranded DNA-binding protein alpha) (LOC487159), mRNA Length = 2906 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 383 ccgccgccactgccgccgccg 363
>ref|XM_541127.2| PREDICTED: Canis familiaris similar to Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2, transcript variant 1 (LOC484010), mRNA Length = 1866 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 |||||| |||||||||||| ||||| ||||||| Sbjct: 663 gccgccgctgccgccgccgctgccgccgccgcc 631
>ref|XM_855740.1| PREDICTED: Canis familiaris similar to Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2, transcript variant 3 (LOC484010), mRNA Length = 1921 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 |||||| |||||||||||| ||||| ||||||| Sbjct: 718 gccgccgctgccgccgccgctgccgccgccgcc 686
>ref|XM_845065.1| PREDICTED: Canis familiaris similar to Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2, transcript variant 2 (LOC484010), mRNA Length = 2048 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccgacgccgcc 536 |||||| |||||||||||| ||||| ||||||| Sbjct: 845 gccgccgctgccgccgccgctgccgccgccgcc 813
>gb|BC051955.1| Mus musculus transducin-like enhancer of split 2, homolog of Drosophila E(spl), mRNA (cDNA clone IMAGE:5695416), complete cds Length = 2760 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 559 tgctccaggctgtggaccgag 579
>gb|BC105999.1| Homo sapiens cDNA clone MGC:104534 IMAGE:5259422, complete cds Length = 3868 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 74 gccgccactgccgccgccgctgccg 98
>gb|BC100652.1| Rattus norvegicus transducin-like enhancer of split 2, homolog of Drosophila E(spl), mRNA (cDNA clone MGC:124808 IMAGE:7932424), complete cds Length = 2431 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 485 tgctccaggctgtggaccgag 505
>emb|AL359272.9| Human DNA sequence from clone RP11-554P16 on chromosome X Contains the 5' end of gene KIAA1202 and a CpG island, complete sequence Length = 173510 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 83217 ccgccgccactgccgccgccg 83197
>ref|XM_964316.1| PREDICTED: Tribolium castaneum similar to CG5812-PA (LOC657888), mRNA Length = 981 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccg 534 ||||||||| ||||||||||| ||||| ||||| Sbjct: 794 ccgccgccaatgccgccgccgatgccgccgccg 762
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 2175931 cctccgccgccaccgccgccgccgt 2175955
>emb|Z35474.1|ATTHIRED2 A.thaliana (GIF1) mRNA for thioredoxin Length = 489 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 121 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 81
>emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genome; segment 5/16 Length = 349737 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgcc 521 ||||||||||||||| ||||||||| Sbjct: 102813 cacctccgccgccaccgccgccgcc 102837
>gb|BC029545.1| Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, mRNA (cDNA clone IMAGE:5301134) Length = 1693 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 53 ccgccgccactgccgccgccg 33
>gb|BC036087.1| Homo sapiens purine-rich element binding protein A, mRNA (cDNA clone MGC:33782 IMAGE:5284976), complete cds Length = 2582 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 149 ccgccgccactgccgccgccg 129
>emb|AL834270.1|HSM805302 Homo sapiens mRNA; cDNA DKFZp761G128 (from clone DKFZp761G128) Length = 3315 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 44 gccgccactgccgccgccgctgccg 68
>emb|AL731614.4|OSJN00260 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0079F16, complete sequence Length = 157801 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgcc 521 ||||||||||||| ||||||||||| Sbjct: 36005 cacctccgccgccgctgccgccgcc 36029
>emb|AL589766.17| Mouse DNA sequence from clone RP23-19G4 on chromosome 13 contains the Vmp gene for vesicular membrane protein P24, complete sequence Length = 176183 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 39204 ccgccgccactgccgccgccg 39224
>dbj|AK220533.1| Mus musculus mRNA for mKIAA4188 protein Length = 3626 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 1415 tgctccaggctgtggaccgag 1435
>gb|BC114123.1| Bos taurus cDNA clone MGC:137260 IMAGE:8166197, complete cds Length = 2552 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 1569 ccgccgccactgccgccgccg 1589
>gb|AY114566.1| Arabidopsis thaliana thioredoxin clone GIF1 (At5g42980) mRNA, complete cds Length = 402 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 117 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 77
>gb|AC087239.18| Homo sapiens 12p BAC RP11-707G18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 178006 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 152776 ccgccgccactgccgccgccg 152756
>gb|AY093318.1| Arabidopsis thaliana thioredoxin (At5g42980) mRNA, complete cds Length = 440 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 117 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 77
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 501 tccgccgccactgccgccgccgttgccgacgccgcca 537 |||||||||| |||||||||||| ||| |||||||| Sbjct: 3835465 tccgccgccaaagccgccgccgttaccgccgccgcca 3835429
>gb|AC094080.4| Homo sapiens chromosome 5 clone CTB-77K22, complete sequence Length = 118504 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 9387 ccgccgccactgccgccgccg 9407
>ref|NM_009501.1| Mus musculus ventral anterior homeobox containing gene 1 (Vax1), mRNA Length = 1017 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttgccgacgccgcca 537 ||||| |||||||||||| ||||| |||||||| Sbjct: 674 ccgccgctgccgccgccgctgccgccgccgcca 706
>gb|AF468110.1| Homo sapiens vascular endothelial growth factor B isoform (VEGFB) gene, complete cds, alternatively spliced Length = 6002 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 511 ctgccgccgccgttgccgacgccgc 535 |||||||||||| |||||||||||| Sbjct: 3537 ctgccgccgccgctgccgacgccgc 3561
>gb|AC074283.3| Oryza sativa chromosome 10 clone OSJNBa0087H07, complete sequence Length = 156654 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 1585 cctccgccgccaccgccgccgccgt 1609
>dbj|AK144581.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730003H17 product:transducin-like enhancer of split 2, homolog of Drosophila E(spl), full insert sequence Length = 2722 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 474 tgctccaggctgtggaccgag 494 ||||||||||||||||||||| Sbjct: 690 tgctccaggctgtggaccgag 710
>gb|AY065098.1| Arabidopsis thaliana thioredoxin (clone GIF1) (At5g42980; MBD2.18) mRNA, complete cds Length = 469 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 163 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 123
>ref|XM_943066.1| PREDICTED: Homo sapiens hypothetical protein LOC647858 (LOC647858), mRNA Length = 952 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 100 gccgccactgccgccgccgctgccg 124
>ref|XM_931729.1| PREDICTED: Homo sapiens hypothetical protein LOC643665 (LOC643665), mRNA Length = 937 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 85 gccgccactgccgccgccgctgccg 109
>gb|DQ138089.1| Triticum aestivum clone wmc(6a4) microsatellite sequence Length = 285 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||| |||||||||||||||| Sbjct: 127 ccgccgccgctgccgccgccgttgc 151
>dbj|AK160941.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:4021402L23 product:vesicular membrain protein p24, full insert sequence Length = 2122 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 66 ccgccgccactgccgccgccg 46
>gb|AY059870.1| Arabidopsis thaliana thioredoxin (clone GIF1) (At5g42980; MBD2.18) mRNA, complete cds Length = 534 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 163 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 123
>gb|AC087771.3|AC087771 Genomic Sequence for Medicago truncatula, clone 8D15, complete sequence Length = 69590 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 500 ctccgccgccactgccgccgc 520 ||||||||||||||||||||| Sbjct: 28836 ctccgccgccactgccgccgc 28856
>gb|AF281817.1|AF281817 Tupaia herpesvirus strain 2, complete genome Length = 195859 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccgt 523 ||||||||||||| ||||||||||| Sbjct: 179351 cctccgccgccaccgccgccgccgt 179327
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccg 534 |||||||||| |||||||||||| ||| ||||| Sbjct: 532594 ccgccgccaccgccgccgccgttaccgtcgccg 532562
>gb|AC148688.1| Macaca mulatta Major Histocompatibility Complex BAC MMU218K02, complete sequence Length = 182826 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgcc 521 |||| |||||||||||||||||||| Sbjct: 55990 caccgccgccgccactgccgccgcc 55966
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgcc 521 ||||||||||||| ||||||||||| Sbjct: 11867410 cacctccgccgccgctgccgccgcc 11867434 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccg 522 |||||||||||||||||||| Sbjct: 31076720 cgccgccactgccgccgccg 31076739 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 495 atcacctccgccgccactgccgccgccg 522 ||||||||||||||| | |||||||||| Sbjct: 24907587 atcacctccgccgccgccgccgccgccg 24907560
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgccgacgccg 534 |||||||||| ||||||||||| |||| ||||| Sbjct: 17573736 ccgccgccaccgccgccgccgtcgccggcgccg 17573704 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccgccg 522 ||||||||||||| |||||||||| Sbjct: 2330780 cctccgccgccaccgccgccgccg 2330757
>ref|XM_392428.2| PREDICTED: Apis mellifera similar to CG10173-PA (LOC408898), mRNA Length = 2967 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 501 tccgccgccactgccgccgccgttg 525 ||||||||||| ||||||||||||| Sbjct: 2514 tccgccgccaccgccgccgccgttg 2490
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds Length = 3284914 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 497 cacctccgccgccactgccgccgcc 521 |||| |||||||||||||||||||| Sbjct: 22081 caccgccgccgccactgccgccgcc 22105
>emb|BX830123.1|CNS0A06Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB61ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 508 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 102 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 62
>emb|BX833468.1|CNS09Z1R Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL57ZG11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 556 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 150 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 110
>dbj|AB020495.2| Mus musculus Vax1 gene for homeobox protein, complete cds Length = 3496 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttgccgacgccgcca 537 ||||| |||||||||||| ||||| |||||||| Sbjct: 2642 ccgccgctgccgccgccgctgccgccgccgcca 2674
>gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 64263 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 504 gccgccactgccgccgccgttgccg 528 ||||||||||||||||||| ||||| Sbjct: 1572 gccgccactgccgccgccgctgccg 1548
>ref|NM_001009447.1| Ovis aries purine-rich element binding protein A (PURA), mRNA Length = 1113 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 151 ccgccgccactgccgccgccg 131
>gb|AC097368.3| Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence Length = 119329 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 500 ctccgccgccactgccgccgccgttgccgacgccgcc 536 |||||||||| |||||||||||| |||| ||||||| Sbjct: 117094 ctccgccgcctctgccgccgccgccgccgccgccgcc 117130
>gb|AC011379.7| Homo sapiens chromosome 5 clone CTB-131B5, complete sequence Length = 170797 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 92818 ccgccgccactgccgccgccg 92838
>ref|XM_226016.3| PREDICTED: Rattus norvegicus purine rich element binding protein A (predicted) (Pura_predicted), mRNA Length = 1097 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 137 ccgccgccactgccgccgccg 117
>gb|AY085117.1| Arabidopsis thaliana clone 13096 mRNA, complete sequence Length = 639 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 401 gcaccatgatgcagtgaagtcaatcaccaccagcttcttgg 441 |||||||| |||||||||||| ||||| | ||| ||||||| Sbjct: 252 gcaccatgttgcagtgaagtctatcacaatcagtttcttgg 212
>gb|AY084491.1| Arabidopsis thaliana clone 109454 mRNA, complete sequence Length = 1790 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 499 cctccgccgccactgccgccg 519 ||||||||||||||||||||| Sbjct: 216 cctccgccgccactgccgccg 196
>gb|AC156445.2| Volvox carteri clone JGIAOBO-25P15, complete sequence Length = 31713 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 501 tccgccgccactgccgccgcc 521 ||||||||||||||||||||| Sbjct: 25964 tccgccgccactgccgccgcc 25944
>dbj|AP005787.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0501E09 Length = 150604 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttg 525 ||||||||||||||||||||| Sbjct: 133416 ccgccactgccgccgccgttg 133436
>dbj|AP005709.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0646B04 Length = 178896 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 505 ccgccactgccgccgccgttg 525 ||||||||||||||||||||| Sbjct: 12204 ccgccactgccgccgccgttg 12224
>dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0672D08 Length = 173729 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 503 cgccgccactgccgccgccgt 523 ||||||||||||||||||||| Sbjct: 63503 cgccgccactgccgccgccgt 63523
>dbj|AP005863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0040N23 Length = 101061 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||||| |||||||||||||| Sbjct: 1773 ccgccgccaccgccgccgccgttgc 1749
>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461D06 Length = 112895 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 43525 ccgccgccactgccgccgccg 43545
>dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0706E03 Length = 188028 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||||| |||||||||||||| Sbjct: 169451 ccgccgccaccgccgccgccgttgc 169427
>ref|XM_557109.1| Anopheles gambiae str. PEST ENSANGP00000026402 (ENSANGG00000024980), partial mRNA Length = 693 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 476 ccgccgccactgccgccgccg 456
>ref|XM_319934.1| Anopheles gambiae str. PEST ENSANGP00000023425 (ENSANGG00000021249), partial mRNA Length = 677 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 391 ccgccgccactgccgccgccg 371
>ref|XM_316112.2| Anopheles gambiae str. PEST ENSANGP00000012557 (ENSANGG00000010068), partial mRNA Length = 681 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccgttgc 526 |||||||||| |||||||||||||| Sbjct: 458 ccgccgccaccgccgccgccgttgc 434
>dbj|AK108886.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-D12, full insert sequence Length = 932 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 497 cacctccgccgccactgccgccgcc 521 ||||||||||||| ||||||||||| Sbjct: 71 cacctccgccgccgctgccgccgcc 47
>emb|AJ333346.1|HSA333346 Homo sapiens genomic sequence surrounding NotI site, clone NL6-HP13C Length = 778 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 46 ccgccgccactgccgccgccg 26
>emb|AJ335863.1|HSA335863 Homo sapiens genomic sequence surrounding NotI site, clone NL6-DF10C Length = 665 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 502 ccgccgccactgccgccgccg 522 ||||||||||||||||||||| Sbjct: 46 ccgccgccactgccgccgccg 26 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,789,079 Number of Sequences: 3902068 Number of extensions: 4789079 Number of successful extensions: 104845 Number of sequences better than 10.0: 473 Number of HSP's better than 10.0 without gapping: 509 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 99160 Number of HSP's gapped (non-prelim): 5668 length of query: 627 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 604 effective length of database: 17,143,297,704 effective search space: 10354551813216 effective search space used: 10354551813216 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)