>ref|XM_478355.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2262

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Minus

                                                                        
Query: 231  ttctcatcctttgctgcacgcttccacagagactgaccatctttgccgttgaagttcagc 290
            ||||| ||||||| ||||||||||||||| |  || | |||||||||| | ||||| |||
Sbjct: 1925 ttctcctcctttggtgcacgcttccacagtggatggcgatctttgccgataaagttgagc 1866

                                                                        
Query: 291  ttgagcttgaaccggtttttaatctc---ggcagacttctcgtcaggttgctccgtgatc 347
            |||| |||||||||||||||| ||||   ||  ||||| || ||||||  |||| | |||
Sbjct: 1865 ttgatcttgaaccggtttttactctcaaggggggacttttcatcaggtgcctccattatc 1806

                                                   
Query: 348  tgaagagcgtcttcaggatgggttactatggcttccatc 386
            |||||||  |||||||| || ||||||||||||||||||
Sbjct: 1805 tgaagagtttcttcagggtgagttactatggcttccatc 1767

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Minus

                                                                            
Query: 231      ttctcatcctttgctgcacgcttccacagagactgaccatctttgccgttgaagttcagc 290
                ||||| ||||||| ||||||||||||||| |  || | |||||||||| | ||||| |||
Sbjct: 19451241 ttctcctcctttggtgcacgcttccacagtggatggcgatctttgccgataaagttgagc 19451182

                                                                            
Query: 291      ttgagcttgaaccggtttttaatctc---ggcagacttctcgtcaggttgctccgtgatc 347
                |||| |||||||||||||||| ||||   ||  ||||| || ||||||  |||| | |||
Sbjct: 19451181 ttgatcttgaaccggtttttactctcaaggggggacttttcatcaggtgcctccattatc 19451122

                                                       
Query: 348      tgaagagcgtcttcaggatgggttactatggcttccatc 386
                |||||||  |||||||| || ||||||||||||||||||
Sbjct: 19451121 tgaagagtttcttcagggtgagttactatggcttccatc 19451083

>dbj|AP005185.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0409B11
          Length = 168354

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Minus

                                                                          
Query: 231    ttctcatcctttgctgcacgcttccacagagactgaccatctttgccgttgaagttcagc 290
              ||||| ||||||| ||||||||||||||| |  || | |||||||||| | ||||| |||
Sbjct: 140779 ttctcctcctttggtgcacgcttccacagtggatggcgatctttgccgataaagttgagc 140720

                                                                          
Query: 291    ttgagcttgaaccggtttttaatctc---ggcagacttctcgtcaggttgctccgtgatc 347
              |||| |||||||||||||||| ||||   ||  ||||| || ||||||  |||| | |||
Sbjct: 140719 ttgatcttgaaccggtttttactctcaaggggggacttttcatcaggtgcctccattatc 140660

                                                     
Query: 348    tgaagagcgtcttcaggatgggttactatggcttccatc 386
              |||||||  |||||||| || ||||||||||||||||||
Sbjct: 140659 tgaagagtttcttcagggtgagttactatggcttccatc 140621

>dbj|AK070461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050A04, full
            insert sequence
          Length = 2262

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 132/159 (83%), Gaps = 3/159 (1%)
 Strand = Plus / Minus

                                                                        
Query: 231  ttctcatcctttgctgcacgcttccacagagactgaccatctttgccgttgaagttcagc 290
            ||||| ||||||| ||||||||||||||| |  || | |||||||||| | ||||| |||
Sbjct: 1925 ttctcctcctttggtgcacgcttccacagtggatggcgatctttgccgataaagttgagc 1866

                                                                        
Query: 291  ttgagcttgaaccggtttttaatctc---ggcagacttctcgtcaggttgctccgtgatc 347
            |||| |||||||||||||||| ||||   ||  ||||| || ||||||  |||| | |||
Sbjct: 1865 ttgatcttgaaccggtttttactctcaaggggggacttttcatcaggtgcctccattatc 1806

                                                   
Query: 348  tgaagagcgtcttcaggatgggttactatggcttccatc 386
            |||||||  |||||||| || ||||||||||||||||||
Sbjct: 1805 tgaagagtttcttcagggtgagttactatggcttccatc 1767

>gb|AC096082.6| Rattus norvegicus 13 BAC CH230-11O17 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 209228

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 116    tgaagcttttgcattcttttttgaaaata 144
              ||||||||||||| |||||||| ||||||
Sbjct: 207764 tgaagcttttgcagtctttttttaaaata 207736

>gb|AC092991.12| Homo sapiens 3 BAC RP11-463H24 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 150726

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 117  gaagcttttgcattctttttt 137
            |||||||||||||||||||||
Sbjct: 9256 gaagcttttgcattctttttt 9276

>gb|AC010043.7| Drosophila melanogaster 3L BAC RP98-12K4 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 184657

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 305    gtttttaatctcggcagacttctcg 329
              |||||||||||||||| ||||||||
Sbjct: 173034 gtttttaatctcggcatacttctcg 173010

>gb|AC010107.7| Drosophila melanogaster 3L BAC RP98-2B1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181063

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 305    gtttttaatctcggcagacttctcg 329
              |||||||||||||||| ||||||||
Sbjct: 121861 gtttttaatctcggcatacttctcg 121885

>gb|AE003551.3| Drosophila melanogaster chromosome 3L, section 34 of 83 of the complete
              sequence
          Length = 285860

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 305    gtttttaatctcggcagacttctcg 329
              |||||||||||||||| ||||||||
Sbjct: 172833 gtttttaatctcggcatacttctcg 172809

>ref|XM_525174.1| PREDICTED: Pan troglodytes similar to SPRY domain-containing SOCS box
            protein SSB-1 (LOC469790), mRNA
          Length = 2100

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 92   tggtgggggtggcgacggca 111
            ||||||||||||||||||||
Sbjct: 1382 tggtgggggtggcgacggca 1401

>ref|NM_025106.2| Homo sapiens splA/ryanodine receptor domain and SOCS box containing
           1 (SPSB1), mRNA
          Length = 3081

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 631 tggtgggggtggcgacggca 650

>gb|BC015711.1| Homo sapiens splA/ryanodine receptor domain and SOCS box containing
           1, mRNA (cDNA clone MGC:16798 IMAGE:3916157), complete
           cds
          Length = 3081

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 631 tggtgggggtggcgacggca 650

>gb|AC102435.6| Mus musculus chromosome 12, clone RP24-123B22, complete sequence
          Length = 155483

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    ttttgcattcttttttgaaa 141
              ||||||||||||||||||||
Sbjct: 115827 ttttgcattcttttttgaaa 115808

>ref|XM_663516.1| Cryptosporidium hominis TU502 transmembrane protein (Chro.70161)
            partial mRNA
          Length = 3249

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  tgttctcttctcatcctttg 243
            ||||||||||||||||||||
Sbjct: 2403 tgttctcttctcatcctttg 2384

>emb|AL590367.4| Human DNA sequence from clone RP13-250M14 on chromosome X, complete
            sequence
          Length = 73357

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 127  cattcttttttgaaaataag 146
            ||||||||||||||||||||
Sbjct: 6428 cattcttttttgaaaataag 6447

>emb|AL008734.10|HS324M8 Human DNA sequence from clone RP3-324M8 on chromosome 1p36.2-36.3
             Contains the 5' end of the gene for a novel SPRY domain
             containing protein and a CpG island, complete sequence
          Length = 85116

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 92    tggtgggggtggcgacggca 111
             ||||||||||||||||||||
Sbjct: 10409 tggtgggggtggcgacggca 10390

>emb|AL731687.13| Mouse DNA sequence from clone RP23-56I20 on chromosome 11 Contains the
             5' end of the gene for a novel protein similar to dynein,
             the Efnb3 gene for ephrin B3, a novel gene, the Trp53 gene
             for transformation related protein 53, the Atp1b2 gene for
             Na+/K+ transporting ATPase beta 2 polypeptide, the Shbg
             gene for sex hormone binding globulin, the 5' end of the
             Sat2 gene for spermidine/spermine N1-acetyl transferase 2
             and two CpG islands, complete sequence
          Length = 116898

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   ttgcattcttttttgaaaat 143
             ||||||||||||||||||||
Sbjct: 26154 ttgcattcttttttgaaaat 26135

>emb|AL929168.3| Zebrafish DNA sequence from clone DKEYP-97C5 in linkage group 4
             Contains the 5' end of the gene for a novel protein
             similar to vertebrate KCND2 and two CpG islands, complete
             sequence
          Length = 50304

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   tctcttctcatcctttgctg 246
             ||||||||||||||||||||
Sbjct: 16257 tctcttctcatcctttgctg 16238

>emb|CR609804.1| full-length cDNA clone CS0DI075YP10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 3039

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 663 tggtgggggtggcgacggca 682

>gb|AF403026.1|AF403026 Homo sapiens SPRY domain-containing SOCS box protein SSB-1 mRNA,
           complete cds
          Length = 1007

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 526 tggtgggggtggcgacggca 545

>ref|XM_628316.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_1340),
            partial mRNA
          Length = 3255

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  tgttctcttctcatcctttg 243
            ||||||||||||||||||||
Sbjct: 2409 tgttctcttctcatcctttg 2390

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 291     ttgagcttgaaccggttttt 310
               ||||||||||||||||||||
Sbjct: 2435259 ttgagcttgaaccggttttt 2435240

>gb|AF270342.1|AF270342 Staphylococcus epidermidis strain SR1 clone step.4022h07 genomic
            sequence
          Length = 3206

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  cttttgcattcttttttgaa 140
            ||||||||||||||||||||
Sbjct: 1594 cttttgcattcttttttgaa 1613

>gb|AF270312.1|AF270312 Staphylococcus epidermidis strain SR1 clone step.4002c09 genomic
            sequence
          Length = 3069

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 121  cttttgcattcttttttgaa 140
            ||||||||||||||||||||
Sbjct: 1888 cttttgcattcttttttgaa 1869

>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome
          Length = 2616530

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    cttttgcattcttttttgaa 140
              ||||||||||||||||||||
Sbjct: 667874 cttttgcattcttttttgaa 667893

>gb|AC102224.21| Mus musculus chromosome 3, clone RP24-372D1, complete sequence
          Length = 196936

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 111    aactctgaagcttttgcattcttt 134
              ||||||||| ||||||||||||||
Sbjct: 121496 aactctgaaacttttgcattcttt 121519

>dbj|AK026046.1| Homo sapiens cDNA: FLJ22393 fis, clone HRC07880
          Length = 1648

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 677 tggtgggggtggcgacggca 696

>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome
          Length = 2499279

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    cttttgcattcttttttgaa 140
              ||||||||||||||||||||
Sbjct: 775362 cttttgcattcttttttgaa 775381

>dbj|AB209559.1| Homo sapiens mRNA for SPRY domain-containing SOCS box protein SSB-1
           variant protein
          Length = 1231

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 92  tggtgggggtggcgacggca 111
           ||||||||||||||||||||
Sbjct: 636 tggtgggggtggcgacggca 655


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,328,961
Number of Sequences: 3902068
Number of extensions: 3328961
Number of successful extensions: 59988
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59871
Number of HSP's gapped (non-prelim): 113
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)