>gb|BC079674.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           MGC:90775 IMAGE:30531994), complete cds
          Length = 5012

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 927 tcactggaatcggagtcccgagca 904

>gb|BC037199.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           IMAGE:3672749)
          Length = 3544

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 422 tcactggaatcggagtcccgagca 399

>gb|AF449715.1| Mus musculus pVHL-interacting deubiquitinating enzyme 2 (Vdu2)
           mRNA, complete cds
          Length = 4094

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 989 tcactggaatcggagtcccgagca 966

>dbj|AK163663.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN
           full-length enriched library, clone:B830039L20
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4052

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 948 tcactggaatcggagtcccgagca 925

>dbj|AK047242.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930041H10 product:BA409K20.4
           (UBIQUITIN SPECIFIC PROTEASE 20 (KIAA1003)) homolog
           [Homo sapiens], full insert sequence
          Length = 4065

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 957 tcactggaatcggagtcccgagca 934

>dbj|AK087412.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130012I02 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4053

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 949 tcactggaatcggagtcccgagca 926

>dbj|AK054279.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330009O13
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4101

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 981 tcactggaatcggagtcccgagca 958

>dbj|AK029890.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4931427A11 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4980

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 935 tcactggaatcggagtcccgagca 912

>dbj|AK173083.1| Mus musculus mRNA for mKIAA1003 protein
          Length = 4044

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 940 tcactggaatcggagtcccgagca 917

>ref|NM_028846.2| Mus musculus ubiquitin specific peptidase 20 (Usp20), mRNA
          Length = 5012

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 369 tcactggaatcggagtcccgagca 392
           ||||||||||||||||||||||||
Sbjct: 927 tcactggaatcggagtcccgagca 904

>emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chromosome 2, complete
             sequence
          Length = 170475

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 369   tcactggaatcggagtcccgagca 392
             ||||||||||||||||||||||||
Sbjct: 35857 tcactggaatcggagtcccgagca 35834

>emb|AL031686.2|HS981L23 Human DNA sequence from clone RP5-981L23 on chromosome 20q12.1-13.2
            Contains the 5' end of the ELMO2 gene for engulfment and
            cell motility 2 (ced-12 homolog, C. elegans), a Krueppel
            type zinc-finger protein pseudogene, a Makorin (MKRN1 or
            MKRN3) ring finger protein pseudogene, a novel KRAB box
            type zinc-finger protein gene, a novel gene
            (DKFZp547G0215) and a CpG island, complete sequence
          Length = 94817

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 277  aagggcaacatggtcatttcca 298
            ||||||||||||||||||||||
Sbjct: 8290 aagggcaacatggtcatttcca 8269

>gb|AC009469.4| Homo sapiens BAC clone RP11-20N16 from 2, complete sequence
          Length = 168448

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 350   gaagacgtgggctttggaatca 371
             ||||||||||||||||||||||
Sbjct: 39404 gaagacgtgggctttggaatca 39383

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 168     atggcatgacctgcaaactgg 188
               |||||||||||||||||||||
Sbjct: 2723931 atggcatgacctgcaaactgg 2723951

>emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chromosome 13 Contains the 5'
             end of a novel gene, the gene for suppressor of G2 allele
             of SKP1, S. cerevisiae, the 5' end of a gene similar to
             TPTE and PTEN homologous inositol lipid phosphatase (TPIP)
             , a pseudogene similar to part of regulator of G-protein
             signalling 17 (RGS17), the WBP4 gene for WW domain binding
             protein 4 (formin binding protein 21) and 4 CpG islands,
             complete sequence
          Length = 198567

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 421   gctagtctgcaaaataaataa 441
             |||||||||||||||||||||
Sbjct: 30716 gctagtctgcaaaataaataa 30696

>emb|BX649258.11| Zebrafish DNA sequence from clone CH211-203F4 in linkage group 15,
             complete sequence
          Length = 148199

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 214   tgcgagaagctcgtggaagga 234
             |||||||||||||||||||||
Sbjct: 44613 tgcgagaagctcgtggaagga 44593

>dbj|AB178530.1| Caiman crocodilus GARS-AIRS-GART mRNA for glycinamide
           ribonucleotide synthetase-aminoimidazole ribonucleotide
           synthetase-glycinamide ribonucleotide transformylase,
           partial cds
          Length = 2599

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 273 gggcaagggcaacatggtcat 293
           |||||||||||||||||||||
Sbjct: 119 gggcaagggcaacatggtcat 99

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tctcgaaggtgctgtttacg 273
              ||||||||||||||||||||
Sbjct: 398912 tctcgaaggtgctgtttacg 398931

>gb|AC159503.10| Mus musculus 10 BAC RP24-293I2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 199258

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 451    ggcccctgggcagagcagct 470
              ||||||||||||||||||||
Sbjct: 168350 ggcccctgggcagagcagct 168331

>gb|AC096909.10| Rattus norvegicus 8 BAC CH230-88B13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 241078

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   ccattgtgagatcacatagt 315
             ||||||||||||||||||||
Sbjct: 39315 ccattgtgagatcacatagt 39334

>emb|AL391724.7| Human DNA sequence from clone RP11-350A18 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 141628

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 352    agacgtgggctttggaatca 371
              ||||||||||||||||||||
Sbjct: 114713 agacgtgggctttggaatca 114694

>emb|AL935255.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 4/11
          Length = 269050

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     gattacatcgccttggcgat 34
              ||||||||||||||||||||
Sbjct: 205688 gattacatcgccttggcgat 205669

>gb|AC079585.3| Homo sapiens BAC clone RP11-161A24 from 2, complete sequence
          Length = 63107

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 307   tcacatagtgaaaatggtac 326
             ||||||||||||||||||||
Sbjct: 13883 tcacatagtgaaaatggtac 13902

>ref|XM_231148.3| PREDICTED: Rattus norvegicus ubiquitin specific protease 20
            (predicted) (Usp20_predicted), mRNA
          Length = 5067

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 369  tcactggaatcggagtcccgagca 392
            ||||||||||| ||||||||||||
Sbjct: 1052 tcactggaatctgagtcccgagca 1029

>gb|AC153911.5| Mus musculus 10 BAC RP23-182J19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 219859

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 451   ggcccctgggcagagcagct 470
             ||||||||||||||||||||
Sbjct: 97431 ggcccctgggcagagcagct 97450

>ref|XM_315016.2| Anopheles gambiae str. PEST ENSANGP00000022258
           (ENSANGG00000019769), mRNA
          Length = 820

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 190 ggtgatggaaccaccgggaa 209
           ||||||||||||||||||||
Sbjct: 501 ggtgatggaaccaccgggaa 482

>emb|AL110479.1|CEY105C5B Caenorhabditis elegans YAC Y105C5B, complete sequence
          Length = 321304

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 298    attgtgagatcacatagtgaaaat 321
              |||||||||||| |||||||||||
Sbjct: 235302 attgtgagatcaaatagtgaaaat 235279

>gb|AC153021.2| Mus musculus 10 BAC RP23-37G3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 187132

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 451   ggcccctgggcagagcagct 470
             ||||||||||||||||||||
Sbjct: 15151 ggcccctgggcagagcagct 15132


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,249,352
Number of Sequences: 3902068
Number of extensions: 4249352
Number of successful extensions: 70446
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70364
Number of HSP's gapped (non-prelim): 82
length of query: 535
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 512
effective length of database: 17,143,297,704
effective search space: 8777368424448
effective search space used: 8777368424448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)