ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd21m22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE009322.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.15
2gb|AE008292.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.15
3gb|AF453665.1| Hordeum vulgare isolate HV Sukkula retrotransposo... 42 2.3
4gb|AY054377.1| Hordeum vulgare clone LTR-INS1 Sukkula retrotrans... 42 2.3
5emb|AL359986.15| Human DNA sequence from clone RP11-106M14 on ch... 42 2.3
6ref|XM_365100.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 9.2
7gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome ... 40 9.2
8gb|AC005483.1| Homo sapiens PAC clone RP4-806A17 from 7, complet... 40 9.2
9gb|AC122243.3| Mus musculus BAC clone RP23-148C10 from chromosom... 40 9.2
10gb|AC134570.5| Mus musculus BAC clone RP24-252B18 from chromosom... 40 9.2
11gb|AC129017.4| Mus musculus BAC clone RP24-414A24 from chromosom... 40 9.2
12gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosom... 40 9.2
13gb|AC122802.2| Mus musculus BAC clone RP24-136N24 from 6, comple... 40 9.2
14gb|BC105425.1| Bos taurus similar to ATPase, H+ transporting, V0... 40 9.2
15emb|AL080278.7|HSDJ691N7 Human DNA sequence from clone RP4-691N7... 40 9.2
16emb|X06552.1|XLRPL1AG X.laevis gene for ribosomal protein L1a 40 9.2
17gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, ... 40 9.2
18gb|AF454824.1| Enterococcus faecalis pathogenicity island, compl... 40 9.2
19gb|AY032999.1| Enterococcus faecalis putative pathogenicity isla... 40 9.2
20dbj|AK044398.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 9.2
21gb|AC134622.3| Mus musculus BAC clone RP23-13I7 from 6, complete... 40 9.2
22gb|AE016830.1| Enterococcus faecalis V583, complete genome 40 9.2
23gb|AC167818.4| Mus musculus BAC clone RP23-120O24 from chromosom... 40 9.2
24gb|AF034411.1|AF034411 Lycopersicon esculentum cytosolic Cu,Zn s... 40 9.2
25gb|AC165360.3| Mus musculus BAC clone RP23-110L20 from chromosom... 40 9.2
26gb|AC134604.5| Mus musculus BAC clone RP23-296I5 from 12, comple... 40 9.2
27gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 40 9.2
28emb|AL671335.12| Mouse DNA sequence from clone RP23-130J1 on chr... 40 9.2
29emb|AL671011.9| Mouse DNA sequence from clone RP23-95O23 on chro... 40 9.2

>gb|AE009322.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 92 of
            187 of the complete sequence
          Length = 12635

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 302  aagggcaacatggtcgtttccat 324
            |||||||||||||||||||||||
Sbjct: 1364 aagggcaacatggtcgtttccat 1386



to top

>gb|AE008292.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 96 of 187
             of the complete sequence
          Length = 13095

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 302   aagggcaacatggtcgtttccat 324
             |||||||||||||||||||||||
Sbjct: 11733 aagggcaacatggtcgtttccat 11711



to top

>gb|AF453665.1| Hordeum vulgare isolate HV Sukkula retrotransposon, partial sequence
          Length = 7674

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 14   atggaaaagaattacaaggat 34
            |||||||||||||||||||||
Sbjct: 5705 atggaaaagaattacaaggat 5685



to top

>gb|AY054377.1| Hordeum vulgare clone LTR-INS1 Sukkula retrotransposon long terminal
            repeat, complete sequence
          Length = 7575

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 14   atggaaaagaattacaaggat 34
            |||||||||||||||||||||
Sbjct: 5717 atggaaaagaattacaaggat 5697



to top

>emb|AL359986.15| Human DNA sequence from clone RP11-106M14 on chromosome 10 Contains the
              PPP1R3C gene for protein phosphatase 1 regulatory
              (inhibitor) subunit 3C, a glyceraldehyde-3-phosphate
              dehydrogenase (GAPD) pseudogene and a CpG island, complete
              sequence
          Length = 173119

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 3      tttttattactatggaaaaga 23
              |||||||||||||||||||||
Sbjct: 111455 tttttattactatggaaaaga 111435



to top

>ref|XM_365100.1| Magnaporthe grisea 70-15 hypothetical protein (MG09945.4) partial
           mRNA
          Length = 1428

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 314 gtcgtttccattgtgatatc 333
           ||||||||||||||||||||
Sbjct: 920 gtcgtttccattgtgatatc 901



to top

>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence
          Length = 185361

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ctttttattactatggaaaa 21
             ||||||||||||||||||||
Sbjct: 64470 ctttttattactatggaaaa 64489



to top

>gb|AC005483.1| Homo sapiens PAC clone RP4-806A17 from 7, complete sequence
          Length = 161667

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      tttattactatggaaaagaa 24
              ||||||||||||||||||||
Sbjct: 144410 tttattactatggaaaagaa 144391



to top

>gb|AC122243.3| Mus musculus BAC clone RP23-148C10 from chromosome 17, complete sequence
          Length = 204584

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 319    ttccattgtgatatcacatg 338
              ||||||||||||||||||||
Sbjct: 101405 ttccattgtgatatcacatg 101424



to top

>gb|AC134570.5| Mus musculus BAC clone RP24-252B18 from chromosome 18, complete
             sequence
          Length = 183551

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 498   ggaaaagaacaaagtgcact 517
             ||||||||||||||||||||
Sbjct: 88252 ggaaaagaacaaagtgcact 88233



to top

>gb|AC129017.4| Mus musculus BAC clone RP24-414A24 from chromosome 15, complete sequence
          Length = 153547

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 404    cagagttatagataaaaaga 423
              ||||||||||||||||||||
Sbjct: 140891 cagagttatagataaaaaga 140910



to top

>gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosome 19, complete sequence
          Length = 175796

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 398    tggaatcagagttatagata 417
              ||||||||||||||||||||
Sbjct: 124801 tggaatcagagttatagata 124820



to top

>gb|AC122802.2| Mus musculus BAC clone RP24-136N24 from 6, complete sequence
          Length = 185938

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      tttttattactatggaaaagaatt 26
              ||||| ||||||||||||||||||
Sbjct: 175554 ttttttttactatggaaaagaatt 175531



to top

>gb|BC105425.1| Bos taurus similar to ATPase, H+ transporting, V0 subunit D isoform
           2, mRNA (cDNA clone MGC:128740 IMAGE:7988206), complete
           cds
          Length = 2040

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 553 cgaggggcgcgcgggaccggaggg 576
           ||||||||||||||| ||||||||
Sbjct: 91  cgaggggcgcgcgggtccggaggg 68



to top

>emb|AL080278.7|HSDJ691N7 Human DNA sequence from clone RP4-691N7 on chromosome 1p31.2-32.3
             Contains ESTs, CA repeat (D1S2665), STSs and GSSs,
             complete sequence
          Length = 104513

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   acctgcaaactgggatgatg 220
             ||||||||||||||||||||
Sbjct: 54562 acctgcaaactgggatgatg 54581



to top

>emb|X06552.1|XLRPL1AG X.laevis gene for ribosomal protein L1a
          Length = 6957

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 249 ctcagaaggaattgccggaaatag 272
           ||||||| ||||||||||||||||
Sbjct: 240 ctcagaacgaattgccggaaatag 217



to top

>gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, RP23-49P8 Complete
              Sequence, complete sequence
          Length = 220143

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 398    tggaatcagagttatagata 417
              ||||||||||||||||||||
Sbjct: 105186 tggaatcagagttatagata 105167



to top

>gb|AF454824.1| Enterococcus faecalis pathogenicity island, complete sequence
          Length = 153571

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ctttttattactatggaaaa 21
             ||||||||||||||||||||
Sbjct: 64245 ctttttattactatggaaaa 64264



to top

>gb|AY032999.1| Enterococcus faecalis putative pathogenicity island, partial sequence
          Length = 30711

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ctttttattactatggaaaa 21
             ||||||||||||||||||||
Sbjct: 27831 ctttttattactatggaaaa 27850



to top

>dbj|AK044398.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
            clone:A930010M14 product:U4/U6 SNRNP-ASSOCIATED 61 KDA
            PROTEIN homolog [Homo sapiens], full insert sequence
          Length = 2701

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 398  tggaatcagagttatagata 417
            ||||||||||||||||||||
Sbjct: 2076 tggaatcagagttatagata 2095



to top

>gb|AC134622.3| Mus musculus BAC clone RP23-13I7 from 6, complete sequence
          Length = 203072

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      tttttattactatggaaaagaatt 26
              ||||| ||||||||||||||||||
Sbjct: 192373 ttttttttactatggaaaagaatt 192396



to top

>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ctttttattactatggaaaa 21
              ||||||||||||||||||||
Sbjct: 492174 ctttttattactatggaaaa 492193



to top

>gb|AC167818.4| Mus musculus BAC clone RP23-120O24 from chromosome 15, complete sequence
          Length = 203474

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 404    cagagttatagataaaaaga 423
              ||||||||||||||||||||
Sbjct: 161139 cagagttatagataaaaaga 161120



to top

>gb|AF034411.1|AF034411 Lycopersicon esculentum cytosolic Cu,Zn superoxide dismutase (Sod)
             gene, partial cds; and dehydroquinate
             dehydratase/shikimate:NADP oxidoreductase gene, complete
             cds
          Length = 20445

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 400   gaatcagagttatagataaaaagatatt 427
             ||||||||||||| ||||| ||||||||
Sbjct: 12771 gaatcagagttattgataagaagatatt 12798



to top

>gb|AC165360.3| Mus musculus BAC clone RP23-110L20 from chromosome 17, complete sequence
          Length = 217732

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 319    ttccattgtgatatcacatg 338
              ||||||||||||||||||||
Sbjct: 216867 ttccattgtgatatcacatg 216848



to top

>gb|AC134604.5| Mus musculus BAC clone RP23-296I5 from 12, complete sequence
          Length = 203284

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 462   tttatttgcaactgagtcct 481
             ||||||||||||||||||||
Sbjct: 92339 tttatttgcaactgagtcct 92320



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
            mRNA, nuclear gene encoding chloroplast protein, complete
            cds
          Length = 1042

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   aattacaaggatacatgaat 42
            ||||||||||||||||||||
Sbjct: 1001 aattacaaggatacatgaat 982



to top

>emb|AL671335.12| Mouse DNA sequence from clone RP23-130J1 on chromosome X, complete
             sequence
          Length = 175336

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 383   gggctttggaatcactggaatcagagtt 410
             |||||||||| || ||||||||||||||
Sbjct: 31082 gggctttggattccctggaatcagagtt 31055



to top

>emb|AL671011.9| Mouse DNA sequence from clone RP23-95O23 on chromosome 4, complete
              sequence
          Length = 226950

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    ctctcggaggagggctgttt 296
              ||||||||||||||||||||
Sbjct: 167861 ctctcggaggagggctgttt 167842


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,101,860
Number of Sequences: 3902068
Number of extensions: 7101860
Number of successful extensions: 113962
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113870
Number of HSP's gapped (non-prelim): 92
length of query: 672
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 649
effective length of database: 17,143,297,704
effective search space: 11126000209896
effective search space used: 11126000209896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top