>ref|XM_466163.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2619

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 32   atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
            ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 2279 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 2220

              
Query: 92   cc 93
            ||
Sbjct: 2219 cc 2218

>emb|AJ428900.1|OSA428900 Oryza sativa partial mRNA for putative Myb-family transcription
            factor (myb-L1 gene)
          Length = 2201

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 32   atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
            ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 2008 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 1949

              
Query: 92   cc 93
            ||
Sbjct: 1948 cc 1947

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 32       atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
                ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 20783133 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 20783192

                  
Query: 92       cc 93
                ||
Sbjct: 20783193 cc 20783194

>dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0451A10
          Length = 137046

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                          
Query: 32     atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
              ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 134239 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 134298

                
Query: 92     cc 93
              ||
Sbjct: 134299 cc 134300

>dbj|AP004038.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1004_H01
          Length = 121377

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 32    atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
             ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 25594 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 25653

               
Query: 92    cc 93
             ||
Sbjct: 25654 cc 25655

>dbj|AK068448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013152C15, full
            insert sequence
          Length = 2619

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 32   atttaccatgttcacctggctattggctggcaggtggattccccttgctagccccattca 91
            ||||||||||||   ||||||  |||||||| ||||||||| ||||||||||||| ||||
Sbjct: 2279 atttaccatgttaggctggcttctggctggctggtggattcaccttgctagccccgttca 2220

              
Query: 92   cc 93
            ||
Sbjct: 2219 cc 2218

>emb|AJ234413.1|HVU234413 Hordeum vulgare partial mRNA; clone cMWG0669.rev
          Length = 229

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 20  cattattacagcatttaccatgtt 43
           ||||||||||||||||||||||||
Sbjct: 178 cattattacagcatttaccatgtt 201

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2307977 gcgactggcagctgatgttc 2307996

>ref|XM_415426.1| PREDICTED: Gallus gallus similar to Retinoic acid receptor RXR-alpha
            (LOC417143), mRNA
          Length = 5037

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 221  tgactggtggtgttgcagtgccgg 244
            ||||||||||||||||| ||||||
Sbjct: 1491 tgactggtggtgttgcaatgccgg 1514

>gb|AF540491.1| Escherichia coli plasmid pColHu194 colicin operon, complete sequence
          Length = 3298

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  gtgttccggcaccaggagct 420
            ||||||||||||||||||||
Sbjct: 1004 gtgttccggcaccaggagct 985

>gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosome 7, complete sequence
          Length = 195987

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    gagttcctggctggtggtgt 269
              ||||||||||||||||||||
Sbjct: 110680 gagttcctggctggtggtgt 110661

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2282795 gcgactggcagctgatgttc 2282814

>emb|AL135790.7| Human DNA sequence from clone RP11-87N24 on chromosome 9p22.1-23
             Contains a ribosomal protein S12 (RPS12) pseudogene, 2
             novel genes, the 5' end of a variant of the PTPRD gene for
             protein tyrosine phosphatase, receptor type, D (HPTP,
             PTPD, HPTPD). and a CpG island, complete sequence
          Length = 176273

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    ttattacagcatttaccatg 41
             ||||||||||||||||||||
Sbjct: 81699 ttattacagcatttaccatg 81718

>ref|NM_009259.4| Mus musculus sialophorin (Spn), transcript variant 1, mRNA
          Length = 3741

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 250  gagttcctggctggtggtgt 269
            ||||||||||||||||||||
Sbjct: 1828 gagttcctggctggtggtgt 1847

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2288107 gcgactggcagctgatgttc 2288126

>dbj|AK134098.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830435O17 product:sialophorin, full
            insert sequence
          Length = 3629

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 250  gagttcctggctggtggtgt 269
            ||||||||||||||||||||
Sbjct: 1829 gagttcctggctggtggtgt 1848

>gb|S70677.1| CD43 Lp-3 antigen=B cell differentiation antigen [mice, MRL-lpr/lpr,
            mRNA, 2718 nt]
          Length = 2718

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 250  gagttcctggctggtggtgt 269
            ||||||||||||||||||||
Sbjct: 1726 gagttcctggctggtggtgt 1745

>dbj|AK077764.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830403K23 product:sialophorin, full
            insert sequence
          Length = 3730

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 250  gagttcctggctggtggtgt 269
            ||||||||||||||||||||
Sbjct: 1825 gagttcctggctggtggtgt 1844

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2287430 gcgactggcagctgatgttc 2287449

>emb|AJ330646.1|HSA330646 Homo sapiens genomic sequence surrounding NotI site, clone NB1-889S
          Length = 787

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 108 gcgactggcagctgatgttc 127
           ||||||||||||||||||||
Sbjct: 105 gcgactggcagctgatgttc 86

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 3090972 gcgactggcagctgatgttc 3090991

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 3019703 gcgactggcagctgatgttc 3019722

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    gcgactggcagctgatgttc 127
              ||||||||||||||||||||
Sbjct: 839537 gcgactggcagctgatgttc 839518

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2110250 gcgactggcagctgatgttc 2110231

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcgactggcagctgatgttc 127
               ||||||||||||||||||||
Sbjct: 2357501 gcgactggcagctgatgttc 2357520

>gb|U00008.1|ECOHU49 centisome 49 region of E.coli K12 BHB2600
          Length = 39149

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   gcgactggcagctgatgttc 127
             ||||||||||||||||||||
Sbjct: 11826 gcgactggcagctgatgttc 11845


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,701,463
Number of Sequences: 3902068
Number of extensions: 3701463
Number of successful extensions: 56815
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56549
Number of HSP's gapped (non-prelim): 266
length of query: 555
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 532
effective length of database: 17,143,297,704
effective search space: 9120234378528
effective search space used: 9120234378528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)