Clone Name | rbasd21m10 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_476904.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1565 Score = 135 bits (68), Expect = 2e-28 Identities = 190/230 (82%), Gaps = 3/230 (1%) Strand = Plus / Minus Query: 420 gaaccagcaatgcatgtcttggtggtcacccgagccatgatggcactgtgtgacagtatg 479 |||| |||||| ||||||||||||| || |||||||||||||||||| | || || || Sbjct: 994 gaactagcaatagatgtcttggtggttactcgagccatgatggcactgcgagagagggtg 935 Query: 480 tgttctgattttctcattagctgatatgctctaaagccggactgcagctttttaacagca 539 | |||| | ||||||| |||| ||||||||||| |||||||| | ||| || |||||| Sbjct: 934 ttctctgtgtctctcatttgctggtatgctctaaatccggactggaacttctttacagca 875 Query: 540 ccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatgtcctca 599 ||||||||||| || |||||||| || || || ||||| || || |||||||||||||| Sbjct: 874 ccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatgtcctcg 815 Query: 600 tagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| | ||| |||||||||||||| || |||||| ||||||||||| Sbjct: 814 tagtggaccagcgttacttcacatgc---ggattgctgtccatcttgttt 768 Score = 73.8 bits (37), Expect = 6e-10 Identities = 96/115 (83%), Gaps = 3/115 (2%) Strand = Plus / Minus Query: 222 cacttctttgcctgccttcttg---cagctccaagtaagagggccttccctacaattccg 278 |||||||| ||||||||||||| ||||||| | | ||| |||||||| |||| || Sbjct: 1195 cacttcttcgcctgccttcttgatgcagctccgatgaggagagccttcccaacaagccca 1136 Query: 279 gtgttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 ||||| ||||||||||| |||||||||| || ||||| ||||||||| ||||||| Sbjct: 1135 gtgttgagcacgcagacggcagccactgcgccaccgaacaccacccatttccagt 1081
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 135 bits (68), Expect = 2e-28 Identities = 190/230 (82%), Gaps = 3/230 (1%) Strand = Plus / Plus Query: 420 gaaccagcaatgcatgtcttggtggtcacccgagccatgatggcactgtgtgacagtatg 479 |||| |||||| ||||||||||||| || |||||||||||||||||| | || || || Sbjct: 4536094 gaactagcaatagatgtcttggtggttactcgagccatgatggcactgcgagagagggtg 4536153 Query: 480 tgttctgattttctcattagctgatatgctctaaagccggactgcagctttttaacagca 539 | |||| | ||||||| |||| ||||||||||| |||||||| | ||| || |||||| Sbjct: 4536154 ttctctgtgtctctcatttgctggtatgctctaaatccggactggaacttctttacagca 4536213 Query: 540 ccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatgtcctca 599 ||||||||||| || |||||||| || || || ||||| || || |||||||||||||| Sbjct: 4536214 ccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatgtcctcg 4536273 Query: 600 tagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| | ||| |||||||||||||| || |||||| ||||||||||| Sbjct: 4536274 tagtggaccagcgttacttcacatgc---ggattgctgtccatcttgttt 4536320 Score = 73.8 bits (37), Expect = 6e-10 Identities = 96/115 (83%), Gaps = 3/115 (2%) Strand = Plus / Plus Query: 222 cacttctttgcctgccttcttg---cagctccaagtaagagggccttccctacaattccg 278 |||||||| ||||||||||||| ||||||| | | ||| |||||||| |||| || Sbjct: 4535893 cacttcttcgcctgccttcttgatgcagctccgatgaggagagccttcccaacaagccca 4535952 Query: 279 gtgttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 ||||| ||||||||||| |||||||||| || ||||| ||||||||| ||||||| Sbjct: 4535953 gtgttgagcacgcagacggcagccactgcgccaccgaacaccacccatttccagt 4536007
>dbj|AP003861.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1046_F10 Length = 118472 Score = 135 bits (68), Expect = 2e-28 Identities = 190/230 (82%), Gaps = 3/230 (1%) Strand = Plus / Plus Query: 420 gaaccagcaatgcatgtcttggtggtcacccgagccatgatggcactgtgtgacagtatg 479 |||| |||||| ||||||||||||| || |||||||||||||||||| | || || || Sbjct: 114813 gaactagcaatagatgtcttggtggttactcgagccatgatggcactgcgagagagggtg 114872 Query: 480 tgttctgattttctcattagctgatatgctctaaagccggactgcagctttttaacagca 539 | |||| | ||||||| |||| ||||||||||| |||||||| | ||| || |||||| Sbjct: 114873 ttctctgtgtctctcatttgctggtatgctctaaatccggactggaacttctttacagca 114932 Query: 540 ccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatgtcctca 599 ||||||||||| || |||||||| || || || ||||| || || |||||||||||||| Sbjct: 114933 ccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatgtcctcg 114992 Query: 600 tagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| | ||| |||||||||||||| || |||||| ||||||||||| Sbjct: 114993 tagtggaccagcgttacttcacatgc---ggattgctgtccatcttgttt 115039 Score = 73.8 bits (37), Expect = 6e-10 Identities = 96/115 (83%), Gaps = 3/115 (2%) Strand = Plus / Plus Query: 222 cacttctttgcctgccttcttg---cagctccaagtaagagggccttccctacaattccg 278 |||||||| ||||||||||||| ||||||| | | ||| |||||||| |||| || Sbjct: 114612 cacttcttcgcctgccttcttgatgcagctccgatgaggagagccttcccaacaagccca 114671 Query: 279 gtgttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 ||||| ||||||||||| |||||||||| || ||||| ||||||||| ||||||| Sbjct: 114672 gtgttgagcacgcagacggcagccactgcgccaccgaacaccacccatttccagt 114726
>dbj|AP003753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1339_B08 Length = 119212 Score = 135 bits (68), Expect = 2e-28 Identities = 190/230 (82%), Gaps = 3/230 (1%) Strand = Plus / Plus Query: 420 gaaccagcaatgcatgtcttggtggtcacccgagccatgatggcactgtgtgacagtatg 479 |||| |||||| ||||||||||||| || |||||||||||||||||| | || || || Sbjct: 1434 gaactagcaatagatgtcttggtggttactcgagccatgatggcactgcgagagagggtg 1493 Query: 480 tgttctgattttctcattagctgatatgctctaaagccggactgcagctttttaacagca 539 | |||| | ||||||| |||| ||||||||||| |||||||| | ||| || |||||| Sbjct: 1494 ttctctgtgtctctcatttgctggtatgctctaaatccggactggaacttctttacagca 1553 Query: 540 ccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatgtcctca 599 ||||||||||| || |||||||| || || || ||||| || || |||||||||||||| Sbjct: 1554 ccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatgtcctcg 1613 Query: 600 tagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| | ||| |||||||||||||| || |||||| ||||||||||| Sbjct: 1614 tagtggaccagcgttacttcacatgc---ggattgctgtccatcttgttt 1660 Score = 73.8 bits (37), Expect = 6e-10 Identities = 96/115 (83%), Gaps = 3/115 (2%) Strand = Plus / Plus Query: 222 cacttctttgcctgccttcttg---cagctccaagtaagagggccttccctacaattccg 278 |||||||| ||||||||||||| ||||||| | | ||| |||||||| |||| || Sbjct: 1233 cacttcttcgcctgccttcttgatgcagctccgatgaggagagccttcccaacaagccca 1292 Query: 279 gtgttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 ||||| ||||||||||| |||||||||| || ||||| ||||||||| ||||||| Sbjct: 1293 gtgttgagcacgcagacggcagccactgcgccaccgaacaccacccatttccagt 1347
>dbj|AK066157.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059B01, full insert sequence Length = 1650 Score = 135 bits (68), Expect = 2e-28 Identities = 190/230 (82%), Gaps = 3/230 (1%) Strand = Plus / Minus Query: 420 gaaccagcaatgcatgtcttggtggtcacccgagccatgatggcactgtgtgacagtatg 479 |||| |||||| ||||||||||||| || |||||||||||||||||| | || || || Sbjct: 1079 gaactagcaatagatgtcttggtggttactcgagccatgatggcactgcgagagagggtg 1020 Query: 480 tgttctgattttctcattagctgatatgctctaaagccggactgcagctttttaacagca 539 | |||| | ||||||| |||| ||||||||||| |||||||| | ||| || |||||| Sbjct: 1019 ttctctgtgtctctcatttgctggtatgctctaaatccggactggaacttctttacagca 960 Query: 540 ccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatgtcctca 599 ||||||||||| || |||||||| || || || ||||| || || |||||||||||||| Sbjct: 959 ccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatgtcctcg 900 Query: 600 tagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| | ||| |||||||||||||| || |||||| ||||||||||| Sbjct: 899 tagtggaccagcgttacttcacatgc---ggattgctgtccatcttgttt 853 Score = 73.8 bits (37), Expect = 6e-10 Identities = 96/115 (83%), Gaps = 3/115 (2%) Strand = Plus / Minus Query: 222 cacttctttgcctgccttcttg---cagctccaagtaagagggccttccctacaattccg 278 |||||||| ||||||||||||| ||||||| | | ||| |||||||| |||| || Sbjct: 1280 cacttcttcgcctgccttcttgatgcagctccgatgaggagagccttcccaacaagccca 1221 Query: 279 gtgttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 ||||| ||||||||||| |||||||||| || ||||| ||||||||| ||||||| Sbjct: 1220 gtgttgagcacgcagacggcagccactgcgccaccgaacaccacccatttccagt 1166
>gb|BT024104.1| Zea mays clone EL01N0520G08 mRNA sequence Length = 1769 Score = 113 bits (57), Expect = 7e-22 Identities = 150/181 (82%) Strand = Plus / Minus Query: 439 tggtggtcacccgagccatgatggcactgtgtgacagtatgtgttctgattttctcatta 498 ||||||||| |||||||| ||||| ||||||||||| | | ||||| | ||||||| Sbjct: 1225 tggtggtcattcgagccataatggcgctgtgtgacagggtattttctgtgtctctcattt 1166 Query: 499 gctgatatgctctaaagccggactgcagctttttaacagcaccccacatgccgtggcgga 558 |||| || ||||| || || ||||| || || || ||||||||||||||||||||||| | Sbjct: 1165 gctggtacgctctgaacccagactgaagtttcttcacagcaccccacatgccgtggcgaa 1106 Query: 559 caccaactttagcaacatccttcggtatgcccatgtcctcatagtgaaacagagttactt 618 || |||| | || ||||| || ||||||||||||||||||||||||| || |||||||| Sbjct: 1105 cagcaaccctggctacatcttttggtatgcccatgtcctcatagtgaaccaaagttactt 1046 Query: 619 c 619 | Sbjct: 1045 c 1045 Score = 71.9 bits (36), Expect = 3e-09 Identities = 93/112 (83%) Strand = Plus / Minus Query: 222 cacttctttgcctgccttcttgcagctccaagtaagagggccttccctacaattccggtg 281 |||||||||||||||||||| || |||||||| || ||| |||| ||||| | ||||||| Sbjct: 1442 cacttctttgcctgccttctcgctgctccaagcaacaggaccttgcctaccaatccggtg 1383 Query: 282 ttaagcacgcagactgcagccactgtgctaccgaccaccacccacttccagt 333 || ||||| || || |||||||| | | ||| | ||||||||| ||||||| Sbjct: 1382 ttgagcacacaaaccgcagccaccgcaccaccaaacaccacccatttccagt 1331
>gb|AY105898.1| Zea mays PCO133189 mRNA sequence Length = 681 Score = 105 bits (53), Expect = 2e-19 Identities = 149/181 (82%) Strand = Plus / Minus Query: 439 tggtggtcacccgagccatgatggcactgtgtgacagtatgtgttctgattttctcatta 498 ||||||||| |||||||| ||||| ||||||||||| | | ||||| | ||||||| Sbjct: 671 tggtggtcattcgagccataatggcgctgtgtgacagggtattttctgtgtctctcattt 612 Query: 499 gctgatatgctctaaagccggactgcagctttttaacagcaccccacatgccgtggcgga 558 |||| || ||||| || || ||||| || || || ||||||||||||||||||||||| | Sbjct: 611 gctggtacgctctgaacccagactgaagtttcttcacagcaccccacatgccgtggcgaa 552 Query: 559 caccaactttagcaacatccttcggtatgcccatgtcctcatagtgaaacagagttactt 618 | |||| | || ||||| || ||||||||||||||||||||||||| || |||||||| Sbjct: 551 tagcaaccctggctacatcttttggtatgcccatgtcctcatagtgaaccaaagttactt 492 Query: 619 c 619 | Sbjct: 491 c 491
>dbj|AK060743.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-E03, full insert sequence Length = 1838 Score = 75.8 bits (38), Expect = 2e-10 Identities = 97/116 (83%), Gaps = 3/116 (2%) Strand = Plus / Minus Query: 534 acagcaccccacatgccgtggcggacaccaactttagcaacatccttcggtatgcccatg 593 ||||||||||||||||| || |||||||| || || || ||||| || || ||||||||| Sbjct: 1459 acagcaccccacatgccatgccggacacccaccttggcgacatctttagggatgcccatg 1400 Query: 594 tcctcatagtgaaacagagttacttcacatgccatgggttgctgcccatcttgttt 649 ||||| ||||| | ||| ||||| |||||||| || |||||| ||||||||||| Sbjct: 1399 tcctcgtagtggaccagcgttacctcacatgc---ggattgctgtccatcttgttt 1347
>gb|AC113547.27| Mus musculus chromosome 12, clone RP23-263J2, complete sequence Length = 197242 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 cttctttgcctgccttcttgc 244 ||||||||||||||||||||| Sbjct: 186161 cttctttgcctgccttcttgc 186141
>emb|AJ310150.1|LUS310150 Linum usitatissimum Ngc-D, Ngc-A and Ngc-B genes, cultivar Bombay Length = 25054 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 143 ggtctcgattgcaactttcta 163 ||||||||||||||||||||| Sbjct: 19938 ggtctcgattgcaactttcta 19958
>gb|AY377856.1| Brassica napus TOC33 (Toc33) gene, complete cds; nuclear gene for chloroplast product Length = 1376 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 tgatccaaggagccatcagaa 422 ||||||||||||||||||||| Sbjct: 1324 tgatccaaggagccatcagaa 1344
>emb|AL663054.9| Mouse DNA sequence from clone RP23-480G5 on chromosome 11 Contains the 5' end of the Myo1d gene for myosin ID, a novel gene and a mitochondrial ribosomal protein L27 (Mrpl27) pseudogene, complete sequence Length = 82452 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 atactgcttacaagacacaat 82 ||||||||||||||||||||| Sbjct: 21285 atactgcttacaagacacaat 21265
>dbj|AK082156.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230015M18 product:hypothetical protein, full insert sequence Length = 4401 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 cttctttgcctgccttcttgc 244 ||||||||||||||||||||| Sbjct: 1203 cttctttgcctgccttcttgc 1183
>emb|CT030030.12| Mouse DNA sequence from clone RP23-123J19 on chromosome 12, complete sequence Length = 201738 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 cttctttgcctgccttcttgc 244 ||||||||||||||||||||| Sbjct: 19840 cttctttgcctgccttcttgc 19820
>gb|AY657927.1| Synthetic construct Peudomonas aeruginosa clone FLH046013.01F PA3196 gene, partial cds Length = 531 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 gctaccgaccaccacccact 327 |||||||||||||||||||| Sbjct: 192 gctaccgaccaccacccact 173
>ref|XM_539971.2| PREDICTED: Canis familiaris similar to potassium large conductance pH-sensitive channel, subfamily M, alpha member 3 (LOC482856), mRNA Length = 4041 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 gagccatcagaaccagcaat 430 |||||||||||||||||||| Sbjct: 1235 gagccatcagaaccagcaat 1254
>gb|AC091768.4| Homo sapiens BAC clone RP11-703N5 from 7, complete sequence Length = 104955 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 466 tgtgtgacagtatgtgttctgattttct 493 ||||| |||||||||||| ||||||||| Sbjct: 71418 tgtgtaacagtatgtgttatgattttct 71391
>gb|AC151819.2| Xenopus tropicalis BAC clone ISB1-243M8 containing hairy2 gene, complete cds, complete sequence Length = 91756 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 623 tgccatgggttgctgcccat 642 |||||||||||||||||||| Sbjct: 3999 tgccatgggttgctgcccat 3980
>gb|AC023315.4| Homo sapiens chromosome 17, clone RP11-333J10, complete sequence Length = 135692 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 ggtatgaatctcattccttt 137 |||||||||||||||||||| Sbjct: 69375 ggtatgaatctcattccttt 69356
>dbj|AK085236.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched library, clone:D530032L01 product:unclassifiable, full insert sequence Length = 3200 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 150 tgcctgccttcttgcagctc 131
>dbj|AK085224.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched library, clone:D530024I09 product:unclassifiable, full insert sequence Length = 3199 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 150 tgcctgccttcttgcagctc 131
>dbj|AK081351.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130009G16 product:gap junction membrane channel protein alpha 7, full insert sequence Length = 3412 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 919 tgcctgccttcttgcagctc 900
>gb|AF283254.1|AF283254 Mus musculus gap junction protein connexin45 (Gja6) gene, partial cds Length = 4591 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 617 tgcctgccttcttgcagctc 598
>gb|AE004743.1| Pseudomonas aeruginosa PAO1, section 304 of 529 of the complete genome Length = 10146 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 gctaccgaccaccacccact 327 |||||||||||||||||||| Sbjct: 8777 gctaccgaccaccacccact 8796
>gb|AC154353.1| Mus musculus BAC clone RP24-547N14 from chromosome 12, complete sequence Length = 249825 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 487 attttctcattagctgatat 506 |||||||||||||||||||| Sbjct: 25257 attttctcattagctgatat 25238
>emb|BX255894.19| Zebrafish DNA sequence from clone CH211-251G8 in linkage group 19, complete sequence Length = 180950 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 326 cttccagttgaaaccatgtt 345 |||||||||||||||||||| Sbjct: 170004 cttccagttgaaaccatgtt 170023
>emb|AL929067.8| Mouse DNA sequence from clone RP24-69A20 on chromosome 11, complete sequence Length = 87925 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 61724 tgcctgccttcttgcagctc 61743
>emb|AL831778.8| Mouse DNA sequence from clone RP23-261L23 on chromosome 4, complete sequence Length = 213495 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 485 tgattttctcattagctgat 504 |||||||||||||||||||| Sbjct: 146473 tgattttctcattagctgat 146492
>emb|AJ300716.1|MMU300716 Mus musculus Cx45 gene for connexin 45, exons 1-3 Length = 8415 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 tgcctgccttcttgcagctc 249 |||||||||||||||||||| Sbjct: 923 tgcctgccttcttgcagctc 904 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,435,452 Number of Sequences: 3902068 Number of extensions: 5435452 Number of successful extensions: 91973 Number of sequences better than 10.0: 29 Number of HSP's better than 10.0 without gapping: 29 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 91889 Number of HSP's gapped (non-prelim): 70 length of query: 657 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 634 effective length of database: 17,143,297,704 effective search space: 10868850744336 effective search space used: 10868850744336 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)