ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd21j24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, comp... 46 0.078
2gb|AY543070.1| Bacteriophage T5, complete genome 46 0.078
3gb|AY303686.1| Bacteriophage T5 T5st(H) pore-forming tail tip pr... 46 0.078
4gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete g... 46 0.078
5gb|AC140947.1| Gallus gallus BAC clone TAM33-40B24 from chromoso... 44 0.31
6gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete se... 42 1.2
7dbj|AK141880.1| Mus musculus 12 days embryo spinal ganglion cDNA... 42 1.2
8gb|AC152401.6| Mus musculus chromosome 3, clone RP23-287A2, comp... 42 1.2
9gb|AC155223.4| Monodelphis domestica clone VMRC6-24O12, complete... 42 1.2
10gb|AC053523.5| Homo sapiens BAC clone RP11-563J6 from 2, complet... 42 1.2
11gb|AC155797.3| Monodelphis domestica clone VMRC6-342C14, complet... 42 1.2
12gb|AC122183.4| Mus musculus BAC clone RP23-14P23 from 3, complet... 42 1.2
13gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 42 1.2
14gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome... 40 4.8
15gb|AC117221.3| Mus musculus BAC clone RP23-347F2 from 1, complet... 40 4.8
16ref|XM_668751.1| Plasmodium berghei strain ANKA hypothetical pro... 40 4.8
17ref|XM_673552.1| Plasmodium berghei strain ANKA hypothetical pro... 40 4.8
18gb|AC163242.3| Callicebus moloch clone LB5-73P23, complete sequence 40 4.8
19emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6... 40 4.8
20emb|AL035078.32|HS17K7 Human DNA sequence from clone RP1-17K7 on... 40 4.8
21emb|AL138654.1|ATF18P9 Arabidopsis thaliana DNA chromosome 3, BA... 40 4.8
22gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete s... 40 4.8
23emb|AJ549806.1|PUN549806 Physcia undulata partial 18S rRNA gene,... 40 4.8
24gb|AC149210.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 40 4.8
25gb|AC107068.3| Homo sapiens BAC clone RP11-121C2 from 4, complet... 40 4.8
26dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome 40 4.8
27gb|DP000019.1| Callicebus moloch target 1 genomic scaffold 40 4.8

>gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, complete genome
          Length = 113238

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 250   tatctttaactaatagttttata 272
             |||||||||||||||||||||||
Sbjct: 87775 tatctttaactaatagttttata 87753



to top

>gb|AY543070.1| Bacteriophage T5, complete genome
          Length = 121750

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 250   tatctttaactaatagttttata 272
             |||||||||||||||||||||||
Sbjct: 95817 tatctttaactaatagttttata 95795



to top

>gb|AY303686.1| Bacteriophage T5 T5st(H) pore-forming tail tip protein pb2 (D18)
           gene, complete cds
          Length = 3844

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 250 tatctttaactaatagttttata 272
           |||||||||||||||||||||||
Sbjct: 91  tatctttaactaatagttttata 113



to top

>gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete genome
          Length = 121752

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 250   tatctttaactaatagttttata 272
             |||||||||||||||||||||||
Sbjct: 95899 tatctttaactaatagttttata 95877



to top

>gb|AC140947.1| Gallus gallus BAC clone TAM33-40B24 from chromosome ul, complete sequence
          Length = 229639

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 287    gtaaaatgaaattgttacaaat 308
              ||||||||||||||||||||||
Sbjct: 204033 gtaaaatgaaattgttacaaat 204054



to top

>gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete sequence
          Length = 124211

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    ttttactgatgtaaaatgaaattgt 301
              |||||||||| ||||||||||||||
Sbjct: 100390 ttttactgatataaaatgaaattgt 100366



to top

>dbj|AK141880.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130048N24
            product:unclassifiable, full insert sequence
          Length = 3510

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 232  aaaccaatattagtactttatctttaactaata 264
            |||||||||||| | ||||| ||||||||||||
Sbjct: 2837 aaaccaatattaatcctttaactttaactaata 2805



to top

>gb|AC152401.6| Mus musculus chromosome 3, clone RP23-287A2, complete sequence
          Length = 217151

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 232    aaaccaatattagtactttatctttaactaata 264
              |||||||||||| | ||||| ||||||||||||
Sbjct: 200943 aaaccaatattaatcctttaactttaactaata 200975



to top

>gb|AC155223.4| Monodelphis domestica clone VMRC6-24O12, complete sequence
          Length = 73778

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 279   ttactgatgtaaaatgaaatt 299
             |||||||||||||||||||||
Sbjct: 18610 ttactgatgtaaaatgaaatt 18590



to top

>gb|AC053523.5| Homo sapiens BAC clone RP11-563J6 from 2, complete sequence
          Length = 172405

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 21    attttggaagcaaaatgtgaa 41
             |||||||||||||||||||||
Sbjct: 62455 attttggaagcaaaatgtgaa 62435



to top

>gb|AC155797.3| Monodelphis domestica clone VMRC6-342C14, complete sequence
          Length = 34952

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 279   ttactgatgtaaaatgaaatt 299
             |||||||||||||||||||||
Sbjct: 31667 ttactgatgtaaaatgaaatt 31647



to top

>gb|AC122183.4| Mus musculus BAC clone RP23-14P23 from 3, complete sequence
          Length = 210223

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 232   aaaccaatattagtactttatctttaactaata 264
             |||||||||||| | ||||| ||||||||||||
Sbjct: 33287 aaaccaatattaatcctttaactttaactaata 33319



to top

>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 279     ttactgatgtaaaatgaaatt 299
               |||||||||||||||||||||
Sbjct: 1202200 ttactgatgtaaaatgaaatt 1202180



to top

>gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome 1, complete sequence
          Length = 179626

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   ttttactgatgtaaaatgaa 296
             ||||||||||||||||||||
Sbjct: 74685 ttttactgatgtaaaatgaa 74666



to top

>gb|AC117221.3| Mus musculus BAC clone RP23-347F2 from 1, complete sequence
          Length = 194077

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    ttttactgatgtaaaatgaa 296
              ||||||||||||||||||||
Sbjct: 177170 ttttactgatgtaaaatgaa 177151



to top

>ref|XM_668751.1| Plasmodium berghei strain ANKA hypothetical protein (PB300636.00.0)
            partial mRNA
          Length = 1524

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 283  tgatgtaaaatgaaattgtt 302
            ||||||||||||||||||||
Sbjct: 1357 tgatgtaaaatgaaattgtt 1338



to top

>ref|XM_673552.1| Plasmodium berghei strain ANKA hypothetical protein (PB000084.00.0)
            partial mRNA
          Length = 3399

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 283  tgatgtaaaatgaaattgtt 302
            ||||||||||||||||||||
Sbjct: 3052 tgatgtaaaatgaaattgtt 3033



to top

>gb|AC163242.3| Callicebus moloch clone LB5-73P23, complete sequence
          Length = 101102

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 18   tgtattttggaagcaaaatg 37
            ||||||||||||||||||||
Sbjct: 9267 tgtattttggaagcaaaatg 9248



to top

>emb|AL109657.8|HSDJ842G6 Human DNA sequence from clone RP5-842G6 on chromosome 20 Contains the
             3' end of the C20orf7 gene for chromosome 20 open reading
             frame 7 (FLJ22324) and the 3' end of the C20orf50 gene for
             chromosome 20 open reading frame 50 (dJ631M13.1, similar
             to SEL1L (DKFZp434C1826)), complete sequence
          Length = 100272

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   ggatgtgaaaatataaatca 347
             ||||||||||||||||||||
Sbjct: 39801 ggatgtgaaaatataaatca 39782



to top

>emb|AL035078.32|HS17K7 Human DNA sequence from clone RP1-17K7 on chromosome 11p13, complete
             sequence
          Length = 130336

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    tattttggaagcaaaatgtg 39
             ||||||||||||||||||||
Sbjct: 75585 tattttggaagcaaaatgtg 75566



to top

>emb|AL138654.1|ATF18P9 Arabidopsis thaliana DNA chromosome 3, BAC clone F18P9
          Length = 95996

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 239   tattagtactttatctttaa 258
             ||||||||||||||||||||
Sbjct: 86864 tattagtactttatctttaa 86883



to top

>gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete sequence
          Length = 113689

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 281   actgatgtaaaatgaaattgttac 304
             |||||||||| |||||||||||||
Sbjct: 95899 actgatgtaacatgaaattgttac 95922



to top

>emb|AJ549806.1|PUN549806 Physcia undulata partial 18S rRNA gene, exons 1-12
          Length = 3538

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 278  tttactgatgtaaaatgaaa 297
            ||||||||||||||||||||
Sbjct: 1951 tttactgatgtaaaatgaaa 1932



to top

>gb|AC149210.2| Medicago truncatula chromosome 2 BAC clone mth2-38k7, complete sequence
          Length = 49473

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 281   actgatgtaaaatgaaattgttac 304
             |||||||||| |||||||||||||
Sbjct: 35080 actgatgtaacatgaaattgttac 35057



to top

>gb|AC107068.3| Homo sapiens BAC clone RP11-121C2 from 4, complete sequence
          Length = 181804

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 231   gaaaccaatattagtactttatctttaactaa 262
             |||||||||||| |||||||||| ||| ||||
Sbjct: 80868 gaaaccaatattggtactttatcattagctaa 80837



to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 51      tccaattatggttatctgaa 70
               ||||||||||||||||||||
Sbjct: 3480680 tccaattatggttatctgaa 3480699



to top

>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     tgtattttggaagcaaaatg 37
              ||||||||||||||||||||
Sbjct: 825521 tgtattttggaagcaaaatg 825502


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,335,225
Number of Sequences: 3902068
Number of extensions: 3335225
Number of successful extensions: 64832
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64761
Number of HSP's gapped (non-prelim): 71
length of query: 360
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 338
effective length of database: 17,147,199,772
effective search space: 5795753522936
effective search space used: 5795753522936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top