Clone Information

BLAST Search Result

Clone Name	rbasd21h10
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|D38089.1\|WHTPH2AC Triticum aestivum mRNA for protein H2A, co...	361	1e-96
2	dbj\|D38091.1\|WHTPH2AE Triticum aestivum mRNA for protein H2A, co...	353	3e-94
3	ref\|XM_478633.1\| Oryza sativa (japonica cultivar-group), mRNA	236	5e-59
4	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	236	5e-59
5	dbj\|AP003838.3\| Oryza sativa (japonica cultivar-group) genomic D...	236	5e-59
6	dbj\|AK059228.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	236	5e-59
7	ref\|XM_482492.1\| Oryza sativa (japonica cultivar-group), mRNA	174	2e-40
8	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	174	2e-40
9	dbj\|AP005734.4\| Oryza sativa (japonica cultivar-group) genomic D...	174	2e-40
10	dbj\|AP003898.3\| Oryza sativa (japonica cultivar-group) genomic D...	174	2e-40
11	gb\|AY108339.1\| Zea mays PCO070432 mRNA sequence	172	6e-40
12	gb\|AY104637.1\| Zea mays PCO070433 mRNA sequence	168	1e-38
13	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
14	dbj\|AK071511.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	131	2e-27
15	dbj\|AK058913.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	131	2e-27
16	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	131	2e-27
17	emb\|AL731753.2\|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112...	131	2e-27
18	ref\|XM_478632.1\| Oryza sativa (japonica cultivar-group), mRNA	115	1e-22
19	dbj\|AK099888.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	115	1e-22
20	dbj\|AK058540.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	115	1e-22
21	gb\|AY104826.1\| Zea mays PCO099353 mRNA sequence	109	8e-21
22	emb\|X94693.1\|TAH2A254 T.aestivum histone H2A gene	107	3e-20
23	gb\|L75824.1\|WHTHIH2AA Triticum aestivum histone H2A gene, comple...	107	3e-20
24	gb\|AY104828.1\| Zea mays PCO072413 mRNA sequence	101	2e-18
25	gb\|AY110108.1\| Zea mays CL14299_1 mRNA sequence	84	5e-13
26	gb\|L41841.1\|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	82	2e-12
27	gb\|M31922.1\|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	82	2e-12
28	ref\|XM_865976.1\| PREDICTED: Bos taurus similar to Histone H2A.g ...	80	7e-12
29	gb\|AF377946.3\| Oryza sativa (japonica cultivar-group) chromosome...	76	1e-10
30	gb\|AC146936.4\| Oryza sativa (japonica cultivar-group) chromosome...	76	1e-10
31	gb\|AC147426.2\| Oryza sativa chromosome 3 B1377B10 genomic seque...	76	1e-10
32	gb\|BC016677.1\| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG...	76	1e-10
33	gb\|BC067782.1\| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM...	76	1e-10
34	ref\|NM_021064.3\| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA	76	1e-10
35	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	76	1e-10
36	emb\|AL021807.2\|HS86C11 Human DNA sequence from clone RP1-86C11 o...	76	1e-10
37	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	76	1e-10
38	gb\|AY131987.1\| Homo sapiens histone H2A (HIST1H2AG) gene, comple...	76	1e-10
39	dbj\|AK121752.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	76	1e-10
40	dbj\|AK064299.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	76	1e-10
41	gb\|L19778.1\|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds	76	1e-10
42	emb\|AL713943.3\|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa...	76	1e-10
43	emb\|AL731880.3\|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa...	76	1e-10
44	ref\|NG_000827.2\| Homo sapiens genomic histone family microcluste...	76	1e-10
45	gb\|U16724.1\|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	74	4e-10
46	ref\|XM_865148.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	72	2e-09
47	ref\|XM_868899.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	72	2e-09
48	gb\|BT016168.1\| Zea mays clone Contig1 mRNA sequence	70	7e-09
49	ref\|XM_577577.1\| PREDICTED: Rattus norvegicus similar to Histone...	70	7e-09
50	ref\|XM_225386.2\| PREDICTED: Rattus norvegicus histone 1, H2an (p...	70	7e-09
51	ref\|XM_225372.2\| PREDICTED: Rattus norvegicus similar to Histone...	70	7e-09
52	gb\|AY105006.1\| Zea mays PCO108932 mRNA sequence	70	7e-09
53	ref\|XM_518300.1\| PREDICTED: Pan troglodytes similar to Histone H...	68	3e-08
54	gb\|BC104198.1\| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	68	3e-08
55	gb\|BC104199.1\| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG...	68	3e-08
56	ref\|XM_583411.2\| PREDICTED: Bos taurus similar to Histone H2A.l ...	68	3e-08
57	ref\|XM_869647.1\| PREDICTED: Bos taurus similar to Histone H2A.l ...	68	3e-08
58	gb\|BC034487.2\| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM...	68	3e-08
59	ref\|NG_000009.2\| Homo sapiens small histone family cluster (HFS@...	68	3e-08
60	ref\|NM_003510.2\| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA	68	3e-08
61	emb\|Z98744.2\|HS193B12 Human DNA sequence from clone RP1-193B12 o...	68	3e-08
62	emb\|Z83739.1\|HSZ83739 H.sapiens hH2A/d gene	68	3e-08
63	gb\|AY131991.1\| Homo sapiens histone H2A (HIST1H2AK) gene, comple...	68	3e-08
64	dbj\|AK130106.1\| Homo sapiens cDNA FLJ26596 fis, clone LNF08501	68	3e-08
65	gb\|AY893520.1\| Synthetic construct Homo sapiens clone FLH130895....	68	3e-08
66	gb\|AC093350.15\| Mus musculus chromosome 3, clone RP23-16G3, comp...	68	3e-08
67	gb\|AC125099.3\| Mus musculus BAC clone RP24-201C14 from 3, comple...	68	3e-08
68	ref\|XM_527262.1\| PREDICTED: Pan troglodytes similar to histone p...	66	1e-07
69	ref\|XM_518289.1\| PREDICTED: Pan troglodytes similar to Histone H...	66	1e-07
70	gb\|BC031333.1\| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	66	1e-07
71	ref\|NG_001335.1\| Homo sapiens genomic large histone family clust...	66	1e-07
72	ref\|NM_003530.3\| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	66	1e-07
73	ref\|NM_021065.2\| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA	66	1e-07
74	emb\|AL031777.5\|HS34B20 Human DNA sequence from clone RP1-34B20 o...	66	1e-07
75	emb\|Z80776.1\|HSH2AG H.sapiens H2A/g gene	66	1e-07
76	emb\|X16495.1\|MMHIST2A Murine H2A gene for histone H2A	66	1e-07
77	gb\|BC093807.1\| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	66	1e-07
78	emb\|CR541999.1\| Homo sapiens full open reading frame cDNA clone ...	66	1e-07
79	emb\|CR541970.1\| Homo sapiens full open reading frame cDNA clone ...	66	1e-07
80	gb\|BC093809.1\| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	66	1e-07
81	ref\|XM_314447.2\| Anopheles gambiae str. PEST ENSANGP00000016040 ...	66	1e-07
82	ref\|XM_306256.1\| Anopheles gambiae str. PEST ENSANGP00000000004 ...	66	1e-07
83	gb\|U16726.1\|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	66	1e-07
84	gb\|M31921.1\|VVCH2AB V.carteri histone H2A-III and H2B-III genes,...	66	1e-07
85	gb\|AY131985.1\| Homo sapiens histone H2A (HIST1H2AD) gene, comple...	66	1e-07
86	ref\|XM_870473.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	64	4e-07
87	ref\|XM_607721.2\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	64	4e-07
88	gb\|BT016569.1\| Zea mays clone Contig402 mRNA sequence	62	2e-06
89	gb\|AY389710.1\| Hyacinthus orientalis histone H2A mRNA, partial cds	62	2e-06
90	ref\|NM_177688.2\| Mus musculus H2A histone family, member J (H2af...	62	2e-06
91	ref\|XM_906486.2\| PREDICTED: Mus musculus similar to H2A histone ...	62	2e-06
92	gb\|AC122804.4\| Mus musculus BAC clone RP23-296J10 from 6, comple...	62	2e-06
93	emb\|X94973.1\|TAH2A274 T.aestivum histone H2A gene (clone TH274)	62	2e-06
94	gb\|L75802.1\|WHTHIH2A Triticum aestivum histone H2A gene, complet...	62	2e-06
95	dbj\|AK053755.1\| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	62	2e-06
96	ref\|XM_344599.2\| PREDICTED: Rattus norvegicus histone 1, H2ao (p...	62	2e-06
97	ref\|XM_318363.2\| Anopheles gambiae str. PEST ENSANGP00000015971 ...	62	2e-06
98	ref\|XM_318365.1\| Anopheles gambiae str. PEST ENSANGP00000015967 ...	62	2e-06
99	ref\|XM_307083.1\| Anopheles gambiae str. PEST ENSANGP00000012043 ...	62	2e-06
100	gb\|AY103710.1\| Zea mays PCO123562 mRNA sequence	62	2e-06
101	gb\|BC099606.1\| Mus musculus H2A histone family, member J, mRNA (...	62	2e-06
102	gb\|BC024397.1\| Mus musculus H2A histone family, member J, mRNA (...	62	2e-06
103	ref\|XM_527287.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
104	ref\|XM_527283.1\| PREDICTED: Pan troglodytes similar to Hist2h2aa...	60	7e-06
105	ref\|XM_527281.1\| PREDICTED: Pan troglodytes similar to H2A histo...	60	7e-06
106	ref\|XM_527273.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
107	ref\|XM_527272.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
108	ref\|XM_518299.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
109	ref\|XM_518286.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
110	ref\|XM_525084.1\| PREDICTED: Pan troglodytes similar to Histone H...	60	7e-06
111	ref\|NM_175662.1\| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA	60	7e-06
112	ref\|NM_013549.1\| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA	60	7e-06
113	gb\|BC062305.1\| Homo sapiens cDNA clone IMAGE:3162462	60	7e-06
114	gb\|BC001193.1\| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	60	7e-06
115	gb\|BC017379.1\| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	60	7e-06
116	gb\|BC082269.1\| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	60	7e-06
117	gb\|BC080809.1\| Mus musculus cDNA clone IMAGE:6466339	60	7e-06
118	gb\|BC069306.1\| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG...	60	7e-06
119	gb\|BC010336.1\| Mus musculus H2A histone family, member X, mRNA (...	60	7e-06
120	gb\|BC010564.1\| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I...	60	7e-06
121	ref\|NM_178185.1\| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	60	7e-06
122	ref\|NM_178213.2\| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA	60	7e-06
123	ref\|NM_033445.2\| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	60	7e-06
124	ref\|NM_021066.2\| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA	60	7e-06
125	ref\|NM_080596.1\| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA	60	7e-06
126	ref\|NM_003514.2\| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA	60	7e-06
127	ref\|NM_003512.3\| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA	60	7e-06
128	ref\|NM_003511.2\| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA	60	7e-06
129	ref\|NM_003509.2\| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA	60	7e-06
130	gb\|AC034285.6\| Mus musculus chromosome 13, clone RP23-220G21, co...	60	7e-06
131	gb\|AY573602.1\| Toxoplasma gondii histone H2A.1 gene, complete cds	60	7e-06
132	ref\|NG_002734.1\| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	60	7e-06
133	gb\|BC066234.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
134	gb\|BC066232.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
135	gb\|BC066233.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
136	gb\|BC066237.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
137	gb\|BC066236.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
138	gb\|BC066235.1\| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	60	7e-06
139	ref\|XM_545430.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
140	ref\|XM_545426.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
141	ref\|XM_849168.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
142	ref\|XM_545421.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
143	ref\|XM_545419.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
144	ref\|XM_545413.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
145	ref\|XM_545411.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
146	ref\|XM_545400.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
147	ref\|XM_545394.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
148	ref\|XM_848774.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
149	ref\|XM_848759.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
150	ref\|XM_545384.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
151	ref\|XM_848716.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
152	ref\|XM_545376.2\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
153	ref\|XM_545373.1\| PREDICTED: Canis familiaris similar to histone ...	60	7e-06
154	ref\|XM_854341.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
155	ref\|XM_545390.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
156	ref\|XM_981616.1\| PREDICTED: Mus musculus similar to H2A histone ...	60	7e-06
157	ref\|XM_992084.1\| PREDICTED: Mus musculus similar to H2A histone ...	60	7e-06
158	ref\|XM_994730.1\| PREDICTED: Mus musculus similar to H2A histone ...	60	7e-06
159	ref\|XM_978341.1\| PREDICTED: Mus musculus similar to histone 2a, ...	60	7e-06
160	ref\|XM_978296.1\| PREDICTED: Mus musculus similar to histone 2a, ...	60	7e-06
161	ref\|XM_886396.1\| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	60	7e-06
162	gb\|BC064002.1\| Mus musculus cDNA clone IMAGE:6823756, partial cds	60	7e-06
163	ref\|XM_539322.1\| PREDICTED: Canis familiaris similar to Histone ...	60	7e-06
164	ref\|XM_569065.1\| Cryptococcus neoformans var. neoformans JEC21 h...	60	7e-06
165	gb\|AC122428.4\| Mus musculus BAC clone RP24-175C20 from chromosom...	60	7e-06
166	ref\|NM_010436.2\| Mus musculus H2A histone family, member X (H2af...	60	7e-06
167	gb\|BC058544.1\| Mus musculus cDNA clone IMAGE:5711765, with appar...	60	7e-06
168	gb\|AY158922.2\| Mus musculus histone protein Hist2h2ab gene, comp...	60	7e-06
169	emb\|AL353759.8\| Human DNA sequence from clone RP1-221C16 on chro...	60	7e-06
170	emb\|AL139288.15\| Human DNA sequence from clone RP5-915N17 on chr...	60	7e-06
171	emb\|AL049822.30\|HSJ160A22 Human DNA sequence from clone RP1-160A...	60	7e-06
172	gb\|AY270707.1\| Homo sapiens clone SKA08-D09 putative promoter se...	60	7e-06
173	emb\|AL009179.1\|HS97D16 Human DNA sequence from clone RP1-97D16 o...	60	7e-06
174	emb\|Z83742.1\|HSZ83742 H.sapiens hH2A/c gene	60	7e-06
175	emb\|Z83736.1\|HSZ83736 H.sapiens hH2A/e gene	60	7e-06
176	emb\|Z80778.1\|HSH2AL H.sapiens H2A/l gene	60	7e-06
177	emb\|Z35401.1\|MMHISTH2A M.musculus C3H gene for histone H2A.X	60	7e-06
178	emb\|Z30940.1\|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ...	60	7e-06
179	emb\|X80327.1\|MPMP323 M.pahari genes mpH323 and mph2a23	60	7e-06
180	emb\|X83549.1\|HSHISTN2A H.sapiens gene for histone H2A	60	7e-06
181	emb\|X80328.1\|MMH2B143 M.musculus genes H2b-143, H3-143	60	7e-06
182	emb\|X16148.1\|MMHIS2A3 Mouse H2a and H3 histone genes	60	7e-06
183	emb\|X57138.1\|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2...	60	7e-06
184	emb\|X05863.1\|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	60	7e-06
185	emb\|X05862.1\|MMHIS2BA Mouse H2B and H2A histone genes (291A)	60	7e-06
186	gb\|BC099406.1\| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	60	7e-06
187	emb\|AL592149.8\| Mouse DNA sequence from clone RP23-283N14 on chr...	60	7e-06
188	ref\|NM_178189.2\| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	60	7e-06
189	emb\|AL589879.21\| Mouse DNA sequence from clone RP23-38E20 on chr...	60	7e-06
190	emb\|AL590614.8\| Mouse DNA sequence from clone RP23-9O16 on chrom...	60	7e-06
191	emb\|AL589651.8\| Mouse DNA sequence from clone RP23-138F20 on chr...	60	7e-06
192	emb\|AL590388.4\| Mouse DNA sequence from clone RP23-480B19 on chr...	60	7e-06
193	gb\|BC065803.1\| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	60	7e-06
194	gb\|BC076498.1\| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	60	7e-06
195	gb\|BC005468.1\| Mus musculus H2A histone family, member X, mRNA (...	60	7e-06
196	gb\|AE017342.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	60	7e-06
197	emb\|CR624886.1\| full-length cDNA clone CS0DK009YH13 of HeLa cell...	60	7e-06
198	emb\|CR621753.1\| full-length cDNA clone CS0DI059YA15 of Placenta ...	60	7e-06
199	gb\|BC032686.1\| Homo sapiens, clone IMAGE:5581652, mRNA	60	7e-06
200	emb\|CR608156.1\| full-length cDNA clone CS0DI013YB19 of Placenta ...	60	7e-06
201	dbj\|AK145443.1\| Mus musculus 5 days embryo whole body cDNA, RIKE...	60	7e-06
202	dbj\|AK146117.1\| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	60	7e-06
203	dbj\|AK146846.1\| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	60	7e-06
204	gb\|U91328.1\|HSU91328 Human hereditary haemochromatosis region, h...	60	7e-06
205	gb\|U90551.1\|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,...	60	7e-06
206	dbj\|AK158457.1\| Mus musculus adult inner ear cDNA, RIKEN full-le...	60	7e-06
207	ref\|NM_175660.2\| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	60	7e-06
208	gb\|BC090402.1\| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	60	7e-06
209	gb\|BC062251.1\| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	60	7e-06
210	gb\|BC069947.1\| Mus musculus cDNA clone IMAGE:6494016	60	7e-06
211	gb\|BC055904.1\| Mus musculus cDNA clone IMAGE:4913108	60	7e-06
212	dbj\|AK006728.1\| Mus musculus adult male testis cDNA, RIKEN full-...	60	7e-06
213	ref\|NM_178186.2\| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	60	7e-06
214	ref\|NM_178187.2\| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	60	7e-06
215	ref\|NM_178188.3\| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	60	7e-06
216	dbj\|AK088040.1\| Mus musculus 2 days neonate thymus thymic cells ...	60	7e-06
217	dbj\|AK077055.1\| Mus musculus adult male testis cDNA, RIKEN full-...	60	7e-06
218	dbj\|AK002725.1\| Mus musculus adult male kidney cDNA, RIKEN full-...	60	7e-06
219	dbj\|AK016171.1\| Mus musculus adult male testis cDNA, RIKEN full-...	60	7e-06
220	gb\|AF255739.1\|AF255739 Bufo bufo gagarizans replication-dependen...	60	7e-06
221	gb\|U62674.1\|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	60	7e-06
222	gb\|U62673.1\|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	60	7e-06
223	gb\|U62669.1\|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	60	7e-06
224	dbj\|AK008124.1\| Mus musculus adult male small intestine cDNA, RI...	60	7e-06
225	dbj\|AK028129.1\| Mus musculus adult male stomach cDNA, RIKEN full...	60	7e-06
226	dbj\|AK028026.1\| Mus musculus 18-day embryo whole body cDNA, RIKE...	60	7e-06
227	dbj\|AK033518.1\| Mus musculus adult male colon cDNA, RIKEN full-l...	60	7e-06
228	gb\|BC093851.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
229	gb\|BC093849.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
230	ref\|NM_178184.1\| Mus musculus histone 1, H2an (Hist1h2an), mRNA	60	7e-06
231	ref\|NM_178182.1\| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	60	7e-06
232	ref\|NM_178212.1\| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA	60	7e-06
233	gb\|AY131993.1\| Homo sapiens histone H2A (HIST1H2AM) gene, comple...	60	7e-06
234	gb\|AY131992.1\| Homo sapiens histone H2A (HIST1H2AL) gene, comple...	60	7e-06
235	gb\|AY131990.1\| Homo sapiens histone H2A (HIST1H2AJ) gene, comple...	60	7e-06
236	gb\|AY131989.1\| Homo sapiens histone H2A (HIST1H2AI) gene, comple...	60	7e-06
237	gb\|AY131988.1\| Homo sapiens histone H2A (HIST1H2AH) gene, comple...	60	7e-06
238	gb\|AY158953.1\| Mus musculus histone protein Hist2h3c2 gene, comp...	60	7e-06
239	gb\|AY158925.1\| Mus musculus histone protein Hist2h2aa1 gene, com...	60	7e-06
240	gb\|AY158924.1\| Mus musculus histone protein Hist2h2aa2 gene, com...	60	7e-06
241	gb\|AY158923.1\| Mus musculus histone protein Hist2h2ac gene, comp...	60	7e-06
242	gb\|AY158920.1\| Mus musculus histone protein Hist1h2ab gene, comp...	60	7e-06
243	gb\|AY158919.1\| Mus musculus histone protein Hist1h2ac gene, comp...	60	7e-06
244	gb\|AY158918.1\| Mus musculus histone protein Hist1h2ad gene, comp...	60	7e-06
245	gb\|AY158917.1\| Mus musculus histone protein Hist1h2ae gene, comp...	60	7e-06
246	gb\|AY158916.1\| Mus musculus histone protein Hist1h2af gene, comp...	60	7e-06
247	gb\|AY158915.1\| Mus musculus histone protein Hist1h2ag gene, comp...	60	7e-06
248	gb\|AY158914.1\| Mus musculus histone protein Hist1h2ah gene, comp...	60	7e-06
249	gb\|AY158913.1\| Mus musculus histone protein Hist1h2ao gene, comp...	60	7e-06
250	gb\|AY158912.1\| Mus musculus histone protein Hist1h2an gene, comp...	60	7e-06
251	gb\|AY158910.1\| Mus musculus histone protein Hist1h2aj pseudogene...	60	7e-06
252	gb\|AY158909.1\| Mus musculus histone protein Hist1h2ai gene, comp...	60	7e-06
253	gb\|BC085010.1\| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	60	7e-06
254	gb\|AY894000.1\| Synthetic construct Homo sapiens clone FLH130938....	60	7e-06
255	gb\|AY893556.1\| Synthetic construct Homo sapiens clone FLH130901....	60	7e-06
256	gb\|AY893555.1\| Synthetic construct Homo sapiens clone FLH130900....	60	7e-06
257	ref\|NM_175661.1\| Mus musculus histone 1, H2af (Hist1h2af), mRNA	60	7e-06
258	ref\|NM_175659.1\| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	60	7e-06
259	gb\|BC112072.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
260	gb\|BC112256.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
261	gb\|BC112254.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
262	gb\|BC071668.1\| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	60	7e-06
263	gb\|BC105129.1\| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	60	7e-06
264	gb\|BC062255.1\| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	60	7e-06
265	gb\|BC050602.1\| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG...	60	7e-06
266	gb\|BC032756.1\| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG...	60	7e-06
267	gb\|AC157656.3\| Mus musculus BAC clone RP23-406A5 from chromosome...	60	7e-06
268	gb\|BC053966.1\| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I...	60	7e-06
269	ref\|XM_667061.1\| Plasmodium berghei strain ANKA histone h2a (PB3...	60	7e-06
270	gb\|BC089519.1\| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	60	7e-06
271	gb\|U95109.1\|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	60	7e-06
272	gb\|M33988.1\|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	60	7e-06
273	gb\|M37736.1\|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	60	7e-06
274	gb\|AY131984.1\| Homo sapiens histone H2A (HIST1H2AC) gene, comple...	60	7e-06
275	gb\|AY131974.1\| Homo sapiens histone H2A (HIST3H2A) gene, complet...	60	7e-06
276	gb\|AC160122.2\| Mus musculus BAC clone RP23-390G1 from chromosome...	60	7e-06
277	gb\|BC051627.1\| Danio rerio zgc:56685, mRNA (cDNA clone MGC:56685...	58	3e-05
278	ref\|NM_201202.1\| Danio rerio zgc:56685 (zgc:56685), mRNA	58	3e-05
279	ref\|NM_021052.2\| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA	58	3e-05
280	emb\|BX063165.1\|CNS09KWH Single read from an extremity of a full-...	58	3e-05
281	emb\|BX063164.1\|CNS09KWG Single read from an extremity of a full-...	58	3e-05
282	emb\|BX040864.1\|CNS093P0 Single read from an extremity of a full-...	58	3e-05
283	emb\|BX019683.1\|CNS08NCN Single read from an extremity of a full-...	58	3e-05
284	emb\|BX016451.1\|CNS08KUV Single read from an extremity of a full-...	58	3e-05
285	emb\|BX009846.1\|CNS08FRE Single read from an extremity of a full-...	58	3e-05
286	emb\|BX008487.1\|CNS08EPN Single read from an extremity of a full-...	58	3e-05
287	emb\|BX007458.1\|CNS08DX2 Single read from an extremity of a full-...	58	3e-05
288	ref\|XM_694300.1\| PREDICTED: Danio rerio similar to histone H2A (...	58	3e-05
289	gb\|BC093862.1\| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	58	3e-05
290	gb\|BC093836.1\| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	58	3e-05
291	dbj\|D38088.1\|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	58	3e-05
292	dbj\|D38087.1\|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	58	3e-05
293	gb\|U16725.1\|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	58	3e-05
294	gb\|M60752.1\|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds	58	3e-05
295	gb\|AY131986.1\| Homo sapiens histone H2A (HIST1H2AE) gene, comple...	58	3e-05
296	gb\|BC060324.1\| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG...	56	1e-04
297	ref\|XM_513764.1\| PREDICTED: Pan troglodytes LOC457261 (LOC457261...	56	1e-04
298	ref\|NM_003517.2\| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA	56	1e-04
299	gb\|AY648852.1\| Homo sapiens histone H2A/r gene, complete cds	56	1e-04
300	gb\|BC019308.1\| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	56	1e-04
301	gb\|BC001629.1\| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	56	1e-04
302	ref\|XM_603142.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	56	1e-04
303	ref\|XM_602496.2\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
304	ref\|XM_871147.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
305	ref\|XM_868674.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
306	ref\|XM_869001.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
307	ref\|NM_003516.2\| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA	56	1e-04
308	emb\|AL591493.14\| Human DNA sequence from clone RP11-196G18 on ch...	56	1e-04
309	ref\|XM_928387.1\| PREDICTED: Homo sapiens similar to Histone H2A....	56	1e-04
310	emb\|CR541872.1\| Homo sapiens full open reading frame cDNA clone ...	56	1e-04
311	emb\|CR536525.1\| Homo sapiens full open reading frame cDNA clone ...	56	1e-04
312	dbj\|AB168678.1\| Macaca fascicularis testis cDNA clone: QtsA-1409...	56	1e-04
313	gb\|AY894055.1\| Synthetic construct Homo sapiens clone FLH131281....	56	1e-04
314	gb\|AY894054.1\| Synthetic construct Homo sapiens clone FLH130836....	56	1e-04
315	gb\|BC098171.1\| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	56	1e-04
316	gb\|BC096705.1\| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	56	1e-04
317	gb\|BC096739.1\| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG...	56	1e-04
318	gb\|L19779.1\|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds	56	1e-04
319	gb\|AY131973.1\| Homo sapiens histone H2A (HIST2H2AC) gene, comple...	56	1e-04
320	gb\|AY131972.1\| Homo sapiens histone H2A (HIST2H2AB) gene, comple...	56	1e-04
321	gb\|AY131971.1\| Homo sapiens histone H2A (HIST2H2AA) gene, comple...	56	1e-04
322	gb\|BT019008.1\| Zea mays clone Contig499.F mRNA sequence	54	4e-04
323	gb\|BC098891.1\| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140...	54	4e-04
324	ref\|NM_001031826.1\| Danio rerio zgc:114037 (zgc:114037), mRNA	54	4e-04
325	emb\|X80330.1\|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	54	4e-04
326	emb\|X59962.1\|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	54	4e-04
327	emb\|X59961.1\|RNH2AB R.norvegicus genes for H2A and H2B histones	54	4e-04
328	emb\|BX088700.1\|CNS09S4S DNA centromeric region sequence from BAC...	54	4e-04
329	emb\|AJ494853.1\|ODI494853 Oikopleura dioica mRNA for histone H2A....	54	4e-04
330	ref\|XM_683419.1\| PREDICTED: Danio rerio similar to replication-d...	54	4e-04
331	ref\|NM_021839.1\| Rattus norvegicus testis-specific histone 2a (H...	54	4e-04
332	ref\|XM_345255.2\| PREDICTED: Rattus norvegicus histone 2, H2aa (p...	54	4e-04
333	ref\|XM_574998.1\| PREDICTED: Rattus norvegicus similar to Hist2h2...	54	4e-04
334	ref\|XM_574997.1\| PREDICTED: Rattus norvegicus similar to histone...	54	4e-04
335	emb\|Z65161.1\|HS21G2F H.sapiens CpG island DNA genomic Mse1 fragm...	54	4e-04
336	dbj\|D38090.1\|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	54	4e-04
337	emb\|CR354435.20\| Zebrafish DNA sequence from clone CH211-113A14 ...	54	4e-04
338	emb\|AL590462.1\|CNS07EGJ DNA centromeric region sequence BAC 34F0...	54	4e-04
339	gb\|DQ214188.1\| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	52	0.002
340	gb\|DQ214187.1\| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	52	0.002
341	gb\|BC106331.1\| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	52	0.002
342	gb\|BT017719.1\| Zea mays clone EL01N0447A04.c mRNA sequence	52	0.002
343	ref\|XM_425469.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
344	ref\|XM_425467.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
345	ref\|XM_425465.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
346	ref\|XM_425459.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
347	ref\|XM_425455.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
348	ref\|XM_416195.1\| PREDICTED: Gallus gallus similar to histone 2, ...	52	0.002
349	ref\|XM_416193.1\| PREDICTED: Gallus gallus similar to histone pro...	52	0.002
350	ref\|XM_416192.1\| PREDICTED: Gallus gallus similar to germinal hi...	52	0.002
351	emb\|Z73102.1\|CEB0035 Caenorhabditis elegans Cosmid B0035, comple...	52	0.002
352	emb\|Z82271.1\|CEF54E12 Caenorhabditis elegans Cosmid F54E12, comp...	52	0.002
353	ref\|XM_848163.1\| PREDICTED: Canis familiaris similar to Histone ...	52	0.002
354	ref\|XM_789760.1\| PREDICTED: Strongylocentrotus purpuratus simila...	52	0.002
355	ref\|XM_781115.1\| PREDICTED: Strongylocentrotus purpuratus simila...	52	0.002
356	emb\|X58069.1\|MMH2AX Mouse mRNA for Histone H2A.X	52	0.002
357	emb\|X14730.1\|CMHIST2A Duck H2A histone gene	52	0.002
358	ref\|NM_001030753.1\| Gallus gallus histone H2A (H2A-IX), mRNA	52	0.002
359	emb\|X07763.1\|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq...	52	0.002
360	emb\|X03018.1\|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	52	0.002
361	emb\|X02218.1\|GGHIS1 Chicken duplicated genes for histone H2A, H4...	52	0.002
362	gb\|AY849372.1\| Alexandrium tamarense histone H2A.X mRNA, partial...	52	0.002
363	emb\|V00413.1\|GGH2AX Chicken gene for histone H2A with flanking r...	52	0.002
364	ref\|NM_069749.1\| Caenorhabditis elegans HIStone family member (h...	52	0.002
365	ref\|NM_069740.1\| Caenorhabditis elegans HIStone family member (h...	52	0.002
366	ref\|NM_069730.1\| Caenorhabditis elegans HIStone family member (h...	52	0.002
367	ref\|NM_178183.1\| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	52	0.002
368	gb\|AY158911.1\| Mus musculus histone protein Hist1h2ak gene, comp...	52	0.002
369	emb\|AJ718664.1\| Nicotiana tabacum cDNA-AFLP-fragment BSTC4-13-38...	52	0.002
370	dbj\|D11055.1\|CHKH2A4H Gallus gallus gene for H2A histone, comple...	52	0.002
371	dbj\|D11054.1\|CHKH2A3H Gallus gallus gene for H2A histone, comple...	52	0.002
372	gb\|U38934.1\|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	52	0.002
373	gb\|U38933.1\|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	52	0.002
374	gb\|U38932.1\|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	52	0.002
375	gb\|U38931.1\|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	52	0.002
376	emb\|Z92789.1\|CEH02I12 Caenorhabditis elegans Fosmid H02I12, comp...	52	0.002
377	gb\|U70133.1\|BBU70133 Bufo bufo gagarizans replication-dependent ...	52	0.002
378	gb\|U95111.1\|MSU95111 Mus spretus histone H2a pseudogene, complet...	52	0.002
379	gb\|M21287.1\|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	52	0.002
380	gb\|J00864.1\|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	52	0.002
381	gb\|BC046078.1\| Danio rerio H2A histone family, member X, mRNA (c...	50	0.006
382	ref\|XM_871500.1\| PREDICTED: Bos taurus similar to Histone H2A.o ...	50	0.006
383	ref\|XM_614586.2\| PREDICTED: Bos taurus similar to Histone H2A.o ...	50	0.006
384	ref\|XM_866756.1\| PREDICTED: Bos taurus similar to H3 histone, fa...	50	0.006
385	ref\|XM_591391.2\| PREDICTED: Bos taurus similar to Histone H2A.o ...	50	0.006
386	ref\|NM_201073.1\| Danio rerio H2A histone family, member X (h2afx...	50	0.006
387	ref\|XM_391803.1\| Gibberella zeae PH-1 H2A_NEUCR Histone H2A (FG1...	50	0.006
388	emb\|CR709561.2\|CNS0GAG5 Tetraodon nigroviridis full-length cDNA	50	0.006
389	emb\|CR700361.2\|CNS0G3CL Tetraodon nigroviridis full-length cDNA	50	0.006
390	emb\|AL512384.9\| Human DNA sequence from clone RP11-317E16 on chr...	50	0.006
391	emb\|BX016452.1\|CNS08KUW Single read from an extremity of a full-...	50	0.006
392	ref\|XM_683706.1\| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
393	emb\|BX510347.9\| Zebrafish DNA sequence from clone DKEY-5E14 in l...	50	0.006
394	emb\|CR450244.2\| Zebrafish DNA sequence from clone CH211-196O21 i...	50	0.006
395	emb\|BX294169.10\| Zebrafish DNA sequence from clone DKEY-151N15 i...	50	0.006
396	ref\|XM_602557.2\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.025
397	ref\|XM_785689.1\| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.025
398	emb\|X07766.1\|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq...	48	0.025
399	ref\|XM_576399.1\| PREDICTED: Rattus norvegicus similar to Histone...	48	0.025
400	gb\|AC024696.1\| Caenorhabditis elegans cosmid F07B7, complete seq...	46	0.10
401	ref\|XM_870470.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	46	0.10
402	gb\|U64843.2\| Caenorhabditis elegans cosmid K06C4, complete sequence	46	0.10
403	ref\|NM_001024396.1\| Danio rerio zgc:110434 (zgc:110434), mRNA	46	0.10
404	gb\|U64845.1\| Caenorhabditis elegans cosmid F45F2, complete sequence	46	0.10
405	ref\|NM_001024282.1\| Rattus norvegicus Histone H2a (predicted) (R...	46	0.10
406	ref\|XM_683282.1\| PREDICTED: Danio rerio similar to histone H2A (...	46	0.10
407	ref\|XM_683060.1\| PREDICTED: Danio rerio similar to replication-d...	46	0.10
408	ref\|XM_694138.1\| PREDICTED: Danio rerio similar to histone H2A (...	46	0.10
409	ref\|XM_687955.1\| PREDICTED: Danio rerio similar to histone H2A (...	46	0.10
410	ref\|XM_682538.1\| PREDICTED: Danio rerio similar to replication-d...	46	0.10
411	ref\|XM_693555.1\| PREDICTED: Danio rerio similar to histone H2A (...	46	0.10
412	ref\|XM_688696.1\| PREDICTED: Danio rerio similar to histone H2A (...	46	0.10
413	emb\|BX510369.6\| Zebrafish DNA sequence from clone CH211-126I22 i...	46	0.10
414	ref\|NM_072895.1\| Caenorhabditis elegans HIStone family member (h...	46	0.10
415	ref\|NM_072797.1\| Caenorhabditis elegans HIStone family member (h...	46	0.10
416	ref\|NM_072879.1\| Caenorhabditis elegans HIStone family member (h...	46	0.10
417	ref\|NM_072892.1\| Caenorhabditis elegans HIStone family member (h...	46	0.10
418	ref\|NM_072876.1\| Caenorhabditis elegans HIStone family member (h...	46	0.10
419	gb\|BC095260.1\| Danio rerio zgc:110434, mRNA (cDNA clone MGC:1104...	46	0.10
420	gb\|BC092032.1\| Xenopus laevis hypothetical protein MGC83508, mRN...	46	0.10
421	gb\|AC084589.1\|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c...	46	0.10
422	gb\|AC084502.1\|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c...	46	0.10
423	gb\|U95113.1\|RNU95113 Rattus norvegicus histone H2a gene, complet...	46	0.10
424	gb\|J00950.1\|NVIHIS2A Newt histone H2a gene, partial	46	0.10
425	ref\|NM_118857.2\| Arabidopsis thaliana DNA binding AT4G27230 mRNA...	44	0.40
426	ref\|XM_522264.1\| PREDICTED: Pan troglodytes similar to Histone H...	44	0.40
427	gb\|BC107354.1\| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	44	0.40
428	gb\|BC107355.1\| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	44	0.40
429	ref\|NM_175658.1\| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	44	0.40
430	ref\|XM_610233.2\| PREDICTED: Bos taurus similar to Histone H2AFX ...	44	0.40
431	gb\|BC004915.2\| Homo sapiens H2A histone family, member X, mRNA (...	44	0.40
432	gb\|BC068823.1\| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	44	0.40
433	ref\|XM_543796.2\| PREDICTED: Canis familiaris similar to H2A hist...	44	0.40
434	ref\|XM_752558.1\| Ustilago maydis 521 histone H2A (UM01504.1) par...	44	0.40
435	ref\|XM_540292.2\| PREDICTED: Canis familiaris similar to histone ...	44	0.40
436	ref\|XM_845715.1\| PREDICTED: Canis familiaris similar to Histone ...	44	0.40
437	ref\|XM_540286.2\| PREDICTED: Canis familiaris similar to Histone ...	44	0.40
438	emb\|Z81128.2\|CET23D8 Caenorhabditis elegans Cosmid T23D8, comple...	44	0.40
439	ref\|NM_002105.2\| Homo sapiens H2A histone family, member X (H2AF...	44	0.40
440	emb\|X14850.1\|HSH2AX Human H2A.X mRNA encoding histone H2A.X	44	0.40
441	emb\|CR457079.1\| Homo sapiens full open reading frame cDNA clone ...	44	0.40
442	emb\|AL606464.11\| Mouse DNA sequence from clone RP23-462P2 on chr...	44	0.40
443	emb\|AL161566.2\|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ...	44	0.40
444	emb\|AL030978.1\|ATM4I22 Arabidopsis thaliana DNA chromosome 4, P1...	44	0.40
445	gb\|BC013416.2\| Homo sapiens H2A histone family, member X, mRNA (...	44	0.40
446	gb\|U58750.1\| Caenorhabditis elegans cosmid F55G1, complete sequence	44	0.40
447	emb\|CR605072.1\| full-length cDNA clone CS0DD007YB20 of Neuroblas...	44	0.40
448	gb\|BT006076.1\| Arabidopsis thaliana clone U20287 putative histon...	44	0.40
449	gb\|AF255740.1\|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	44	0.40
450	ref\|NM_068800.2\| Caenorhabditis elegans F55G1.10 (Histone) mRNA,...	44	0.40
451	ref\|NM_060241.2\| Caenorhabditis elegans HIStone family member (h...	44	0.40
452	gb\|AY760064.1\| Muntiacus muntjak vaginalis H2A histone family me...	44	0.40
453	gb\|DQ015918.1\| Homo sapiens H2A histone family, member X (H2AFX)...	44	0.40
454	gb\|BT005779.1\| Arabidopsis thaliana clone RAFL14-92-E07 (R20287)...	44	0.40
455	emb\|BX933556.1\| Gallus gallus finished cDNA, clone ChEST42h4	44	0.40
456	ref\|XM_577573.1\| PREDICTED: Rattus norvegicus similar to Histone...	44	0.40
457	gb\|AY088714.1\| Arabidopsis thaliana clone 927 mRNA, complete seq...	44	0.40
458	gb\|AY158921.1\| Mus musculus histone protein Hist1h2aa gene, comp...	44	0.40
459	dbj\|AK214754.1\| Mus musculus cDNA, clone:Y2G0132O07, strand:minu...	44	0.40
460	dbj\|AK207984.1\| Mus musculus cDNA, clone:Y2G0109L23, strand:minu...	44	0.40
461	ref\|XM_551996.1\| Anopheles gambiae str. PEST ENSANGP00000029020 ...	44	0.40
462	gb\|BC011694.2\| Homo sapiens H2A histone family, member X, mRNA (...	44	0.40
463	dbj\|AP003391.1\| Homo sapiens genomic DNA, chromosome 11q clone:C...	44	0.40
464	gb\|U95110.1\|MMU95110 Mus macedonicus histone H2a pseudogene, com...	44	0.40
465	gb\|AY835842.1\| Bos taurus histone H2A mRNA, partial cds	44	0.40
466	gb\|M14141.1\|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds	44	0.40
467	ref\|XM_527254.1\| PREDICTED: Pan troglodytes similar to HIST2H3C ...	42	1.6
468	ref\|XM_866523.1\| PREDICTED: Bos taurus similar to Histone H2A.1 ...	42	1.6
469	gb\|BT013349.1\| Lycopersicon esculentum clone 135292F, mRNA sequence	42	1.6
470	ref\|NM_003513.2\| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA	42	1.6
471	emb\|CR722682.2\|CNS0GKKG Tetraodon nigroviridis full-length cDNA	42	1.6
472	emb\|CR705936.2\|CNS0G7NG Tetraodon nigroviridis full-length cDNA	42	1.6
473	emb\|CR681249.2\|CNS0FOLP Tetraodon nigroviridis full-length cDNA	42	1.6
474	emb\|CR659269.2\|CNS0F7NV Tetraodon nigroviridis full-length cDNA	42	1.6
475	ref\|XM_504426.1\| Yarrowia lipolytica CLIB122, YALI0E26477g predi...	42	1.6
476	ref\|XM_789645.1\| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.6
477	emb\|X00089.1\|HSHISH2A Human histone H2a gene	42	1.6
478	gb\|AY849373.1\| Emiliania huxleyi histone H2A.X mRNA, complete cds	42	1.6
479	emb\|AJ306722.1\|PPI306722 Pinus pinaster mRNA for putative histon...	42	1.6
480	emb\|Z83741.1\|HSZ83741 H.sapiens hH2A/m gene	42	1.6
481	ref\|XM_687127.1\| PREDICTED: Danio rerio similar to replication-d...	42	1.6
482	ref\|XM_683938.1\| PREDICTED: Danio rerio similar to histone H2A (...	42	1.6
483	gb\|AF315729.1\|AF315729 Carassius auratus histone H2A mRNA, compl...	42	1.6
484	gb\|CP000116.1\| Thiobacillus denitrificans ATCC 25259, complete g...	42	1.6
485	gb\|AY131983.1\| Homo sapiens histone H2A (HIST1H2AB) gene, comple...	42	1.6
486	emb\|CR382131.1\| Yarrowia lipolytica chromosome E of strain CLIB ...	42	1.6
487	gb\|M11085.1\|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2...	42	1.6
488	gb\|M11084.1\|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1...	42	1.6
489	gb\|AC151783.1\| Ornithorhynchus anatinus chromosome UNK clone OAB...	40	6.2
490	ref\|XM_475374.1\| Oryza sativa (japonica cultivar-group), predic...	40	6.2
491	ref\|NM_196672.1\| Oryza sativa (japonica cultivar-group) putative...	40	6.2
492	ref\|NM_021840.2\| Rattus norvegicus histone 2a (H2a), mRNA	40	6.2
493	ref\|XM_475081.1\| Oryza sativa (japonica cultivar-group), predic...	40	6.2
494	ref\|NM_178218.2\| Mus musculus histone 3, H2a (Hist3h2a), mRNA	40	6.2
495	gb\|BT019315.1\| Zea mays clone Contig989.F mRNA sequence	40	6.2
496	gb\|BT016301.1\| Zea mays clone Contig134 mRNA sequence	40	6.2
497	gb\|BC099140.1\| Rattus norvegicus histone 2a, mRNA (cDNA clone MG...	40	6.2
498	gb\|AC087546.1\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.2
499	ref\|XM_602862.2\| PREDICTED: Bos taurus similar to synapse defect...	40	6.2
500	gb\|AE000516.2\| Mycobacterium tuberculosis CDC1551, complete genome	40	6.2

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score =  361 bits (182), Expect = 1e-96
 Identities = 223/236 (94%), Gaps = 3/236 (1%)
 Strand = Plus / Minus

                                                                       
Query: 224 gatacagccgagcacccacgaccaccgagaaggagccgtcatctagctatcgtcatcggc 283
           ||||||||||||||||||||||| | ||| ||||| |||||||||||||||||| |||||
Sbjct: 529 gatacagccgagcacccacgacctcagaggaggagtcgtcatctagctatcgtcgtcggc 470

                                                                       
Query: 284 agccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttggg 343
           |||| ||||||||   ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 agccacggccttg---ctgcctccggccttcttggggagcagaaggttgtggatgttggg 413

                                                                       
Query: 344 catgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgtt 403
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 412 catgacaccgccgctggcgattgtgaccatgccgagcaggcgggagagctcctcgtcgtt 353

                                                                   
Query: 404 gcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||| |||||||| || ||||||||||||||||||||||||||||||||||
Sbjct: 352 gcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctcg 297



 Score =  143 bits (72), Expect = 6e-31
 Identities = 78/80 (97%)
 Strand = Plus / Minus

                                                                       
Query: 26  tatagaacgtagcaacgaattacagaggatgtaaccattgtccacacctagtttagcacc 85
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 696 tatagaacatagcaacgaattacagaggatgtaaccattgtccacacctagtttagcatc 637

                               
Query: 86  ggtacaagcacacagattca 105
           ||||||||||||||||||||
Sbjct: 636 ggtacaagcacacagattca 617



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                               
Query: 131 tagtaaaacgcaacacctaggcaacacttgactgcagacgctactacacaga 182
           ||||||||||||||||||||||||||||| |||| | |||||||||||||||
Sbjct: 585 tagtaaaacgcaacacctaggcaacacttaactgaacacgctactacacaga 534

to top

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score =  353 bits (178), Expect = 3e-94
 Identities = 222/236 (94%), Gaps = 3/236 (1%)
 Strand = Plus / Minus

                                                                       
Query: 224 gatacagccgagcacccacgaccaccgagaaggagccgtcatctagctatcgtcatcggc 283
           ||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||
Sbjct: 531 gatacagccgagcacccacgaccaccgaggaggagtcgtcatctagctatcgtcgtcggc 472

                                                                       
Query: 284 agccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttggg 343
           |||| ||||||||   ||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 471 agccacggccttg---ctgccaccggccttcttggggagcaggaggttgtggatgttggg 415

                                                                       
Query: 344 catgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgtt 403
           ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 414 catgacaccaccgctggcgattgtgaccatgccgagcaggcgggagagctcctcgtcgtt 355

                                                                   
Query: 404 gcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||| |||||||| || ||||||||||||||||||||||||||||||||||
Sbjct: 354 gcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctcg 299



 Score =  125 bits (63), Expect = 1e-25
 Identities = 132/152 (86%), Gaps = 11/152 (7%)
 Strand = Plus / Minus

                                                                       
Query: 38  caacgaattacagaggatgtaaccattgtccacacctagtttagcaccggtacaagcaca 97
           |||||||||||| |||||| |||||||||||||  |||||||||||||||||||||||||
Sbjct: 683 caacgaattacaaaggatgcaaccattgtccacggctagtttagcaccggtacaagcaca 624

                                                                       
Query: 98  cagattcattcagaaactaata--cgtactac--tcct---agtaaaacgcaacacctag 150
           |||    |||||||||||||||   |||||||  ||||   |||||||||||||||||||
Sbjct: 623 cag----attcagaaactaatagcagtactaccatcctagaagtaaaacgcaacacctag 568

                                           
Query: 151 gcaacacttgactgcagacgctactacacaga 182
           |||||| || |||| | |||||||||||||||
Sbjct: 567 gcaacatttaactgaacacgctactacacaga 536

to top

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score =  236 bits (119), Expect = 5e-59
 Identities = 161/175 (92%)
 Strand = Plus / Minus

                                                                       
Query: 285 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 344
           ||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485

                                                                       
Query: 345 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 404
           ||||| || |||||||||||||||||| | |||||||||||||| |||||||||||||||
Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425

                                                                  
Query: 405 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
           |||||||| |||||||| || || ||||| |||||||||||||||||||||||||
Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcg 370

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  236 bits (119), Expect = 5e-59
 Identities = 161/175 (92%)
 Strand = Plus / Minus

                                                                            
Query: 285      gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 344
                ||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 21539692 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 21539633

                                                                            
Query: 345      atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 404
                ||||| || |||||||||||||||||| | |||||||||||||| |||||||||||||||
Sbjct: 21539632 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 21539573

                                                                       
Query: 405      cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
                |||||||| |||||||| || || ||||| |||||||||||||||||||||||||
Sbjct: 21539572 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcg 21539518



 Score =  115 bits (58), Expect = 1e-22
 Identities = 130/154 (84%)
 Strand = Plus / Minus

                                                                            
Query: 306      ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
                ||||||||||||||||| ||  | | ||||||||||||||| || |||||||||||||| 
Sbjct: 21537032 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 21536973

                                                                            
Query: 366      gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
                ||| |    ||||||||   ||  | ||||||||||||||| || || |||||||| || 
Sbjct: 21536972 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 21536913

                                                  
Query: 426      cgcggcacgatgcgggtcttcttgttgtccctcg 459
                ||||||||||||||||||||||||||||||||||
Sbjct: 21536912 cgcggcacgatgcgggtcttcttgttgtccctcg 21536879

to top

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score =  236 bits (119), Expect = 5e-59
 Identities = 161/175 (92%)
 Strand = Plus / Minus

                                                                         
Query: 285   gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 344
             ||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 77476 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 77417

                                                                         
Query: 345   atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 404
             ||||| || |||||||||||||||||| | |||||||||||||| |||||||||||||||
Sbjct: 77416 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 77357

                                                                    
Query: 405   cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
             |||||||| |||||||| || || ||||| |||||||||||||||||||||||||
Sbjct: 77356 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcg 77302



 Score =  115 bits (58), Expect = 1e-22
 Identities = 130/154 (84%)
 Strand = Plus / Minus

                                                                         
Query: 306   ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
             ||||||||||||||||| ||  | | ||||||||||||||| || |||||||||||||| 
Sbjct: 74816 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 74757

                                                                         
Query: 366   gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
             ||| |    ||||||||   ||  | ||||||||||||||| || || |||||||| || 
Sbjct: 74756 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 74697

                                               
Query: 426   cgcggcacgatgcgggtcttcttgttgtccctcg 459
             ||||||||||||||||||||||||||||||||||
Sbjct: 74696 cgcggcacgatgcgggtcttcttgttgtccctcg 74663

to top

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score =  236 bits (119), Expect = 5e-59
 Identities = 161/175 (92%)
 Strand = Plus / Minus

                                                                       
Query: 285 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 344
           ||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485

                                                                       
Query: 345 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 404
           ||||| || |||||||||||||||||| | |||||||||||||| |||||||||||||||
Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425

                                                                  
Query: 405 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 459
           |||||||| |||||||| || || ||||| |||||||||||||||||||||||||
Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcg 370

to top

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score =  174 bits (88), Expect = 2e-40
 Identities = 160/184 (86%)
 Strand = Plus / Minus

                                                                       
Query: 273 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 332
           ||||| ||||| || |||||||||||||||   ||||||||||||||||| || ||||||
Sbjct: 401 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 342

                                                                       
Query: 333 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 392
           ||||||||||||||||| |||||| ||||||| |||||    ||||||||||| || |||
Sbjct: 341 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 282

                                                                       
Query: 393 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 452
           |||||||||||||| ||||| |||||||| || | ||||||||| || ||||||||||||
Sbjct: 281 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 222

               
Query: 453 tccc 456
           ||||
Sbjct: 221 tccc 218

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  174 bits (88), Expect = 2e-40
 Identities = 160/184 (86%)
 Strand = Plus / Minus

                                                                            
Query: 273      tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 332
                ||||| ||||| || |||||||||||||||   ||||||||||||||||| || ||||||
Sbjct: 20566557 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 20566498

                                                                            
Query: 333      tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 392
                ||||||||||||||||| |||||| ||||||| |||||    ||||||||||| || |||
Sbjct: 20566497 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 20566438

                                                                            
Query: 393      tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 452
                |||||||||||||| ||||| |||||||| || | ||||||||| || ||||||||||||
Sbjct: 20566437 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 20566378

                    
Query: 453      tccc 456
                ||||
Sbjct: 20566377 tccc 20566374



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 118     tacgtactactcctagtaaa 137
               ||||||||||||||||||||
Sbjct: 3543090 tacgtactactcctagtaaa 3543109

to top

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score =  174 bits (88), Expect = 2e-40
 Identities = 160/184 (86%)
 Strand = Plus / Minus

                                                                         
Query: 273   tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 332
             ||||| ||||| || |||||||||||||||   ||||||||||||||||| || ||||||
Sbjct: 70518 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 70459

                                                                         
Query: 333   tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 392
             ||||||||||||||||| |||||| ||||||| |||||    ||||||||||| || |||
Sbjct: 70458 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 70399

                                                                         
Query: 393   tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 452
             |||||||||||||| ||||| |||||||| || | ||||||||| || ||||||||||||
Sbjct: 70398 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 70339

                 
Query: 453   tccc 456
             ||||
Sbjct: 70338 tccc 70335

to top

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score =  174 bits (88), Expect = 2e-40
 Identities = 160/184 (86%)
 Strand = Plus / Minus

                                                                         
Query: 273   tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 332
             ||||| ||||| || |||||||||||||||   ||||||||||||||||| || ||||||
Sbjct: 40929 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 40870

                                                                         
Query: 333   tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 392
             ||||||||||||||||| |||||| ||||||| |||||    ||||||||||| || |||
Sbjct: 40869 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 40810

                                                                         
Query: 393   tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 452
             |||||||||||||| ||||| |||||||| || | ||||||||| || ||||||||||||
Sbjct: 40809 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 40750

                 
Query: 453   tccc 456
             ||||
Sbjct: 40749 tccc 40746

to top

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score =  172 bits (87), Expect = 6e-40
 Identities = 155/177 (87%), Gaps = 3/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 cagccgcggccttggcgctgcctccggc---cttcttggggagcagaaggttgtggatgt 339
           ||||||| |||||||| ||||| ||| |   ||||||||| | ||| ||||| |||||||
Sbjct: 504 cagccgcagccttggcactgccgccgccagacttcttgggcaacagcaggttatggatgt 445

                                                                       
Query: 340 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 399
           ||||||||||||| ||||||||||| || ||| | || |||| |||||||||||||||||
Sbjct: 444 tgggcatgacaccaccgctggcgatggtcaccgtgcccagcaagcgggagagctcctcgt 385

                                                                    
Query: 400 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccc 456
           ||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 384 cgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttcttgttgtccc 328

to top

>gb|AY104637.1| Zea mays PCO070433 mRNA sequence
          Length = 767

 Score =  168 bits (85), Expect = 1e-38
 Identities = 153/175 (87%), Gaps = 3/175 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 cagccgcggccttggcgctgcctccg---gccttcttggggagcagaaggttgtggatgt 339
           ||||||| |||||||||||||| |||   |||||||| ||||| || ||||| |||||||
Sbjct: 504 cagccgcagccttggcgctgccgccgccggccttcttcgggagaagcaggttatggatgt 445

                                                                       
Query: 340 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 399
           ||||||||||||| ||||| ||||| || ||| | || |||| |||||||||||| ||||
Sbjct: 444 tgggcatgacaccaccgctagcgatggtcaccgtgcccagcaagcgggagagctcttcgt 385

                                                                  
Query: 400 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtc 454
           ||||||||||||| |||||||| || ||||| |||||||||||||||||||||||
Sbjct: 384 cgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttcttgttgtc 330

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  131 bits (66), Expect = 2e-27
 Identities = 132/154 (85%)
 Strand = Plus / Plus

                                                                            
Query: 306      ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
                ||||||||||||||||| ||  | | |||||||||||||||||| |||||||||||||| 
Sbjct: 14468520 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14468579

                                                                            
Query: 366      gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
                ||| |    ||||||||   || |||||||||||||||||| || || |||||||| || 
Sbjct: 14468580 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14468639

                                                  
Query: 426      cgcggcacgatgcgggtcttcttgttgtccctcg 459
                |||||||| |||||||||||||||||||||||||
Sbjct: 14468640 cgcggcacaatgcgggtcttcttgttgtccctcg 14468673



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                            
Query: 390      agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
                ||||||||||||||||| || || |||||||| || | ||||||||| ||| ||||||||
Sbjct: 20924512 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20924571

                          
Query: 450      ttgtccctcg 459
                ||||||||||
Sbjct: 20924572 ttgtccctcg 20924581

to top

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  131 bits (66), Expect = 2e-27
 Identities = 132/154 (85%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
           ||||||||||||||||| ||  | | |||||||||||||||||| |||||||||||||| 
Sbjct: 483 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 424

                                                                       
Query: 366 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
           ||| |    ||||||||   || |||||||||||||||||| || || |||||||| || 
Sbjct: 423 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 364

                                             
Query: 426 cgcggcacgatgcgggtcttcttgttgtccctcg 459
           |||||||| |||||||||||||||||||||||||
Sbjct: 363 cgcggcacaatgcgggtcttcttgttgtccctcg 330

to top

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  131 bits (66), Expect = 2e-27
 Identities = 132/154 (85%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
           ||||||||||||||||| ||  | | |||||||||||||||||| |||||||||||||| 
Sbjct: 482 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 423

                                                                       
Query: 366 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
           ||| |    ||||||||   || |||||||||||||||||| || || |||||||| || 
Sbjct: 422 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 363

                                             
Query: 426 cgcggcacgatgcgggtcttcttgttgtccctcg 459
           |||||||| |||||||||||||||||||||||||
Sbjct: 362 cgcggcacaatgcgggtcttcttgttgtccctcg 329

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  131 bits (66), Expect = 2e-27
 Identities = 132/154 (85%)
 Strand = Plus / Plus

                                                                            
Query: 306      ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
                ||||||||||||||||| ||  | | |||||||||||||||||| |||||||||||||| 
Sbjct: 14422804 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14422863

                                                                            
Query: 366      gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
                ||| |    ||||||||   || |||||||||||||||||| || || |||||||| || 
Sbjct: 14422864 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14422923

                                                  
Query: 426      cgcggcacgatgcgggtcttcttgttgtccctcg 459
                |||||||| |||||||||||||||||||||||||
Sbjct: 14422924 cgcggcacaatgcgggtcttcttgttgtccctcg 14422957



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                            
Query: 390      agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
                ||||||||||||||||| || || |||||||| || | ||||||||| ||| ||||||||
Sbjct: 20850726 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20850785

                          
Query: 450      ttgtccctcg 459
                ||||||||||
Sbjct: 20850786 ttgtccctcg 20850795

to top

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score =  131 bits (66), Expect = 2e-27
 Identities = 132/154 (85%)
 Strand = Plus / Minus

                                                                         
Query: 306   ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
             ||||||||||||||||| ||  | | |||||||||||||||||| |||||||||||||| 
Sbjct: 48772 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 48713

                                                                         
Query: 366   gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
             ||| |    ||||||||   || |||||||||||||||||| || || |||||||| || 
Sbjct: 48712 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 48653

                                               
Query: 426   cgcggcacgatgcgggtcttcttgttgtccctcg 459
             |||||||| |||||||||||||||||||||||||
Sbjct: 48652 cgcggcacaatgcgggtcttcttgttgtccctcg 48619

to top

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  115 bits (58), Expect = 1e-22
 Identities = 130/154 (84%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
           ||||||||||||||||| ||  | | ||||||||||||||| || |||||||||||||| 
Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458

                                                                       
Query: 366 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
           ||| |    ||||||||   ||  | ||||||||||||||| || || |||||||| || 
Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398

                                             
Query: 426 cgcggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||||||||||||||||||||||||||||
Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcg 364

to top

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score =  115 bits (58), Expect = 1e-22
 Identities = 130/154 (84%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
           ||||||||||||||||| ||  | | ||||||||||||||| || |||||||||||||| 
Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458

                                                                       
Query: 366 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
           ||| |    ||||||||   ||  | ||||||||||||||| || || |||||||| || 
Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398

                                             
Query: 426 cgcggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||||||||||||||||||||||||||||
Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcg 364

to top

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score =  115 bits (58), Expect = 1e-22
 Identities = 130/154 (84%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 365
           ||||||||||||||||| ||  | | ||||||||||||||| || |||||||||||||| 
Sbjct: 518 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 459

                                                                       
Query: 366 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 425
           ||| |    ||||||||   ||  | ||||||||||||||| || || |||||||| || 
Sbjct: 458 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 399

                                             
Query: 426 cgcggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||||||||||||||||||||||||||||
Sbjct: 398 cgcggcacgatgcgggtcttcttgttgtccctcg 365

to top

>gb|AY104826.1| Zea mays PCO099353 mRNA sequence
          Length = 793

 Score =  109 bits (55), Expect = 8e-21
 Identities = 127/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 368
           |||||||||||||| ||  | | ||||||||||||||| || |||||||| ||||| |||
Sbjct: 464 gccttcttggggaggaggtgctggtggatgttgggcataacgccgccgctcgcgatggtg 405

                                                                       
Query: 369 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 428
            |   ||| |||||   ||  ||||||||||||||||| ||||| |||||||| || |||
Sbjct: 404 gcaccaccaagcagcttggtcagctcctcgtcgttgcgcacggcgagctggatgtgacgc 345

                                          
Query: 429 ggcacgatgcgggtcttcttgttgtccctcg 459
           ||||||||||||||||||||||| |||||||
Sbjct: 344 ggcacgatgcgggtcttcttgttatccctcg 314

to top

>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene
          Length = 2241

 Score =  107 bits (54), Expect = 3e-20
 Identities = 126/150 (84%)
 Strand = Plus / Minus

                                                                        
Query: 308  ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 367
            ||||||||||||||| ||  | | ||||||||||||||| ||||||||||||||||| ||
Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675

                                                                        
Query: 368  gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 427
            | |    |||||||    ||  ||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615

                                          
Query: 428  cggcacgatgcgggtcttcttgttgtccct 457
            ||||||||| ||||||||||||||||||||
Sbjct: 1614 cggcacgatacgggtcttcttgttgtccct 1585

to top

>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds
          Length = 2241

 Score =  107 bits (54), Expect = 3e-20
 Identities = 126/150 (84%)
 Strand = Plus / Minus

                                                                        
Query: 308  ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 367
            ||||||||||||||| ||  | | ||||||||||||||| ||||||||||||||||| ||
Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675

                                                                        
Query: 368  gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 427
            | |    |||||||    ||  ||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615

                                          
Query: 428  cggcacgatgcgggtcttcttgttgtccct 457
            ||||||||| ||||||||||||||||||||
Sbjct: 1614 cggcacgatacgggtcttcttgttgtccct 1585

to top

>gb|AY104828.1| Zea mays PCO072413 mRNA sequence
          Length = 741

 Score =  101 bits (51), Expect = 2e-18
 Identities = 126/151 (83%)
 Strand = Plus / Minus

                                                                       
Query: 309 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 368
           |||||||||||||||||| | |  |||||||| ||||| ||||| ||||| ||||| |||
Sbjct: 422 gccttcttggggagcagatgctgatggatgttaggcataacacctccgctcgcgatggtg 363

                                                                       
Query: 369 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 428
            |   ||| | |||   ||  ||||||||||||||||| || ||||||||||| || |||
Sbjct: 362 gcaccacccaacagtttggtcagctcctcgtcgttgcgcacagcaagctggatgtggcgc 303

                                          
Query: 429 ggcacgatgcgggtcttcttgttgtccctcg 459
           ||||| |||||||||||||||||||||||||
Sbjct: 302 ggcacaatgcgggtcttcttgttgtccctcg 272

to top

>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence
          Length = 712

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 393 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 452
           |||||||||||||| ||||| |||||||| || ||||||||||||||| |||||||||||
Sbjct: 354 tcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcggttcttcttgttg 413

             
Query: 453 tc 454
           ||
Sbjct: 414 tc 415

to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                        
Query: 390  agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
            ||||||||||||||||||| ||| |||||||| || || |||||||||||| ||||||||
Sbjct: 4081 agctcctcgtcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 4022

                 
Query: 450  ttgtc 454
            |||||
Sbjct: 4021 ttgtc 4017

to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| |||||||| || ||||| ||||||||| ||||||||
Sbjct: 550 agctcctcgtcgttgcggatggcgagctggatgtggcgcgggacgatgcggttcttcttg 609

                
Query: 450 ttgtc 454
           |||||
Sbjct: 610 ttgtc 614

to top

>ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC614970), mRNA
          Length = 447

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| | ||| ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgggtcttctt 223

                   
Query: 449 gttgtccc 456
           ||||||||
Sbjct: 222 gttgtccc 215

to top

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                         
Query: 390   agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
             ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 38405 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 38346

                       
Query: 450   ttgtccctcg 459
             ||||||||||
Sbjct: 38345 ttgtccctcg 38336

to top

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                          
Query: 390    agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
              ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 141027 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 141086

                        
Query: 450    ttgtccctcg 459
              ||||||||||
Sbjct: 141087 ttgtccctcg 141096

to top

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                          
Query: 390    agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
              ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 181559 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 181500

                        
Query: 450    ttgtccctcg 459
              ||||||||||
Sbjct: 181499 ttgtccctcg 181490

to top

>gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MGC:17204
           IMAGE:4342191), complete cds
          Length = 2256

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 301 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 242

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 241 gttgtc 236

to top

>gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IMAGE:5314244),
           partial cds
          Length = 2270

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA
          Length = 2267

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                            
Query: 390      agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
                ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 28998264 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 28998205

                          
Query: 450      ttgtccctcg 459
                ||||||||||
Sbjct: 28998204 ttgtccctcg 28998195

to top

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 56658 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 56599

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 56598 gttgtc 56593



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 70715 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 70656

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 70655 gttgtc 70650

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                            
Query: 390      agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
                ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 29089686 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 29089627

                          
Query: 450      ttgtccctcg 459
                ||||||||||
Sbjct: 29089626 ttgtccctcg 29089617

to top

>gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, complete cds
          Length = 1173

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 674 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 615

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 614 gttgtc 609

to top

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||| || || |||||||| || | ||||||||| ||| ||||||||
Sbjct: 400 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 341

                     
Query: 450 ttgtccctcg 459
           ||||||||||
Sbjct: 340 ttgtccctcg 331

to top

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||| || || |||||||| || ||||||||||| | | ||||||||
Sbjct: 397 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 338

                     
Query: 450 ttgtccctcg 459
           ||||||||||
Sbjct: 337 ttgtccctcg 328

to top

>gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds
          Length = 2250

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                         
Query: 390   agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
             ||||||||||||||||| || || |||||||| || | ||||||||| ||| ||||||||
Sbjct: 10002 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 10061

                       
Query: 450   ttgtccctcg 459
             ||||||||||
Sbjct: 10062 ttgtccctcg 10071

to top

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                         
Query: 390   agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
             ||||||||||||||||| || || |||||||| || | ||||||||| ||| ||||||||
Sbjct: 34483 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 34424

                       
Query: 450   ttgtccctcg 459
             ||||||||||
Sbjct: 34423 ttgtccctcg 34414

to top

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome
            6
          Length = 20621

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| || |||| ||| ||||| | |||||||||||||||
Sbjct: 5859 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 5800

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 5799 gttgtc 5794



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 19916 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 19857

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 19856 gttgtc 19851

to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                        
Query: 390  agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
            |||||||| |||||||||| ||| |||||||| || || |||||||||||| ||||||||
Sbjct: 3500 agctcctcatcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 3441

                 
Query: 450  ttgtc 454
            |||||
Sbjct: 3440 ttgtc 3436

to top

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtgacgcgggatgatgcgggtcttctt 223

                   
Query: 449 gttgtccc 456
           ||||||||
Sbjct: 222 gttgtccc 215

to top

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243

                   
Query: 449 gttgtccc 456
           ||||||||
Sbjct: 242 gttgtccc 235

to top

>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence
          Length = 676

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           |||||||||||||| || || || |||||||| || ||||||||||| ||| ||||||||
Sbjct: 382 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 323

                  
Query: 450 ttgtccc 456
           |||||||
Sbjct: 322 ttgtccc 316

to top

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 222 gttgtccctcg 212

to top

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 222 gttgtccctcg 212

to top

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 296 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 237

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 236 gttgtccctcg 226

to top

>gb|AY105006.1| Zea mays PCO108932 mRNA sequence
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           |||||||||||||| || || || |||||||| || ||||||||||| ||| ||||||||
Sbjct: 370 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 311

                  
Query: 450 ttgtccc 456
           |||||||
Sbjct: 310 ttgtccc 304

to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 168 gttgtc 163

to top

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893
           IMAGE:40031340), complete cds
          Length = 438

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l (H2A/l), transcript
           variant 1 (LOC506900), mRNA
          Length = 1039

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| | ||| ||||| | ||| |||||||||||
Sbjct: 320 gagctcctcgtcgttgcggatggccagctgtaaatggcgcgggatgatacgggtcttctt 261

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 260 gttgtc 255

to top

>ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l (H2A/l), transcript
           variant 2 (LOC506900), mRNA
          Length = 703

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| | ||| ||||| | ||| |||||||||||
Sbjct: 320 gagctcctcgtcgttgcggatggccagctgtaaatggcgcgggatgatacgggtcttctt 261

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 260 gttgtc 255

to top

>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with
           apparent retained intron
          Length = 2884

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 258 gttgtc 253

to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 56334 gttgtc 56329



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 86021 gttgtc 86026



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 79933 gttgtc 79928



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 28876 gttgtc 28881



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1524 gttgtc 1519

to top

>ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA
          Length = 460

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
            Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
            H2AFN, and H2BFN histone genes, the OR2B2 gene for
            olfactory receptor 2B2, histone H2B family member I
            pseudogene H2BFIP, a hypothetical protein pseudogene,
            ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 1799 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 1858

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1859 gttgtc 1864



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 56609 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 56668

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 56669 gttgtc 56674



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 29377 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 29318

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 29317 gttgtc 29312

to top

>emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene
          Length = 650

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 425 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 366

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 365 gttgtc 360

to top

>gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, complete cds
          Length = 1119

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 596

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 595 gttgtc 590

to top

>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501
          Length = 1723

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 358

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 359 gttgtc 364

to top

>gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.01X histone 1 H2ak
           (HIST1H2AK) mRNA, complete cds
          Length = 393

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||
Sbjct: 45202 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 45261

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 45262 gttgtc 45267



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 70501 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 70442

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 70441 gttgtc 70436



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 64608 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64667

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 64668 gttgtc 64673

to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||
Sbjct: 55491 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 55432

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 55431 gttgtc 55426



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 36085 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 36026

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 36025 gttgtc 36020



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 30192 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 30251

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 30252 gttgtc 30257

to top

>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af
           (LOC471884), mRNA
          Length = 420

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  || ||||| | ||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttg 222

                
Query: 450 ttgtc 454
           |||||
Sbjct: 221 ttgtc 217

to top

>ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H2A.g (H2A/g) (H2A.3)
           (LOC462493), mRNA
          Length = 1052

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 331 agctcctcgtcgttgcggatggctagctgcaggtgtcgggggatgatgcgggtcttcttg 272

                
Query: 450 ttgtc 454
           |||||
Sbjct: 271 ttgtc 267

to top

>gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC:45668
           IMAGE:3608479), complete cds
          Length = 890

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 250 agctcctcgtcgttgcggatggccagctgcaagtgtcgggggatgatgcgggtcttcttg 191

                
Query: 450 ttgtc 454
           |||||
Sbjct: 190 ttgtc 186

to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                          
Query: 390    agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
              ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022

                   
Query: 450    ttgtc 454
              |||||
Sbjct: 183023 ttgtc 183027



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 108396 gttgtc 108391



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                          
Query: 390    agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
              ||||||||||||||||||| ||| ||||| |  || ||||| | ||||||||||||||| 
Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 201196

                   
Query: 450    ttgtc 454
              |||||
Sbjct: 201195 ttgtc 201191



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                         
Query: 390   agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
             ||||||||||| ||||||| ||| |  || |  || ||||| | ||||||||||||||||
Sbjct: 17230 agctcctcgtcattgcggatggccaattgcaggtggcgcgggatgatgcgggtcttcttg 17289

                  
Query: 450   ttgtc 454
             |||||
Sbjct: 17290 ttgtc 17294

to top

>ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA
          Length = 864

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 274 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 215

                
Query: 450 ttgtc 454
           |||||
Sbjct: 214 ttgtc 210

to top

>ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA
          Length = 460

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222

                
Query: 450 ttgtc 454
           |||||
Sbjct: 221 ttgtc 217

to top

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
            Contains seventeen histone (pseudo)genes and gene RPS10P1
            (40S Ribosomal protein S10 pseudogene 1), three CpG
            islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 390  agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
            ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 4345 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 4404

                 
Query: 450  ttgtc 454
            |||||
Sbjct: 4405 ttgtc 4409



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 390   agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
             ||||||||||||||||||| ||| ||||| |  || ||||| | ||||||||||||||| 
Sbjct: 22637 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 22578

                  
Query: 450   ttgtc 454
             |||||
Sbjct: 22577 ttgtc 22573

to top

>emb|Z80776.1|HSH2AG H.sapiens H2A/g gene
          Length = 840

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 479 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 420

                
Query: 450 ttgtc 454
           |||||
Sbjct: 419 ttgtc 415

to top

>emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A
          Length = 470

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 284 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 225

                
Query: 450 ttgtc 454
           |||||
Sbjct: 224 ttgtc 220

to top

>gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MGC:120842
           IMAGE:7939652), complete cds
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 320 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 261

                
Query: 450 ttgtc 454
           |||||
Sbjct: 260 ttgtc 256

to top

>emb|CR541999.1| Homo sapiens full open reading frame cDNA clone RZPDo834C1135D for
           gene HIST1H3D, histone 1, H3d; complete cds, without
           stopcodon
          Length = 390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222

                
Query: 450 ttgtc 454
           |||||
Sbjct: 221 ttgtc 217

to top

>emb|CR541970.1| Homo sapiens full open reading frame cDNA clone RZPDo834G1134D for
           gene HIST1H3D, histone 1, H3d; complete cds, incl.
           stopcodon
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222

                
Query: 450 ttgtc 454
           |||||
Sbjct: 221 ttgtc 217

to top

>gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MGC:120844
           IMAGE:7939654), complete cds
          Length = 473

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 323 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 264

                
Query: 450 ttgtc 454
           |||||
Sbjct: 263 ttgtc 259

to top

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||||
Sbjct: 278 agctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttcttg 219

                
Query: 450 ttgtc 454
           |||||
Sbjct: 218 ttgtc 214

to top

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||||
Sbjct: 392 agctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttcttg 333

                
Query: 450 ttgtc 454
           |||||
Sbjct: 332 ttgtc 328

to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 390  agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
            |||||||| |||||||||| ||| |||||||| || || ||||| |||||| ||||||||
Sbjct: 3194 agctcctcatcgttgcggatggccagctggatgtggcgaggcacaatgcggttcttcttg 3253

                 
Query: 450  ttgtc 454
            |||||
Sbjct: 3254 ttgtc 3258

to top

>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds
          Length = 1442

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||| ||||||| ||| | ||||||||| || || ||||||||| ||||||||
Sbjct: 267 agctcctcgtcattgcggatggccaactggatatggcgtgggacgatgcggttcttcttg 326

                
Query: 450 ttgtc 454
           |||||
Sbjct: 327 ttgtc 331

to top

>gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, complete cds
          Length = 1119

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 390 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
           ||||||||||||||||||| ||| ||||| |  ||||| || | ||||||||||||||||
Sbjct: 654 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 595

                
Query: 450 ttgtc 454
           |||||
Sbjct: 594 ttgtc 590

to top

>ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618147), mRNA
          Length = 434

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||| ||||||||||||| ||| ||||| |  || ||||| | |||||||||||||||
Sbjct: 323 gagctcttcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 264

                   
Query: 449 gttgtccc 456
           ||||||||
Sbjct: 263 gttgtccc 256

to top

>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA
          Length = 522

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgcgtcttctt 224

                   
Query: 449 gttgtccc 456
           ||||||||
Sbjct: 223 gttgtccc 216

to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||||||  | |  || ||||| | |||||||||||||||
Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355

                  
Query: 449 gttgtcc 455
           |||||||
Sbjct: 354 gttgtcc 348

to top

>gb|AY389710.1| Hyacinthus orientalis histone H2A mRNA, partial cds
          Length = 677

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 121/151 (80%)
 Strand = Plus / Minus

                                                                       
Query: 309 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 368
           |||||||| |||||||  |||||||||||||||||||| ||||| ||| | ||||| || 
Sbjct: 453 gccttcttcgggagcaagaggttgtggatgttgggcatcacacctccgtttgcgatggtc 394

                                                                       
Query: 369 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 428
           ||||| || |  ||    || |||||||| ||||| |  || || |||||||| || || 
Sbjct: 393 accatccccaagagcttcgacagctcctcatcgttcctcaccgcgagctggatgtgacgt 334

                                          
Query: 429 ggcacgatgcgggtcttcttgttgtccctcg 459
           |||||||| | ||||||||||||||| ||||
Sbjct: 333 ggcacgatcctggtcttcttgttgtctctcg 303

to top

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 239 gttgtccctcg 229

to top

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 378 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 319

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 318 gttgtccctcg 308

to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 108662 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 108721

                         
Query: 449    gttgtccctcg 459
              |||||||||||
Sbjct: 108722 gttgtccctcg 108732

to top

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||| ||||||||||||||| ||| | |  || ||||| | |||||||||||||||
Sbjct: 2157 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttctt 2098

                   
Query: 449  gttgtcc 455
            |||||||
Sbjct: 2097 gttgtcc 2091

to top

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||| ||||||||||||||| ||| | |  || ||||| | |||||||||||||||
Sbjct: 2157 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttctt 2098

                   
Query: 449  gttgtcc 455
            |||||||
Sbjct: 2097 gttgtcc 2091

to top

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 239 gttgtccctcg 229

to top

>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted)
           (Hist1h2ao_predicted), mRNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||| ||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcggaatgatgcgtgtcttttt 223

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 222 gttgtccctcg 212

to top

>ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971
           (ENSANGG00000013482), partial mRNA
          Length = 372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 451
           ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||||||
Sbjct: 273 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 214

              
Query: 452 gtc 454
           |||
Sbjct: 213 gtc 211

to top

>ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967
           (ENSANGG00000013478), partial mRNA
          Length = 375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 451
           ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||||||
Sbjct: 276 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 217

              
Query: 452 gtc 454
           |||
Sbjct: 216 gtc 214

to top

>ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043
           (ENSANGG00000009554), partial mRNA
          Length = 375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 451
           ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||||||
Sbjct: 276 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 217

              
Query: 452 gtc 454
           |||
Sbjct: 216 gtc 214

to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||||||  | |  || ||||| | |||||||||||||||
Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355

                  
Query: 449 gttgtcc 455
           |||||||
Sbjct: 354 gttgtcc 348

to top

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 356 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 297

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 296 gttgtccctcg 286

to top

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || || || | |||||| ||||||||
Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 275

                      
Query: 449 gttgtccctcg 459
           |||||||||||
Sbjct: 274 gttgtccctcg 264

to top

>ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471909),
           mRNA
          Length = 537

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 367

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 366 gttgtc 361

to top

>ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa1 protein
           (LOC471905), mRNA
          Length = 555

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 444 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 385

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 384 gttgtc 379

to top

>ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histone family, member E
           (LOC471903), mRNA
          Length = 372

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 267 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 208

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 207 gttgtc 202

to top

>ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471895),
           mRNA
          Length = 387

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471894),
           mRNA
          Length = 372

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 261 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 202

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 201 gttgtc 196

to top

>ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462506),
           mRNA
          Length = 792

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 333 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 274

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 273 gttgtc 268

to top

>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l)
           (LOC462490), mRNA
          Length = 565

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 265

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 264 gttgtc 259

to top

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 265 gttgtc 260

to top

>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462
          Length = 2706

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 300 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 241

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 240 gttgtc 235

to top

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 264 gttgtc 259

to top

>gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730
           IMAGE:2988620), complete cds
          Length = 1656

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 275

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 274 gttgtc 269

to top

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 254 gttgtc 249

to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 249 gttgtc 244

to top

>gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MGC:97481
           IMAGE:7262757), complete cds
          Length = 469

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 248 gttgtc 243

to top

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 329 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 270

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 269 gttgtc 264

to top

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 249 gttgtc 244

to top

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 264 gttgtc 259

to top

>ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA
          Length = 439

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA
          Length = 439

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA
          Length = 487

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 259

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 258 gttgtc 253

to top

>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA
          Length = 546

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 370 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 311

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 310 gttgtc 305

to top

>ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA
          Length = 470

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 248 gttgtc 243

to top

>ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA
          Length = 469

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 293 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 234

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 233 gttgtc 228

to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 101186 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 101245

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 101246 gttgtc 101251



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 64551 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64492

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 64491 gttgtc 64486



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 60626 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60685

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 60686 gttgtc 60691

to top

>gb|AY573602.1| Toxoplasma gondii histone H2A.1 gene, complete cds
          Length = 782

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 75/90 (83%)
 Strand = Plus / Minus

                                                                       
Query: 332 gtggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagag 391
           ||||| ||||||||||||||| ||||||||||| || ||    ||||| |    ||||||
Sbjct: 500 gtggacgttgggcatgacaccaccgctggcgatggtcactccgccgaggaacttggagag 441

                                         
Query: 392 ctcctcgtcgttgcggacggcaagctggat 421
            |||||||||||||||||||| ||||||||
Sbjct: 440 ttcctcgtcgttgcggacggccagctggat 411

to top

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 764 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 705

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 704 gttgtc 699

to top

>gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002043),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002040),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002042),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002046),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002045),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002044),
           partial cds
          Length = 404

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 345 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 286

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 285 gttgtc 280

to top

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 429 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 370

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 369 gttgtc 364

to top

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 351 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 292

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 291 gttgtc 286

to top

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 306 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 247

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 246 gttgtc 241

to top

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC670497), mRNA
          Length = 3003

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 229

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 228 gttgtc 223

to top

>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC667728), mRNA
          Length = 3054

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 339 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 280

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 279 gttgtc 274

to top

>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC677006), mRNA
          Length = 2991

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 276 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 217

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 216 gttgtc 211

to top

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 254 gttgtc 249

to top

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 316 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 257

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 256 gttgtc 251

to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 249 gttgtc 244

to top

>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds
          Length = 819

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 249

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 248 gttgtc 243

to top

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|XM_569065.1| Cryptococcus neoformans var. neoformans JEC21 histone H2A-1
           (CNB00550) partial mRNA
          Length = 544

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||| |||||||| |||||||||||||| |  ||||| || ||||| |||| ||||||
Sbjct: 342 gagctcttcgtcgtttcggacggcaagctgaaggtgtcgggggacgatacgggacttctt 283

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 282 gttgtc 277

to top

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 149732 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 149791

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 149792 gttgtc 149797

to top

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 329 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 270

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 269 gttgtc 264

to top

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 253 gttgtc 248

to top

>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds
          Length = 1680

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 490 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 431

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 430 gttgtc 425

to top

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 30837 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 30778

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 30777 gttgtc 30772

to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 100829 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 100770

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 100769 gttgtc 100764

to top

>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2
            Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs,
            STSs, GSSs and three CpG islands, complete sequence
          Length = 24706

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 2806 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 2865

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 2866 gttgtc 2871

to top

>gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter sequence
          Length = 457

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 110 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 51

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 50  gttgtc 45

to top

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 136642 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 136583

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 136582 gttgtc 136577

to top

>emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene
          Length = 786

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 396 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 337

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 336 gttgtc 331

to top

>emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene
          Length = 625

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 468 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 409

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 408 gttgtc 403

to top

>emb|Z80778.1|HSH2AL H.sapiens H2A/l gene
          Length = 601

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 421 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 362

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 361 gttgtc 356

to top

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 908 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 849

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 848 gttgtc 843

to top

>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial)
          Length = 523

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 245

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 244 gttgtc 239

to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1098 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1039

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1038 gttgtc 1033

to top

>emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A
          Length = 776

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 534 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 475

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 474 gttgtc 469

to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1855 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1796

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1795 gttgtc 1790

to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1139 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1080

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1079 gttgtc 1074

to top

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 1373 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1314

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1313 gttgtc 1308

to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1230 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1171

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1170 gttgtc 1165

to top

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1231 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1172

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1171 gttgtc 1166

to top

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 292 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 233

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 232 gttgtc 227

to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 164051 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 164110

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 164111 gttgtc 164116



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 55358 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 55299

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 55298 gttgtc 55293



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 51433 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 51492

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 51493 gttgtc 51498



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 14794 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 14735

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 14734 gttgtc 14729

to top

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 266 gttgtc 261

to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 33361 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 33420

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 33421 gttgtc 33426



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 10915 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 10856

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 10855 gttgtc 10850

to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 60002 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60061

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 60062 gttgtc 60067



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 52627 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 52686

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 52687 gttgtc 52692

to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 207927 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 207986

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 207987 gttgtc 207992



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 142528 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142587

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 142588 gttgtc 142593



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 137693 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137634

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 137633 gttgtc 137628



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||| ||||||||
Sbjct: 174536 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttctt 174595

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 174596 gttgtc 174601

to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 142102 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142043

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 142042 gttgtc 142037



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 136964 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137023

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 137024 gttgtc 137029

to top

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 244 gttgtc 239

to top

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 323 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 264

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 263 gttgtc 258

to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 389    gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
              |||||| |||||||| |||||||||||||| |  ||||| || ||||| |||| ||||||
Sbjct: 161666 gagctcttcgtcgtttcggacggcaagctgaaggtgtcgggggacgatacgggacttctt 161725

                    
Query: 449    gttgtc 454
              ||||||
Sbjct: 161726 gttgtc 161731

to top

>emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1446

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1462

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 252 gttgtc 247

to top

>gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA
          Length = 1138

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 333 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 274

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 273 gttgtc 268

to top

>emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1620

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 298 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 239

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 238 gttgtc 233

to top

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 315 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 256

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 255 gttgtc 250

to top

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 234 gttgtc 229

to top

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 253 gttgtc 248

to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
             hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
             sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 389   gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
             |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 16545 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 16604

                   
Query: 449   gttgtc 454
             ||||||
Sbjct: 16605 gttgtc 16610



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                          
Query: 390    agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 449
              ||||||||||| ||||||| ||| |  || |  || ||||| | ||||||||||||||||
Sbjct: 107771 agctcctcgtcattgcggatggccaattgcaggtggcgcgggatgatgcgggtcttcttg 107712

                   
Query: 450    ttgtc 454
              |||||
Sbjct: 107711 ttgtc 107707

to top

>gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA, complete cds
          Length = 1666

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 379 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 320

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 319 gttgtc 314

to top

>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930118D21 product:unclassifiable, full
           insert sequence
          Length = 2833

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 520 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 579

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 580 gttgtc 585

to top

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 327 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 268

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 267 gttgtc 262

to top

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 234 gttgtc 229

to top

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 234 gttgtc 229

to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 552 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 493

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 492 gttgtc 487

to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 550 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 491

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 490 gttgtc 485

to top

>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700048I17 product:histone gene complex
           2, full insert sequence
          Length = 578

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 265 gttgtc 260

to top

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 244 gttgtc 239

to top

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 335 gttgtc 330

to top

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 352 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 293

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 292 gttgtc 287

to top

>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932439K17 product:histone gene complex
           2, full insert sequence
          Length = 2876

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 140 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 81

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 80  gttgtc 75

to top

>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610031H01 product:histone gene complex
           2, full insert sequence
          Length = 545

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 266 gttgtc 261

to top

>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930558E18 product:histone gene complex
           2, full insert sequence
          Length = 1059

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 100 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 159

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 160 gttgtc 165

to top

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||| ||||| ||||| |  || || || | |||||||||||||||
Sbjct: 1087 gagctcctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgggtcttctt 1028

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1027 gttgtc 1022

to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1229

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1228 gttgtc 1223

to top

>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone
            H2b-613 (H2b) genes, complete cds
          Length = 2618

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1311 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1370

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1371 gttgtc 1376

to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                        
Query: 389  gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
            |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 1547 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1606

                  
Query: 449  gttgtc 454
            ||||||
Sbjct: 1607 gttgtc 1612

to top

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 349 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 290

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 289 gttgtc 284

to top

>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210403F13 product:histone gene complex
           2, full insert sequence
          Length = 2428

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 578 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 637

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 638 gttgtc 643

to top

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 335 gttgtc 330

to top

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 266 gttgtc 261

to top

>gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120886
           IMAGE:7939696), complete cds
          Length = 457

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 269 gttgtc 264

to top

>gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120884
           IMAGE:7939694), complete cds
          Length = 457

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 269 gttgtc 264

to top

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 222 gttgtc 217

to top

>gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, complete cds
          Length = 1119

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||||||||| ||
Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 596

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 595 gttgtc 590

to top

>gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, complete cds
          Length = 1173

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| |  ||||||||||||||
Sbjct: 674 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 615

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 614 gttgtc 609

to top

>gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, complete cds
          Length = 1119

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 655 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 596

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 595 gttgtc 590

to top

>gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, complete cds
          Length = 1173

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           ||||||||| |||||||||| ||| |||||||  || ||||| | |||||| ||||||||
Sbjct: 674 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 615

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 614 gttgtc 609

to top

>gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, complete cds
          Length = 1155

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| || ||||  || ||||| | ||| |||||||||||
Sbjct: 668 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 609

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 608 gttgtc 603

to top

>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds
          Length = 1440

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 502 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 561

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 562 gttgtc 567

to top

>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds
          Length = 1387

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 719 gttgtc 714

to top

>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds
          Length = 1387

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 719 gttgtc 714

to top

>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds
          Length = 1200

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 590 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 531

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 530 gttgtc 525

to top

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717

to top

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717

to top

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717

to top

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717

to top

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 806 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 747

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 746 gttgtc 741

to top

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 781 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 722

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 721 gttgtc 716

to top

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 719 gttgtc 714

to top

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717

to top

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 389 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 448
           |||||||||||||||||||| ||| ||||| |  || ||||| | |||||| ||||||||
Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723

                 
Query: 449 gttgtc 454
           ||||||
Sbjct: 722 gttgtc 717


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,611,145
Number of Sequences: 3902068
Number of extensions: 2611145
Number of successful extensions: 53670
Number of sequences better than 10.0: 540
Number of HSP's better than 10.0 without gapping: 531
Number of HSP's successfully gapped in prelim test: 13
Number of HSP's that attempted gapping in prelim test: 52198
Number of HSP's gapped (non-prelim): 1380
length of query: 459
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 437
effective length of database: 17,147,199,772
effective search space: 7493326300364
effective search space used: 7493326300364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result