Clone Information

BLAST Search Result

Clone Name	rbasd21g12
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|DQ167203.2\| Triticum aestivum eukaryotic translation initiati...	309	2e-81
2	gb\|DQ234393.1\| Aegilops tauschii translation initiation factor 5...	143	2e-31
3	gb\|DQ234392.1\| Thinopyrum intermedium translation initiation fac...	143	2e-31
4	gb\|DQ167202.1\| Triticum aestivum eukaryotic translation initiati...	143	2e-31
5	gb\|DQ167201.1\| Triticum aestivum eukaryotic translation initiati...	143	2e-31
6	gb\|DQ234394.1\| Secale sylvestre translation initiation factor 5A...	135	6e-29
7	gb\|DQ234391.1\| Secale cereale translation initiation factor 5A m...	135	6e-29
8	gb\|DQ234390.1\| Dasypyrum breviaristatum translation initiation f...	121	9e-25
9	gb\|AC151350.2\| Xenopus tropicalis clone ISB-400N1, complete sequ...	54	2e-04
10	gb\|AC124492.4\| Mus musculus BAC clone RP23-454I23 from chromosom...	50	0.003
11	emb\|AL731765.5\| Human DNA sequence from clone RP11-268L7 on chro...	50	0.003
12	gb\|AC153657.4\| Mus musculus BAC clone RP23-324B3 from chromosome...	50	0.003
13	gb\|AC142328.1\| Pan troglodytes BAC clone RP43-24E4 from 7, compl...	48	0.011
14	emb\|AL391134.13\| Human DNA sequence from clone RP11-245M24 on ch...	48	0.011
15	emb\|BX547935.12\| Zebrafish DNA sequence from clone CH211-207C1 i...	48	0.011
16	emb\|BX950219.10\| Mouse DNA sequence from clone RP23-303E24 on ch...	48	0.011
17	gb\|AC102666.13\| Mus musculus chromosome 1, clone RP23-444A8, com...	48	0.011
18	gb\|AC107677.7\| Mus musculus chromosome 3, clone RP23-235F22, com...	46	0.043
19	gb\|AC156576.3\| Mus musculus BAC clone RP23-7C22 from chromosome ...	46	0.043
20	gb\|AC122820.4\| Mus musculus BAC clone RP23-200M5 from chromosome...	46	0.043
21	gb\|AC124486.4\| Mus musculus BAC clone RP23-451E1 from chromosome...	46	0.043
22	gb\|AC124501.3\| Mus musculus BAC clone RP23-412F10 from chromosom...	46	0.043
23	gb\|AC101142.9\| Mus musculus chromosome 13, clone RP23-170P21, co...	46	0.043
24	emb\|AL683870.15\| Human DNA sequence from clone RP11-261P4 on chr...	46	0.043
25	gb\|AC114933.2\| Homo sapiens chromosome 5 clone CTD-2023M8, compl...	46	0.043
26	gb\|AC164168.3\| Mus musculus 6 BAC RP23-343D21 (Roswell Park Canc...	46	0.043
27	gb\|AC164662.6\| Mus musculus 10 BAC RP24-279D11 (Roswell Park Can...	46	0.043
28	gb\|AC098642.5\| Genomic sequence for Mus musculus, clone RP23-270...	46	0.043
29	gb\|AC084407.10\| Mus Musculus Strain C57BL6/J Chromosome 11 Clone...	46	0.043
30	gb\|AC154817.2\| Mus musculus BAC clone RP23-72G6 from chromosome ...	46	0.043
31	gb\|AC153496.4\| Mus musculus 10 BAC RP23-373D1 (Roswell Park Canc...	46	0.043
32	emb\|BX901950.7\| Zebrafish DNA sequence from clone DKEY-111C4 in ...	46	0.043
33	emb\|AL929209.17\| Mouse DNA sequence from clone RP23-415C3 on chr...	46	0.043
34	emb\|CT030739.10\| Mouse DNA sequence from clone RP24-496K8 on chr...	46	0.043
35	gb\|AC140301.3\| Mus musculus BAC clone RP23-435M8 from 5, complet...	46	0.043
36	emb\|AL606704.20\| Mouse DNA sequence from clone RP23-375B1 on chr...	46	0.043
37	emb\|AL672188.6\| Mouse DNA sequence from clone RP23-53B2 on chrom...	46	0.043
38	gb\|AC115013.18\| Mus musculus chromosome 10, clone RP24-193P19, c...	44	0.17
39	gb\|AC105979.13\| Mus musculus chromosome 14, clone RP24-301E12, c...	44	0.17
40	gb\|AC130828.4\| Mus musculus BAC clone RP23-406H14 from chromosom...	44	0.17
41	gb\|AC134898.4\| Mus musculus BAC clone RP23-478H2 from chromosome...	44	0.17
42	gb\|AC161473.5\| Pan troglodytes BAC clone CH251-460F23 from chrom...	44	0.17
43	gb\|AC161121.3\| Pan troglodytes BAC clone CH251-720M8 from chromo...	44	0.17
44	gb\|AC118009.7\| Mus musculus chromosome 8, clone RP23-442H2, comp...	44	0.17
45	gb\|AC139325.4\| Mus musculus BAC clone RP24-373O11 from chromosom...	44	0.17
46	emb\|CT010456.8\| Mouse DNA sequence from clone RP23-96D14 on chro...	44	0.17
47	gb\|AC126693.3\| Mus musculus BAC clone RP23-247E23 from chromosom...	44	0.17
48	gb\|AC122239.4\| Mus musculus BAC clone RP23-143K14 from chromosom...	44	0.17
49	gb\|AC123840.4\| Mus musculus BAC clone RP23-399K5 from chromosome...	44	0.17
50	gb\|AC162909.2\| Mus musculus BAC clone RP24-308O19 from chromosom...	44	0.17
51	emb\|AL591521.8\| Human DNA sequence from clone RP5-965F6 on chrom...	44	0.17
52	emb\|AL512410.14\| Human DNA sequence from clone RP11-100E6 on chr...	44	0.17
53	emb\|AL512366.12\| Human DNA sequence from clone RP11-449O16 on ch...	44	0.17
54	emb\|AL441943.6\| Human DNA sequence from clone RP11-69C17 on chro...	44	0.17
55	emb\|AL139376.17\| Human DNA sequence from clone RP11-23E3 on chro...	44	0.17
56	emb\|AL139140.11\| Human DNA sequence from clone RP5-1071P19 on ch...	44	0.17
57	gb\|AC009780.12\| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Canc...	44	0.17
58	dbj\|AK139964.1\| Mus musculus adult male corpora quadrigemina cDN...	44	0.17
59	emb\|BX936349.5\| Mouse DNA sequence from clone RP23-416N9 on chro...	44	0.17
60	dbj\|AK046241.1\| Mus musculus adult male corpora quadrigemina cDN...	44	0.17
61	gb\|AC155725.3\| Mus musculus 6 BAC RP24-231N5 (Roswell Park Cance...	44	0.17
62	gb\|AC154549.2\| Mus musculus BAC clone RP23-443L15 from chromosom...	44	0.17
63	gb\|AC151582.3\| Pan troglodytes BAC clone RP43-3F18 from chromoso...	44	0.17
64	gb\|AC024887.22\| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Canc...	44	0.17
65	gb\|AC084879.23\| Homo sapiens 12q BAC RP11-167N24 (Roswell Park C...	44	0.17
66	gb\|AC067962.6\| Homo sapiens BAC clone RP11-48K7 from 2, complete...	44	0.17
67	gb\|AC154676.2\| Mus musculus BAC clone RP23-146O19 from 17, compl...	44	0.17
68	gb\|AC155271.1\| Mus musculus BAC clone RP23-204F12 from 16, compl...	44	0.17
69	gb\|AC154643.2\| Mus musculus BAC clone RP23-277M12 from 13, compl...	44	0.17
70	gb\|AF054116.1\|AF054116 Rattus norvegicus polymorphic marker D5UI...	44	0.17
71	gb\|AC148976.3\| Mus musculus BAC clone RP23-391I5 from 7, complet...	44	0.17
72	gb\|AC123062.4\| Mus musculus BAC clone RP23-218A9 from 13, comple...	44	0.17
73	gb\|AC141895.4\| Mus musculus BAC clone RP23-299L22 from 10, compl...	44	0.17
74	gb\|AC140270.3\| Mus musculus BAC clone RP23-456C8 from 6, complet...	44	0.17
75	emb\|AL807811.9\| Mouse DNA sequence from clone RP23-247I1 on chro...	44	0.17
76	emb\|AL840626.7\| Mouse DNA sequence from clone RP23-151M8 on chro...	44	0.17
77	gb\|AC115905.8\| Mus musculus chromosome 1, clone RP24-472N17, com...	42	0.67
78	gb\|AC126598.13\| Mus musculus chromosome 5, clone RP24-486L9, com...	42	0.67
79	gb\|AC110195.14\| Mus musculus chromosome 3, clone RP24-291L17, co...	42	0.67
80	gb\|AC099607.6\| Mus musculus chromosome 5, clone RP23-361G20, com...	42	0.67
81	gb\|AC115930.10\| Mus musculus chromosome 3, clone RP24-534H10, co...	42	0.67
82	ref\|NM_001013019.1\| Mus musculus RIKEN cDNA 1110067I12 gene (111...	42	0.67
83	gb\|AC161210.5\| Mus musculus chromosome 3, clone RP23-71N6, compl...	42	0.67
84	gb\|AY324145.1\| Desmognathus auriculatus clone Dau11 microsatelli...	42	0.67
85	gb\|U93889.1\|MNU93889 Megaptera novaeangliae clone GATA019 micros...	42	0.67
86	gb\|AC151815.1\| Solanum demissum chromosome 5 clone PGEC472P22 ma...	42	0.67
87	gb\|AC149301.1\| Solanum demissum chromosome 5 clone PGEC517A09 ma...	42	0.67
88	gb\|AC162291.13\| Mus musculus chromosome 18, clone RP23-264B14, c...	42	0.67
89	gb\|AY730340.1\| Solanum tuberosum strain P6/210 clone BAC BA87d17...	42	0.67
90	gb\|AC134411.7\| Mus musculus chromosome 5, clone RP24-369N6, comp...	42	0.67
91	gb\|AY526337.1\| Panulirus argus clone Par3(4D19) microsatellite s...	42	0.67
92	gb\|AC115878.12\| Mus musculus chromosome 15, clone RP24-358G9, co...	42	0.67
93	gb\|AC133874.10\| Mus musculus chromosome 19, clone RP23-81N16, co...	42	0.67
94	gb\|AC109601.9\| Oryza sativa chromosome 3 BAC OSJNBa0004G03 genom...	42	0.67
95	gb\|AC100986.9\| Mus musculus chromosome 3, clone RP23-77E5, compl...	42	0.67
96	gb\|AC134611.4\| Mus musculus BAC clone RP23-98D8 from chromosome ...	42	0.67
97	gb\|AC140680.4\| Mus musculus BAC clone RP24-548A12 from chromosom...	42	0.67
98	gb\|AC139335.3\| Mus musculus BAC clone RP23-376N11 from chromosom...	42	0.67
99	gb\|AC102195.14\| Mus musculus chromosome 18, clone RP24-430B21, c...	42	0.67
100	gb\|AC149595.2\| Xenopus tropicalis clone ISB-166A19, complete seq...	42	0.67
101	gb\|AC165348.3\| Mus musculus BAC clone RP23-300C11 from chromosom...	42	0.67
102	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	42	0.67
103	gb\|AC164603.4\| Mus musculus chromosome 8, clone RP24-114E3, comp...	42	0.67
104	gb\|AC164102.2\| Mus musculus BAC clone RP23-7E23 from chromosome ...	42	0.67
105	emb\|BX908756.12\| Zebrafish DNA sequence from clone CH211-190D13 ...	42	0.67
106	emb\|AL133390.7\| Human DNA sequence from clone RP1-317G22 on chro...	42	0.67
107	gb\|AC130550.4\| Mus musculus BAC clone RP24-463N15 from chromosom...	42	0.67
108	gb\|AC118607.12\| Mus musculus chromosome 14, clone RP23-479D1, co...	42	0.67
109	gb\|AC125398.4\| Mus musculus BAC clone RP24-217G23 from chromosom...	42	0.67
110	gb\|AC129217.3\| Mus musculus BAC clone RP24-458M20 from chromosom...	42	0.67
111	gb\|AC112792.4\| Mus musculus BAC clone RP23-192J17 from 18, compl...	42	0.67
112	gb\|AC124752.4\| Mus musculus BAC clone RP23-283G18 from 13, compl...	42	0.67
113	gb\|AC122880.4\| Mus musculus BAC clone RP23-77F18 from 8, complet...	42	0.67
114	gb\|AC122027.1\| Mus musculus BAC clone RP24-390L20 from 1, comple...	42	0.67
115	gb\|AC114823.4\| Mus musculus BAC clone RP23-209L10 from 2, comple...	42	0.67
116	gb\|AC093714.2\| Homo sapiens BAC clone RP11-458K10 from 7, comple...	42	0.67
117	gb\|AC116451.7\| Mus musculus chromosome 19, clone RP24-273P9, com...	42	0.67
118	gb\|AC123675.7\| Mus musculus chromosome 15, clone RP23-271I6, com...	42	0.67
119	gb\|AC160638.6\| Mus musculus BAC clone RP23-99K6 from chromosome ...	42	0.67
120	gb\|AC107781.9\| Mus musculus, clone RP23-56O1, complete sequence	42	0.67
121	emb\|AL672277.20\| Human DNA sequence from clone RP11-309M23 on ch...	42	0.67
122	emb\|AL450445.6\| Human DNA sequence from clone RP11-411G9 on chro...	42	0.67
123	emb\|AL138915.16\| Human DNA sequence from clone RP11-288K24 on ch...	42	0.67
124	gb\|AC073153.16\| Mus musculus Strain C57BL6/J chromosome 19 BAC, ...	42	0.67
125	gb\|AC165148.2\| Mus musculus BAC clone RP24-278K24 from chromosom...	42	0.67
126	emb\|CR352297.14\| Zebrafish DNA sequence from clone CH211-165L15 ...	42	0.67
127	emb\|BX323089.13\| Zebrafish DNA sequence from clone DKEYP-10D2 in...	42	0.67
128	emb\|AL713925.10\| Mouse DNA sequence from clone RP23-298B18 on ch...	42	0.67
129	emb\|AL663035.8\| Mouse DNA sequence from clone RP23-432G17 on chr...	42	0.67
130	emb\|BX276104.14\| Mouse DNA sequence from clone RP24-313E3 on chr...	42	0.67
131	emb\|AL645970.15\| Mouse DNA sequence from clone DN-258M5 on chrom...	42	0.67
132	emb\|BX324181.26\| Zebrafish DNA sequence from clone CH211-203O8 i...	42	0.67
133	gb\|AC124771.4\| Mus musculus BAC clone RP23-28G12 from chromosome...	42	0.67
134	emb\|BX629347.20\| Zebrafish DNA sequence from clone DKEY-103K21 i...	42	0.67
135	gb\|DQ402491.1\| Liposcelis decolor microsatellite Lip135 sequence	42	0.67
136	emb\|AL844587.19\| Zebrafish DNA sequence from clone DKEY-7E14 in ...	42	0.67
137	gb\|AC098719.3\| Mus musculus clone RP23-2M3, complete sequence	42	0.67
138	gb\|AC008249.14\| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Can...	42	0.67
139	emb\|BX571955.15\| Zebrafish DNA sequence from clone DKEY-27B3 in ...	42	0.67
140	gb\|AC104297.1\| Homo sapiens chromosome 3 clone RP11-8D23, comple...	42	0.67
141	gb\|AC006065.3\| Homo sapiens 12q24.2 BAC RPCI11-407A16 (Roswell P...	42	0.67
142	gb\|AC097515.5\| Homo sapiens BAC clone RP11-446J8 from 4, complet...	42	0.67
143	gb\|AY034584.1\| Mus musculus cathepsin M (CtsM) pseudogene, parti...	42	0.67
144	gb\|AC147620.5\| Mus musculus BAC clone RP24-285H21 from chromosom...	42	0.67
145	gb\|AC174221.4\| Mus musculus BAC clone RP24-237K1 from chromosome...	42	0.67
146	emb\|BX571983.11\| Zebrafish DNA sequence from clone DKEY-18M7 in ...	42	0.67
147	gb\|AC160128.2\| Mus musculus BAC clone RP23-286G17 from chromosom...	42	0.67
148	gb\|AC012601.7\| Homo sapiens chromosome 5 clone CTC-288O10, compl...	42	0.67
149	gb\|AC131183.4\| Mus musculus BAC clone RP23-225A14 from chromosom...	42	0.67
150	gb\|AC138589.16\| Mus musculus chromosome 1, clone RP24-153C14, co...	42	0.67
151	dbj\|AK087615.1\| Mus musculus 2 days pregnant adult female oviduc...	42	0.67
152	dbj\|AK049485.1\| Mus musculus 7 days embryo whole body cDNA, RIKE...	42	0.67
153	dbj\|AK049402.1\| Mus musculus 7 days embryo whole body cDNA, RIKE...	42	0.67
154	gb\|AC006576.15\| Homo sapiens Chromosome 12p13.3 BAC Clone 762c12...	42	0.67
155	gb\|AF226042.1\|AF226038S5 Mus musculus isovaleryl CoA dehydrogena...	42	0.67
156	gb\|AC145619.4\| Homo sapiens BAC clone RP11-722J20 from chromosom...	42	0.67
157	ref\|NG_002774.1\| Mus musculus cathepsin M, pseudogene (Ctsm-ps) ...	42	0.67
158	gb\|AC153820.4\| Mus musculus 6 BAC RP23-459L15 (Roswell Park Canc...	42	0.67
159	emb\|BX539340.7\| Zebrafish DNA sequence from clone DKEY-57K2 in l...	42	0.67
160	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	0.67
161	emb\|BX085194.14\| Zebrafish DNA sequence from clone DKEY-242M13, ...	42	0.67
162	gb\|AC079818.56\| Mus musculus strain C57BL/6J chromosome 10 clone...	42	0.67
163	gb\|AC093873.2\| Homo sapiens BAC clone RP11-615B17 from 2, comple...	42	0.67
164	gb\|AC080166.6\| Homo sapiens BAC clone RP11-813C7 from 2, complet...	42	0.67
165	gb\|AC005104.1\| Homo sapiens BAC clone CTA-442F18 from 2, complet...	42	0.67
166	gb\|AC102461.15\| Mus musculus chromosome 8, clone RP24-319H6, com...	42	0.67
167	gb\|AC154389.1\| Mus musculus BAC clone RP23-2H9 from chromosome 1...	42	0.67
168	gb\|AC005904.19\| Homo sapiens 12 PAC RP4-751H1 (Roswell Park Canc...	42	0.67
169	gb\|AC074264.3\| Homo sapiens BAC clone RP11-410L9 from 2, complet...	42	0.67
170	gb\|AY183109.1\| Trifolium repens clone c3.10 microsatellite sequence	42	0.67
171	gb\|AY183098.1\| Trifolium repens clone c1.9 microsatellite sequence	42	0.67
172	gb\|AY183073.1\| Trifolium repens clone a2.22 microsatellite sequence	42	0.67
173	gb\|AY183071.1\| Trifolium repens clone A2.10 microsatellite sequence	42	0.67
174	gb\|AF482426.1\| Homo sapiens encephalopsin splice variant 1 (OPN3...	42	0.67
175	gb\|AC068812.13\|AC068812 Homo sapiens chromosome N/A clone RP11-2...	42	0.67
176	gb\|AY178300.1\| Trifolium repens microsatellite agr1012 sequence	42	0.67
177	gb\|AY178297.1\| Trifolium repens microsatellite agr1009 sequence	42	0.67
178	gb\|AY178296.1\| Trifolium repens microsatellite agr1007 sequence	42	0.67
179	gb\|AC148974.5\| Mus musculus BAC clone RP24-165K23 from chromosom...	42	0.67
180	gb\|AC124982.13\| Mus musculus chromosome 3, clone RP24-173F6, com...	42	0.67
181	emb\|BX855594.2\| Mouse DNA sequence from clone RP24-322M2 on chro...	42	0.67
182	emb\|BX649621.5\| Mouse DNA sequence from clone RP23-173F3 on chro...	42	0.67
183	dbj\|BS000169.1\| Pan troglodytes chromosome 22 clone:RP43-042E01,...	42	0.67
184	emb\|AL713974.9\| Mouse DNA sequence from clone RP23-135I10 on chr...	42	0.67
185	emb\|BX323595.8\| Zebrafish DNA sequence from clone CH211-155O21 i...	42	0.67
186	emb\|BX000986.4\| Zebrafish DNA sequence from clone CH211-210B19 i...	42	0.67
187	emb\|CR925790.6\| Zebrafish DNA sequence from clone DKEY-275J21 in...	42	0.67
188	emb\|AL162464.5\|CNS01RHT Human chromosome 14 DNA sequence BAC R-8...	42	0.67
189	emb\|AL121775.3\|CNS01DSG Human chromosome 14 DNA sequence BAC R-5...	42	0.67
190	gb\|AC107045.9\| Mus musculus chromosome 1, clone RP23-334J7, comp...	42	0.67
191	dbj\|AP000626.5\| Homo sapiens genomic DNA, chromosome 11q clone:C...	42	0.67
192	gb\|AC109608.14\| Mus musculus strain C57BL/6J chromosome 5 clone ...	42	0.67
193	gb\|AC109606.11\| Mus musculus strain C57BL/6J chromosome 5 clone ...	42	0.67
194	gb\|AC161764.4\| Mus musculus BAC clone RP23-193D1 from chromosome...	42	0.67
195	gb\|AF056032.1\|AF056032 Homo sapiens kynurenine 3-hydroxylase mRN...	42	0.67
196	emb\|AL928547.12\| Mouse DNA sequence from clone RP23-226B16 on ch...	42	0.67
197	emb\|CR974430.11\| Mouse DNA sequence from clone RP23-373C24 on ch...	42	0.67
198	gb\|AC114627.8\| Mus musculus chromosome 3, clone RP24-108F9, comp...	42	0.67
199	emb\|AL929565.16\| Mouse DNA sequence from clone RP23-454N16 on ch...	42	0.67
200	gb\|AC145597.4\| Mus musculus BAC clone RP24-323M2 from Y, complet...	42	0.67
201	emb\|CT030233.6\| Mouse DNA sequence from clone RP24-103C16 on chr...	42	0.67
202	gb\|AC134608.3\| Mus musculus BAC clone RP23-68H13 from 13, comple...	42	0.67
203	gb\|AC151578.1\| Mus musculus BAC clone RP23-218K4 from 18, comple...	42	0.67
204	gb\|AC149588.4\| Mus musculus BAC clone RP23-366I10 from 15, compl...	42	0.67
205	gb\|M25858.1\|HUMVWFA31 Human von Willebrand factor gene, exon 39,...	42	0.67
206	gb\|AC024913.33\| Mus musculus BAC Clone 402k12 RPCI-23, complete ...	42	0.67
207	gb\|AC161932.5\| Mus musculus chromosome 18, clone RP24-78F20, com...	42	0.67
208	ref\|NM_003679.2\| Homo sapiens kynurenine 3-monooxygenase (kynure...	42	0.67
209	emb\|AL607074.13\| Mouse DNA sequence from clone RP23-174M9 on chr...	42	0.67
210	emb\|AL607066.23\| Mouse DNA sequence from clone RP23-406N5 on chr...	42	0.67
211	emb\|AL672106.9\| Mouse DNA sequence from clone RP23-372E6 on chro...	42	0.67
212	emb\|AL845500.6\| Mouse DNA sequence from clone RP23-221K3 on chro...	42	0.67
213	emb\|AL645723.11\| Mouse DNA sequence from clone RP23-423N6 on chr...	42	0.67
214	emb\|AL772371.3\| Mouse DNA sequence from clone RP23-234N12 on chr...	42	0.67
215	emb\|AL772255.12\| Mouse DNA sequence from clone RP23-172B16 on ch...	42	0.67
216	emb\|AL365336.20\| Mouse DNA sequence from clone RP21-639N14 on ch...	42	0.67
217	gb\|AC154026.1\| Mus musculus 6 NOVECTOR RP24-423A5 (Roswell Park ...	40	2.7
218	gb\|AC121281.19\| Mus musculus chromosome 3, clone RP23-61G16, com...	40	2.7
219	gb\|AC117827.6\| Mus musculus chromosome 1, clone RP24-88L2, compl...	40	2.7
220	gb\|AC115727.10\| Mus musculus chromosome 3, clone RP23-30A13, com...	40	2.7
221	gb\|AC102156.16\| Mus musculus chromosome 18, clone RP23-334L7, co...	40	2.7
222	gb\|AC154262.1\| Mus musculus chromosome 14 clone RP24-304G19, com...	40	2.7
223	gb\|AC116896.7\| Mus musculus chromosome 8, clone RP24-531D19, com...	40	2.7
224	gb\|AC130657.9\| Mus musculus chromosome 1, clone RP23-307H3, comp...	40	2.7
225	gb\|AC111115.13\| Mus musculus chromosome 5, clone RP23-213H20, co...	40	2.7
226	gb\|AC136372.13\| Mus musculus chromosome 15, clone RP23-232G24, c...	40	2.7
227	gb\|AC110544.13\| Mus musculus chromosome 3, clone RP23-112A11, co...	40	2.7
228	gb\|AC102297.12\| Mus musculus chromosome 1, clone RP24-392K18, co...	40	2.7
229	gb\|AC160134.2\| Mus musculus BAC clone RP23-139G11 from chromosom...	40	2.7
230	gb\|AC153357.4\| Mus musculus BAC clone RP24-124N8 from chromosome...	40	2.7
231	gb\|AC102908.11\| Mus musculus chromosome 16, clone RP24-288K2, co...	40	2.7
232	gb\|AC101748.7\| Mus musculus chromosome 5, clone RP24-133H21, com...	40	2.7
233	gb\|AC165078.2\| Mus musculus BAC clone RP24-287O1 from chromosome...	40	2.7
234	gb\|AC153380.1\| Mus musculus BAC RP23-256G5 (Roswell Park Cancer...	40	2.7
235	gb\|AC165972.4\| Mus musculus BAC clone RP23-87D12 from chromosome...	40	2.7
236	gb\|AC161571.11\| Mus musculus chromosome 7, clone RP23-403M22, co...	40	2.7
237	gb\|AC164079.11\| Mus musculus chromosome 1, clone RP23-15E12, com...	40	2.7
238	gb\|AC170862.1\| Mus musculus chromosome 19, clone wi1-593J16, com...	40	2.7
239	gb\|AC163689.3\| Mus musculus BAC clone CH36-200G6 from chromosome...	40	2.7
240	gb\|AC154102.15\| Mus musculus chromosome 8, clone RP24-186O14, co...	40	2.7
241	gb\|AC171175.1\| Mus musculus chromosome 19, clone wi1-1715L8, com...	40	2.7
242	gb\|AC125018.15\| Mus musculus chromosome 7, clone RP24-158A20, co...	40	2.7
243	gb\|AC153645.4\| Mus musculus BAC clone RP24-534E8 from chromosome...	40	2.7
244	gb\|AC164095.4\| Mus musculus BAC clone RP23-355A22 from chromosom...	40	2.7
245	gb\|AC164648.3\| Mus musculus BAC clone RP23-434H4 from chromosome...	40	2.7
246	gb\|AC135667.5\| Mus musculus BAC clone RP24-536G18 from chromosom...	40	2.7
247	gb\|AC105173.10\| Mus musculus chromosome 8, clone RP23-319J15, co...	40	2.7
248	gb\|AC134662.11\| Mus musculus chromosome 15, clone RP24-445D14, c...	40	2.7
249	gb\|AC116121.8\| Mus musculus chromosome 8, clone RP23-79K4, compl...	40	2.7
250	gb\|AC108768.14\| Mus musculus chromosome 8, clone RP23-398L15, co...	40	2.7
251	gb\|AC154786.2\| Mus musculus BAC clone RP24-468B14 from chromosom...	40	2.7
252	gb\|AC102081.15\| Mus musculus chromosome 18, clone RP23-43H5, com...	40	2.7
253	gb\|AC167963.5\| Mus musculus chromosome 1, clone RP24-171A4, comp...	40	2.7
254	gb\|AC152999.1\| Homo sapiens chromosome X clone Qc-3H10 map q28, ...	40	2.7
255	gb\|AC107757.15\| Mus musculus chromosome 15, clone RP23-207L14, c...	40	2.7
256	gb\|AC131085.16\| Mus musculus chromosome 13, clone RP23-452D10, c...	40	2.7
257	gb\|AC115011.27\| Mus musculus chromosome 1, clone RP24-192A11, co...	40	2.7
258	gb\|AC118193.9\| Mus musculus chromosome 8, clone RP23-241A10, com...	40	2.7
259	gb\|AC102457.11\| Mus musculus chromosome 19, clone RP24-312C18, c...	40	2.7
260	gb\|AC115749.12\| Mus musculus chromosome 3, clone RP23-14C17, com...	40	2.7
261	gb\|AC122014.3\| Mus musculus chromosome 1 clone RP24-358F15, comp...	40	2.7
262	gb\|AC104203.11\| Mus musculus chromosome 5, clone RP24-301M6, com...	40	2.7
263	gb\|AC102525.8\| Mus musculus chromosome 8, clone RP24-133K20, com...	40	2.7
264	gb\|AC123703.8\| Mus musculus chromosome 3, clone RP23-345N18, com...	40	2.7
265	gb\|AC154387.2\| Mus musculus BAC clone RP23-10K1 from chromosome ...	40	2.7
266	gb\|AC154555.3\| Mus musculus BAC clone RP23-418L12 from chromosom...	40	2.7
267	gb\|AC163612.3\| Mus musculus BAC clone RP23-89N5 from chromosome ...	40	2.7
268	gb\|AC154236.2\| Mus musculus BAC clone RP24-160E14 from chromosom...	40	2.7
269	gb\|AC163281.3\| Mus musculus BAC clone RP23-443B19 from chromosom...	40	2.7
270	gb\|AC166821.2\| Mus musculus BAC clone RP24-68F22 from chromosome...	40	2.7
271	gb\|AC159285.3\| Mus musculus BAC clone RP23-306M13 from chromosom...	40	2.7
272	gb\|AC167814.4\| Mus musculus BAC clone RP24-248O12 from chromosom...	40	2.7
273	gb\|AC154728.2\| Mus musculus BAC clone RP24-377E6 from chromosome...	40	2.7
274	gb\|AC165075.3\| Mus musculus BAC clone RP24-465N15 from chromosom...	40	2.7
275	gb\|AC161363.7\| Mus musculus BAC clone RP24-554L15 from chromosom...	40	2.7
276	gb\|AC122262.3\| Mus musculus BAC clone RP23-190N21 from chromosom...	40	2.7
277	gb\|AC161411.11\| Mus musculus chromosome 1, clone RP24-223E1, com...	40	2.7
278	gb\|AC169502.1\| Mus musculus BAC clone RP24-409G12 from chromosom...	40	2.7
279	gb\|AC165317.8\| Mus musculus chromosome 5, clone RP23-265O20, com...	40	2.7
280	gb\|AC169503.1\| Mus musculus BAC clone RP24-281B5 from chromosome...	40	2.7
281	gb\|AC162520.7\| Mus musculus chromosome 5, clone RP24-118C7, comp...	40	2.7
282	gb\|AC166973.5\| Mus musculus chromosome 1, clone RP24-372J6, comp...	40	2.7
283	gb\|AC169813.2\| Rhesus Macaque BAC CH250-16M3 (Children's Hospit...	40	2.7
284	gb\|AC114653.11\| Mus musculus chromosome 5, clone RP24-158G19, co...	40	2.7
285	gb\|AC102355.13\| Mus musculus chromosome 5, clone RP23-120C8, com...	40	2.7
286	gb\|AC137842.8\| Mus musculus chromosome 15, clone RP23-91M6, comp...	40	2.7
287	gb\|AC163094.5\| Mus musculus chromosome 5, clone RP23-123P10, com...	40	2.7
288	gb\|AC104918.13\| Mus musculus chromosome 7, clone RP23-335G1, com...	40	2.7
289	gb\|AC154107.3\| Mus musculus BAC clone RP23-67L1 from chromosome ...	40	2.7
290	gb\|AC102150.10\| Mus musculus chromosome 7, clone RP23-310N5, com...	40	2.7
291	gb\|AC110194.11\| Mus musculus chromosome 7, clone RP23-238J3, com...	40	2.7
292	gb\|DP000014.1\| Callithrix jacchus target 1 genomic scaffold	40	2.7
293	gb\|AY453831.1\| Mandarina ponderosa clone Mpo5 microsatellite seq...	40	2.7
294	gb\|AC129588.10\| Mus musculus chromosome 3, clone RP23-296L7, com...	40	2.7
295	gb\|AC152010.1\| Homo sapiens chromosome X clone Qc-13B12 map q28,...	40	2.7
296	gb\|AC151961.1\| Homo sapiens chromosome X clone RP11-76K17 map q2...	40	2.7
297	gb\|AC151960.1\| Homo sapiens chromosome X clone RP11-76K17 map q2...	40	2.7
298	gb\|AC151959.1\| Homo sapiens chromosome X clone RP11-76K17 map q2...	40	2.7
299	gb\|AC102410.5\| Mus musculus chromosome 18, clone RP24-369O1, com...	40	2.7
300	gb\|AC124083.14\| Mus musculus chromosome 5, clone RP24-400H4, com...	40	2.7
301	gb\|AC119856.13\| Mus musculus chromosome 5, clone RP23-256B18, co...	40	2.7
302	gb\|AC112997.10\| Mus musculus chromosome 8, clone RP24-484I6, com...	40	2.7
303	gb\|AC107786.14\| Mus musculus chromosome 5, clone RP23-5E3, compl...	40	2.7
304	gb\|AC168277.2\| Mus musculus BAC RP24-186L17 (Roswell Park Cance...	40	2.7
305	gb\|AC079290.12\| Mus musculus chromosome 18, clone RP23-330E13, c...	40	2.7
306	gb\|AC101686.8\| Mus musculus chromosome 7, clone RP23-200O8, comp...	40	2.7
307	gb\|AC120867.10\| Mus musculus chromosome 5, clone RP23-91O14, com...	40	2.7
308	gb\|AC114420.11\| Mus musculus chromosome 5, clone RP23-375E13, co...	40	2.7
309	gb\|AC158918.7\| Mus musculus chromosome 15, clone RP23-106N12, co...	40	2.7
310	gb\|AC162163.2\| Mus musculus chromosome 1, clone RP23-258N15, com...	40	2.7
311	gb\|AC102938.20\| Mus musculus chromosome 1, clone RP24-187H3, com...	40	2.7
312	gb\|AC163998.2\| Mus musculus chromosome 15, clone RP24-326H11, co...	40	2.7
313	gb\|AF325697.1\| Schistosoma mansoni microsatellite SMD43 sequence	40	2.7
314	gb\|AF296724.1\| Acrantophis madagascariensis microsatellite 5HDZ6...	40	2.7
315	gb\|AY023933.1\| Oryza sativa microsatellite MRG6258 containing (A...	40	2.7
316	gb\|AY023869.1\| Oryza sativa microsatellite MRG6194 containing (A...	40	2.7
317	gb\|AC100734.4\| Mus musculus chromosome 15, clone RP24-316L11, co...	40	2.7
318	gb\|AC139130.10\| Mus musculus chromosome 15, clone RP23-210B16, c...	40	2.7
319	gb\|AY730337.1\| Solanum tuberosum strain P6/210 clone BAC BA27c1,...	40	2.7
320	gb\|AC142496.2\| Homo sapiens chromosome X clone RP1-8N8 map p11.2...	40	2.7
321	gb\|AC125670.4\| Rattus norvegicus BAC CH230-113E22 (Children's H...	40	2.7
322	gb\|AC162892.7\| Mus musculus chromosome 5, clone RP23-257D19, com...	40	2.7
323	gb\|AC165315.5\| Mus musculus chromosome 3, clone RP24-205J15, com...	40	2.7
324	gb\|AC164437.2\| Mus musculus BAC clone RP23-105B9 from chromosome...	40	2.7
325	gb\|AC157570.5\| Mus musculus BAC clone RP23-105H5 from chromosome...	40	2.7
326	gb\|AC154240.2\| Mus musculus BAC clone RP24-170E23 from chromosom...	40	2.7
327	gb\|AC117247.4\| Mus musculus BAC clone RP24-323L24 from chromosom...	40	2.7
328	gb\|AC160962.2\| Mus musculus BAC clone RP24-308N16 from chromosom...	40	2.7
329	gb\|AC161587.2\| Mus musculus BAC clone RP24-492G17 from chromosom...	40	2.7
330	gb\|AC157593.4\| Mus musculus BAC clone RP23-254B18 from chromosom...	40	2.7
331	gb\|AC113099.12\| Mus musculus chromosome 8, clone RP23-314N20, co...	40	2.7
332	gb\|AC110036.8\| Mus musculus chromosome 7, clone RP23-254F9, comp...	40	2.7
333	gb\|AC125273.9\| Mus musculus chromosome 1, clone RP24-156N4, comp...	40	2.7
334	gb\|AC130697.10\| Mus musculus chromosome 15, clone RP24-121O7, co...	40	2.7
335	gb\|AC105067.8\| Mus musculus chromosome 18, clone RP23-232D3, com...	40	2.7
336	gb\|AC119190.7\| Mus musculus chromosome 8, clone RP24-178B9, comp...	40	2.7
337	gb\|AC161357.4\| Mus musculus chromosome 5, clone wi1-1640B17, com...	40	2.7
338	gb\|AC107692.7\| Mus musculus chromosome 3, clone RP24-387H23, com...	40	2.7
339	gb\|AC120004.14\| Mus musculus chromosome 5, clone RP24-150N15, co...	40	2.7
340	gb\|AC116507.9\| Mus musculus chromosome 19, clone RP24-309C17, co...	40	2.7
341	gb\|AC113328.5\| Mus musculus chromosome 3, clone RP23-456E2, comp...	40	2.7
342	gb\|AC011070.8\| Drosophila melanogaster clone BACR02B12, complete...	40	2.7
343	gb\|AC147909.2\| Xenopus tropicalis clone CH216-80K10, complete se...	40	2.7
344	gb\|AC146440.5\| Pan troglodytes BAC clone RP43-11P11 from 7, comp...	40	2.7
345	gb\|AC134414.12\| Mus musculus chromosome 15, clone RP24-70H12, co...	40	2.7
346	gb\|AY526335.1\| Panulirus argus clone Par1(1G27) microsatellite s...	40	2.7
347	gb\|AF534377.1\| Limulus polyphemus clone LpoA73 microsatellite se...	40	2.7
348	gb\|AC148086.6\| Mus musculus chromosome 17, clone RP24-147C6, com...	40	2.7
349	gb\|AC126115.5\| Rattus norvegicus 4 BAC CH230-213L22 (Children's ...	40	2.7
350	gb\|AC125688.6\| Rattus norvegicus 20 BAC CH230-186I2 (Children's ...	40	2.7
351	gb\|AC134127.3\| Rattus norvegicus 8 BAC CH230-24F13 (Children's H...	40	2.7
352	gb\|AC114434.4\| Rattus norvegicus 1 BAC CH230-210C18 (Children's ...	40	2.7
353	gb\|AC097023.6\| Rattus norvegicus BAC CH230-35L12 (Children's Hos...	40	2.7
354	gb\|AC069539.5\| Homo sapiens chromosome 11 clone RP11-321E15, com...	40	2.7
355	gb\|AC108813.8\| Mus musculus chromosome 1, clone RP23-320P13, com...	40	2.7
356	gb\|AC091473.2\| Mus musculus chromosome X clones RP21-114F21, RP2...	40	2.7
357	gb\|AC102229.7\| Mus musculus chromosome 15, clone RP24-70F9, comp...	40	2.7
358	gb\|AC091452.2\| Mus musculus chromosome X clone RP23-124C16, comp...	40	2.7
359	gb\|AC120388.11\| Mus musculus chromosome 9, clone RP24-300P2, com...	40	2.7
360	gb\|AC138766.20\| Mus musculus chromosome 5, clone RP23-444J3, com...	40	2.7
361	gb\|AC148244.3\| Mus musculus chromosome 9, clone wi1-65440F10, co...	40	2.7
362	gb\|AC115924.11\| Mus musculus chromosome 15, clone RP24-511O11, c...	40	2.7
363	gb\|AC149035.2\| X. tropicalis BAC clone ISB1-221I9 containing gen...	40	2.7
364	gb\|AC148966.2\| X. tropicalis BAC clone ISB1-137N19 containing ge...	40	2.7
365	gb\|AC140447.3\| Mus musculus BAC clone RP23-53E23 from chromosome...	40	2.7
366	gb\|AC144933.4\| Mus musculus BAC clone RP24-531B24 from chromosom...	40	2.7
367	gb\|AC137514.2\| Mus musculus BAC clone RP24-511G20 from chromosom...	40	2.7
368	gb\|AC133934.3\| Mus musculus BAC clone RP24-361B1 from chromosome...	40	2.7
369	gb\|AC132681.5\| Mus musculus BAC clone RP23-442K13 from chromosom...	40	2.7
370	gb\|AC116595.4\| Mus musculus BAC clone RP24-127G9 from chromosome...	40	2.7
371	gb\|AC144816.3\| Mus musculus BAC clone RP24-243E15 from chromosom...	40	2.7
372	gb\|AC111109.6\| Mus musculus chromosome 1, clone RP23-199D23, com...	40	2.7
373	gb\|AC138260.7\| Mus musculus chromosome 6, clone RP23-247I19, com...	40	2.7
374	gb\|AC137128.17\| Mus musculus chromosome 3, clone RP24-271G16, co...	40	2.7
375	gb\|AC126593.5\| Rattus norvegicus 13 BAC CH230-103N15 (Children's...	40	2.7
376	gb\|AC131999.9\| Mus musculus chromosome 15, clone RP24-139E21, co...	40	2.7
377	gb\|AC110243.9\| Mus musculus chromosome 15, clone RP23-246C6, com...	40	2.7
378	gb\|AC119218.7\| Mus musculus chromosome 7, clone RP24-200I20, com...	40	2.7
379	gb\|AC138401.9\| Mus musculus chromosome 13, clone RP24-79G5, comp...	40	2.7
380	gb\|AC161474.4\| Pan troglodytes BAC clone CH251-488B17 from chrom...	40	2.7
381	gb\|AC148924.2\| Pan troglodytes fosmid clone CH1251-1825H8 from Y...	40	2.7
382	gb\|AC100378.10\| Mus musculus chromosome 10, clone RP23-130O4, co...	40	2.7
383	gb\|AC118606.13\| Mus musculus chromosome 5, clone RP24-69F9, comp...	40	2.7
384	gb\|AC158619.12\| Mus musculus 10 BAC RP23-291O3 (Roswell Park Can...	40	2.7
385	gb\|AC147228.3\| Mus musculus BAC clone RP23-159I8 from chromosome...	40	2.7
386	gb\|AC133649.2\| Mus musculus BAC clone RP23-341M13 from chromosom...	40	2.7
387	gb\|AC134583.5\| Mus musculus BAC clone RP24-94C12 from chromosome...	40	2.7
388	gb\|AC134442.4\| Mus musculus BAC clone RP24-104I4 from chromosome...	40	2.7
389	gb\|AC132322.3\| Mus musculus BAC clone RP24-262F3 from chromosome...	40	2.7
390	gb\|AC101757.12\| Mus musculus chromosome 8, clone RP24-545I11, co...	40	2.7
391	gb\|AC101968.11\| Mus musculus chromosome 3, clone RP24-257N17, co...	40	2.7
392	gb\|AC147058.3\| Pan troglodytes BAC clone RP43-154B16 from 7, com...	40	2.7
393	gb\|AC131745.4\| Mus musculus BAC clone RP23-55L3 from chromosome ...	40	2.7
394	gb\|AC125406.4\| Mus musculus BAC clone RP23-32C18 from chromosome...	40	2.7
395	gb\|AC147502.2\| Mus musculus BAC clone RP23-111N9 from chromosome...	40	2.7
396	gb\|AC147227.4\| Mus musculus BAC clone RP23-153H22 from chromosom...	40	2.7
397	gb\|AC115360.6\| Mus musculus BAC clone RP23-191N22 from chromosom...	40	2.7
398	gb\|AC134576.3\| Mus musculus BAC clone RP24-68G10 from chromosome...	40	2.7
399	gb\|AC141888.4\| Mus musculus BAC clone RP23-462H3 from chromosome...	40	2.7
400	gb\|AC140492.3\| Mus musculus BAC clone RP24-137B3 from chromosome...	40	2.7
401	gb\|AC147380.2\| Mus musculus BAC clone RP24-119J10 from chromosom...	40	2.7
402	gb\|AC145589.3\| Mus musculus BAC clone RP24-174M10 from chromosom...	40	2.7
403	gb\|AC123531.4\| Mus musculus BAC clone RP24-289C11 from chromosom...	40	2.7
404	gb\|AC138110.3\| Mus musculus BAC clone RP24-363O16 from chromosom...	40	2.7
405	gb\|AC134826.4\| Mus musculus BAC clone RP24-459P6 from chromosome...	40	2.7
406	gb\|AC140843.2\| Mus musculus BAC clone RP24-443L17 from chromosom...	40	2.7
407	gb\|AC129289.4\| Mus musculus BAC clone RP24-482E11 from chromosom...	40	2.7
408	gb\|AC140211.2\| Mus musculus BAC clone RP24-474M1 from chromosome...	40	2.7
409	gb\|AC122527.3\| Mus musculus BAC clone RP24-502E10 from chromosom...	40	2.7
410	gb\|AC134908.5\| Mus musculus BAC clone RP23-377L13 from chromosom...	40	2.7
411	gb\|AC144776.2\| Mus musculus BAC clone RP23-357B5 from chromosome...	40	2.7
412	gb\|AC138790.2\| Mus musculus BAC clone RP23-292H23 from chromosom...	40	2.7
413	gb\|AC114409.17\| Mus musculus chromosome 5, clone RP23-148F6, com...	40	2.7
414	gb\|AC158925.4\| Mus musculus chromosome 1, clone RP23-22I7, compl...	40	2.7
415	gb\|AC157608.10\| Mus musculus chromosome 5, clone RP23-343F16, co...	40	2.7
416	gb\|AC110376.4\| Mus musculus chromosome 12 clone RP23-441E7, comp...	40	2.7
417	gb\|AC164536.5\| Mus musculus chromosome 18, clone RP23-425H1, com...	40	2.7
418	gb\|AC113028.15\| Mus musculus chromosome 5, clone RP23-205D3, com...	40	2.7
419	gb\|AC093474.7\| Mus musculus chromosome 7, clone RP23-54H2, compl...	40	2.7
420	gb\|AC099640.6\| Mus musculus chromosome 1, clone RP24-339K18, com...	40	2.7
421	gb\|AC116473.13\| Mus musculus chromosome 8, clone RP23-385E22, co...	40	2.7
422	gb\|AC157583.9\| Mus musculus chromosome 15, clone RP24-367L4, com...	40	2.7
423	gb\|AY318391.2\| Mus musculus olfactory receptor Olfr1190-ps1 pseu...	40	2.7
424	gb\|AC157994.2\| Mus musculus BAC clone RP24-349B6 from chromosome...	40	2.7
425	gb\|AC145799.2\| Xenopus tropicalis clone CH216-55B16, complete se...	40	2.7
426	gb\|AC124113.9\| Mus musculus chromosome 5, clone RP24-354P12, com...	40	2.7
427	gb\|AC023175.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	2.7
428	gb\|AC119896.6\| Mus musculus chromosome 10, clone RP24-226B10, co...	40	2.7
429	gb\|AC119864.9\| Mus musculus chromosome 18, clone RP23-325I21, co...	40	2.7
430	gb\|AC140051.10\| Mus musculus chromosome 12, clone RP23-296J15, c...	40	2.7
431	gb\|AC154885.8\| Mus musculus chromosome 5, clone RP24-333I1, comp...	40	2.7
432	gb\|AC153010.3\| Mus musculus BAC clone RP23-325H1 from chromosome...	40	2.7
433	gb\|AC117547.19\| Mus musculus chromosome 1, clone RP23-221M20, co...	40	2.7
434	gb\|AC026478.5\| Mus musculus strain C57BL6/J chromosome 5 clone R...	40	2.7
435	gb\|AC157024.7\| Mus musculus 6 BAC RP24-549F4 (Roswell Park Cance...	40	2.7
436	gb\|AC153378.4\| Mus musculus 6 BAC RP23-106C18 (Roswell Park Canc...	40	2.7
437	gb\|AC068006.10\| Mus musculus chromosome 7, clone RP23-6I17, comp...	40	2.7
438	gb\|AC138682.14\| Mus musculus chromosome 5, clone RP23-34L23, com...	40	2.7
439	gb\|AY234818.1\| Ambystoma macrodactylum macrodactylum clone H120 ...	40	2.7
440	gb\|AC160540.7\| Mus musculus chromosome 7, clone RP23-44O19, comp...	40	2.7
441	gb\|AC091396.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	2.7
442	gb\|AC112675.12\| Mus musculus chromosome 1, clone RP23-138J12, co...	40	2.7
443	gb\|AC165168.3\| Mus musculus BAC clone RP23-12D3 from chromosome ...	40	2.7
444	gb\|AC165365.3\| Mus musculus BAC clone RP23-28N13 from chromosome...	40	2.7
445	gb\|AC149136.3\| Xenopus tropicalis clone CH216-164F21, complete s...	40	2.7
446	gb\|AC125024.6\| Mus musculus chromosome 5, clone RP24-320B23, com...	40	2.7
447	gb\|AC165409.3\| Mus musculus chromosome 18, clone RP23-90F15, com...	40	2.7
448	gb\|DQ168326.1\| Solanum tuberosum clone 149E01 metallocarboxypept...	40	2.7
449	gb\|DQ168312.1\| Solanum tuberosum clone 024H10 metallocarboxypept...	40	2.7
450	gb\|AC164575.7\| Mus musculus 10 BAC RP23-455M6 (Roswell Park Canc...	40	2.7
451	gb\|AC164306.3\| Mus musculus BAC clone RP23-190A21 from chromosom...	40	2.7
452	gb\|AC134459.4\| Mus musculus BAC clone RP23-360L15 from chromosom...	40	2.7
453	gb\|AC164637.3\| Mus musculus BAC clone RP23-128I20 from chromosom...	40	2.7
454	gb\|AC114643.9\| Mus musculus chromosome 6, clone RP24-127D6, comp...	40	2.7
455	gb\|AC164441.4\| Mus musculus BAC clone CH25-660D15 from chromosom...	40	2.7
456	gb\|AC134582.5\| Mus musculus BAC clone RP24-90M17 from chromosome...	40	2.7
457	gb\|AC158392.2\| Mus musculus BAC clone RP24-87B5 from chromosome ...	40	2.7
458	gb\|AC164086.3\| Mus musculus BAC clone RP23-25E6 from chromosome ...	40	2.7
459	gb\|AC165361.3\| Mus musculus BAC clone RP23-77H6 from chromosome ...	40	2.7
460	gb\|AC158521.2\| Mus musculus BAC clone RP23-404M10 from chromosom...	40	2.7
461	gb\|AC165081.3\| Mus musculus BAC clone RP24-63B10 from chromosome...	40	2.7
462	gb\|AC156164.2\| Mus musculus BAC clone RP24-75M13 from chromosome...	40	2.7
463	gb\|AC161762.4\| Mus musculus BAC clone RP23-371K18 from chromosom...	40	2.7
464	gb\|AC153510.10\| Mus musculus 10 BAC RP23-151C4 (Roswell Park Can...	40	2.7
465	gb\|AC144671.3\| Mus musculus BAC clone RP24-292O2 from chromosome...	40	2.7
466	gb\|AC100740.8\| Mus musculus chromosome 1, clone RP24-421N21, com...	40	2.7
467	gb\|AC125019.6\| Mus musculus chromosome 19, clone RP24-158H8, com...	40	2.7
468	gb\|AC145793.2\| Xenopus tropicalis clone CH216-157F1, complete se...	40	2.7
469	ref\|XM_001004638.1\| PREDICTED: Mus musculus RIKEN cDNA 1200016G0...	40	2.7
470	ref\|XM_924348.2\| PREDICTED: Mus musculus RIKEN cDNA 1200016G03 g...	40	2.7
471	ref\|XM_902582.2\| PREDICTED: Mus musculus RIKEN cDNA 1200016G03 g...	40	2.7
472	gb\|AC146618.2\| Mus musculus BAC clone RP23-5P3 from chromosome 1...	40	2.7
473	gb\|AC122801.3\| Mus musculus BAC clone RP23-471L3 from chromosome...	40	2.7
474	gb\|AC128738.4\| Mus musculus BAC clone RP24-106M4 from chromosome...	40	2.7
475	gb\|AC145299.3\| Mus musculus BAC clone RP24-129J23 from chromosom...	40	2.7
476	gb\|AC140313.2\| Mus musculus BAC clone RP24-324C6 from chromosome...	40	2.7
477	gb\|AC141875.4\| Mus musculus BAC clone RP24-316O22 from chromosom...	40	2.7
478	gb\|AC145804.2\| Xenopus tropicalis clone CH216-83M4, complete seq...	40	2.7
479	gb\|AC145789.2\| Xenopus tropicalis clone CH216-127D2, complete se...	40	2.7
480	gb\|AC099863.14\| Mus musculus chromosome 3, clone RP23-6F2, compl...	40	2.7
481	gb\|AC116392.12\| Mus musculus chromosome 10, clone RP23-93D3, com...	40	2.7
482	gb\|AC103411.8\| Rattus norvegicus 15 BAC CH230-7J23 (Children's H...	40	2.7
483	gb\|AC144629.2\| Mus musculus BAC clone RP23-448G2 from chromosome...	40	2.7
484	gb\|AC136018.5\| Mus musculus BAC clone RP24-125E6 from chromosome...	40	2.7
485	gb\|AC134325.2\| Mus musculus BAC clone RP24-235L14 from chromosom...	40	2.7
486	gb\|AC135110.3\| Mus musculus BAC clone RP23-392G14 from chromosom...	40	2.7
487	gb\|AC140463.2\| Mus musculus BAC clone RP24-348D8 from chromosome...	40	2.7
488	gb\|AC124738.5\| Mus musculus BAC clone RP23-344C15 from chromosom...	40	2.7
489	gb\|AC132237.3\| Mus musculus BAC clone RP24-501M9 from chromosome...	40	2.7
490	gb\|AC131801.3\| Mus musculus BAC clone RP24-538A12 from chromosom...	40	2.7
491	gb\|DQ483536.1\| Gymnogyps californianus clone 95D microsatellite ...	40	2.7
492	gb\|DQ483462.1\| Gymnogyps californianus clone 21D microsatellite ...	40	2.7
493	emb\|CR788228.11\| Zebrafish DNA sequence from clone CH211-15N4 in...	40	2.7
494	emb\|CR974489.8\| Mouse DNA sequence from clone RP23-78L13 on chro...	40	2.7
495	gb\|AC129570.10\| Mus musculus chromosome 14, clone RP23-343H21, c...	40	2.7
496	emb\|CR450793.12\| Zebrafish DNA sequence from clone DKEY-48M5 in ...	40	2.7
497	emb\|CT009510.7\| Mouse DNA sequence from clone RP23-47H16 on chro...	40	2.7
498	emb\|BX927253.9\| Zebrafish DNA sequence from clone DKEY-29J8 in l...	40	2.7
499	emb\|CT025708.8\| Mouse DNA sequence from clone RP24-331C1 on chro...	40	2.7
500	emb\|CR524823.17\| Zebrafish DNA sequence from clone CH211-150A18 ...	40	2.7

>gb|DQ167203.2| Triticum aestivum eukaryotic translation initiation factor 5A3
           mRNA, complete cds
          Length = 768

 Score =  309 bits (156), Expect = 2e-81
 Identities = 186/196 (94%), Gaps = 1/196 (0%)
 Strand = Plus / Minus

                                                                       
Query: 15  ataatagagatagatagatagatgacanagtactagcagcacctcgagcattcggtgtaa 74
           ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||
Sbjct: 768 ataatagagatagatagatagataacaaagtactagcagcacctcgagcattcggtgtaa 709

                                                                       
Query: 75  aaaacacacaaatctggatcaaacttgtttcacccaacagatatncttgatgcctatgta 134
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 708 aaaacacacaaatctggatcaaacttgtttcacccaacagatat-cttgatgcctatgta 650

                                                                       
Query: 135 tgtgtatnncaaacacccagaagcactagataccaagtatnacagctaggcaaccatgca 194
           |||||||  |||||||||||||||||||||||||||||||  ||| |||||||||| |||
Sbjct: 649 tgtgtatctcaaacacccagaagcactagataccaagtatcgcaggtaggcaaccacgca 590

                           
Query: 195 ccgctgcttacttgcc 210
           | ||||||||||||||
Sbjct: 589 cagctgcttacttgcc 574

to top

>gb|DQ234393.1| Aegilops tauschii translation initiation factor 5A gene, complete
           cds
          Length = 636

 Score =  143 bits (72), Expect = 2e-31
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
           ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 636 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 578

                                                        
Query: 166 accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
           |||||||||  ||| |||||||||| |||| ||||||||||||||
Sbjct: 577 accaagtatcgcaggtaggcaaccacgcacagctgcttacttgcc 533

to top

>gb|DQ234392.1| Thinopyrum intermedium translation initiation factor 5A mRNA,
           complete cds
          Length = 636

 Score =  143 bits (72), Expect = 2e-31
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
           ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 636 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 578

                                                        
Query: 166 accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
           ||||||||   |||||||||||||| |||| ||||||||||||||
Sbjct: 577 accaagtaccgcagctaggcaaccacgcacagctgcttacttgcc 533

to top

>gb|DQ167202.1| Triticum aestivum eukaryotic translation initiation factor 5A2 gene,
            complete cds
          Length = 1679

 Score =  143 bits (72), Expect = 2e-31
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                        
Query: 106  acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
            ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 1679 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 1621

                                                         
Query: 166  accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
            |||||||||  ||| |||||||||| |||| ||||||||||||||
Sbjct: 1620 accaagtatcgcaggtaggcaaccacgcacagctgcttacttgcc 1576

to top

>gb|DQ167201.1| Triticum aestivum eukaryotic translation initiation factor 5A1 gene,
            complete cds
          Length = 1910

 Score =  143 bits (72), Expect = 2e-31
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                        
Query: 106  acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
            ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 1910 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 1852

                                                         
Query: 166  accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
            |||||||||  ||| |||||||||| |||| ||||||||||||||
Sbjct: 1851 accaagtatcgcaggtaggcaaccacgcacagctgcttacttgcc 1807

to top

>gb|DQ234394.1| Secale sylvestre translation initiation factor 5A mRNA, complete
           cds
          Length = 636

 Score =  135 bits (68), Expect = 6e-29
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
           ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 636 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 578

                                                        
Query: 166 accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
           |||||||||  ||| |||||||||  |||| ||||||||||||||
Sbjct: 577 accaagtatcgcaggtaggcaaccgcgcacagctgcttacttgcc 533

to top

>gb|DQ234391.1| Secale cereale translation initiation factor 5A mRNA, complete cds
          Length = 636

 Score =  135 bits (68), Expect = 6e-29
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 acccaacagatatncttgatgcctatgtatgtgtatnncaaacacccagaagcactagat 165
           ||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 636 acccaacagatat-cttgatgcctatgtatgtgtatctcaaacacccagaagcactagat 578

                                                        
Query: 166 accaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
           |||||||||  ||| |||||||||  |||| ||||||||||||||
Sbjct: 577 accaagtatcgcaggtaggcaaccgcgcacagctgcttacttgcc 533

to top

>gb|DQ234390.1| Dasypyrum breviaristatum translation initiation factor 5A mRNA,
           complete cds
          Length = 637

 Score =  121 bits (61), Expect = 9e-25
 Identities = 96/106 (90%), Gaps = 2/106 (1%)
 Strand = Plus / Minus

                                                                       
Query: 106 acccaacagatatncttgatgcctatgtat-gtgtatnncaaacacccagaagcactaga 164
           ||||||||||||| |||||||||||||||| ||||||  |||||||||||||||||||||
Sbjct: 637 acccaacagatat-cttgatgcctatgtattgtgtatctcaaacacccagaagcactaga 579

                                                         
Query: 165 taccaagtatnacagctaggcaaccatgcaccgctgcttacttgcc 210
           ||||||||||  ||| |||||||||| || | ||||||||||||||
Sbjct: 578 taccaagtatcgcagataggcaaccacgcgcagctgcttacttgcc 533

to top

>gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequence
          Length = 88948

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 13    ttataatagagatagatagatagatga 39
             |||||||||||||||||||||||||||
Sbjct: 21663 ttataatagagatagatagatagatga 21689



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 21701 atagagatagatagatagat 21720

to top

>gb|AC124492.4| Mus musculus BAC clone RP23-454I23 from chromosome 12, complete
             sequence
          Length = 176782

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 22    agatagatagatagatgacanagtacta 49
             |||||||||||||||||||| |||||||
Sbjct: 91579 agatagatagatagatgacagagtacta 91552

to top

>emb|AL731765.5| Human DNA sequence from clone RP11-268L7 on chromosome X, complete
             sequence
          Length = 64790

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 17    aatagagatagatagatagatgaca 41
             |||||||||||||||||||||||||
Sbjct: 37062 aatagagatagatagatagatgaca 37038

to top

>gb|AC153657.4| Mus musculus BAC clone RP23-324B3 from chromosome 12, complete sequence
          Length = 208058

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 22    agatagatagatagatgacanagtacta 49
             |||||||||||||||||||| |||||||
Sbjct: 35109 agatagatagatagatgacagagtacta 35136

to top

>gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, complete sequence
          Length = 192006

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 15    ataatagagatagatagatagatg 38
             ||||||||||||||||||||||||
Sbjct: 86219 ataatagagatagatagatagatg 86242

to top

>emb|AL391134.13| Human DNA sequence from clone RP11-245M24 on chromosome Xp11.22-11.3
            Contains the 3' end of a nove  gene and a keratin 8 (K8,
            KO, CK8, CYK8, K2C8, CARD2) (KRT8) pseudogene, complete
            sequence
          Length = 58094

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 14   tataatagagatagatagatagat 37
            ||||||||||||||||||||||||
Sbjct: 5668 tataatagagatagatagatagat 5691

to top

>emb|BX547935.12| Zebrafish DNA sequence from clone CH211-207C1 in linkage group 16,
              complete sequence
          Length = 195252

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 14     tataatagagatagatagatagat 37
              ||||||||||||||||||||||||
Sbjct: 178914 tataatagagatagatagatagat 178891

to top

>emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on chromosome 4, complete
              sequence
          Length = 167874

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 14     tataatagagatagatagatagat 37
              ||||||||||||||||||||||||
Sbjct: 161774 tataatagagatagatagatagat 161751

to top

>gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, complete sequence
          Length = 169085

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 14    tataatagagatagatagatagat 37
             ||||||||||||||||||||||||
Sbjct: 30933 tataatagagatagatagatagat 30910



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 31250 atagagatagatagatagat 31231

to top

>gb|AC107677.7| Mus musculus chromosome 3, clone RP23-235F22, complete sequence
          Length = 157746

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 73188 ataatagagatagatagatagat 73166

to top

>gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome 13, complete sequence
          Length = 205345

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 48774 ataatagagatagatagatagat 48796

to top

>gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome 6, complete sequence
          Length = 215238

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 58932 ataatagagatagatagatagat 58954

to top

>gb|AC124486.4| Mus musculus BAC clone RP23-451E1 from chromosome 12, complete sequence
          Length = 183140

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 71003 ataatagagatagatagatagat 71025

to top

>gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosome 6, complete sequence
          Length = 210057

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 84493 ataatagagatagatagatagat 84471

to top

>gb|AC101142.9| Mus musculus chromosome 13, clone RP23-170P21, complete sequence
          Length = 176563

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 10502 ataatagagatagatagatagat 10480

to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3'
              end of the IL3RA gene for interleukin 3 receptor, alpha
              (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra,
              MGC34174), the SLC25A6 gene for solute carrier family 25
              (mitochondrial carrier; adenine nucleotide translocator),
              member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for
              acetylserotonin O-methyltransferase-like (ASMTLX), a novel
              gene (LOC286530), a novel gene (FLJ13330) and six CpG
              islands, complete sequence
          Length = 162377

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 15     ataatagagatagatagatagat 37
              |||||||||||||||||||||||
Sbjct: 130783 ataatagagatagatagatagat 130761

to top

>gb|AC114933.2| Homo sapiens chromosome 5 clone CTD-2023M8, complete sequence
          Length = 177958

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 17     aatagagatagatagatagatga 39
              |||||||||||||||||||||||
Sbjct: 119880 aatagagatagatagatagatga 119902

to top

>gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 236103

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 15     ataatagagatagatagatagat 37
              |||||||||||||||||||||||
Sbjct: 166712 ataatagagatagatagatagat 166690

to top

>gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154482

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 11    tattataatagagatagatagatagat 37
             |||| ||||||||||||||||||||||
Sbjct: 83143 tattctaatagagatagatagatagat 83169

to top

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 15     ataatagagatagatagatagat 37
              |||||||||||||||||||||||
Sbjct: 155238 ataatagagatagatagatagat 155216



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     agatagatagatagatgaca 41
              ||||||||||||||||||||
Sbjct: 155208 agatagatagatagatgaca 155189

to top

>gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone RP23-271O13, complete
              sequence
          Length = 239837

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 15     ataatagagatagatagatagat 37
              |||||||||||||||||||||||
Sbjct: 185071 ataatagagatagatagatagat 185093



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     agatagatagatagatgaca 41
              ||||||||||||||||||||
Sbjct: 185101 agatagatagatagatgaca 185120

to top

>gb|AC154817.2| Mus musculus BAC clone RP23-72G6 from chromosome 13, complete sequence
          Length = 143739

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 43116 ataatagagatagatagatagat 43138

to top

>gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 149839

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 11    tattataatagagatagatagatagat 37
             |||| ||||||||||||||||||||||
Sbjct: 47986 tattctaatagagatagatagatagat 47960

to top

>emb|BX901950.7| Zebrafish DNA sequence from clone DKEY-111C4 in linkage group 6,
             complete sequence
          Length = 146043

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 16    taatagagatagatagatagatg 38
             |||||||||||||||||||||||
Sbjct: 21413 taatagagatagatagatagatg 21435

to top

>emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chromosome 2, complete
             sequence
          Length = 210790

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 96395 ataatagagatagatagatagat 96373

to top

>emb|CT030739.10| Mouse DNA sequence from clone RP24-496K8 on chromosome 13, complete
             sequence
          Length = 192075

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 75863 ataatagagatagatagatagat 75841

to top

>gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complete sequence
          Length = 197633

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 68677 ataatagagatagatagatagat 68699

to top

>emb|AL606704.20| Mouse DNA sequence from clone RP23-375B1 on chromosome 11, complete
             sequence
          Length = 71109

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 19350 ataatagagatagatagatagat 19372



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 19380 agatagatagatagatgaca 19399

to top

>emb|AL672188.6| Mouse DNA sequence from clone RP23-53B2 on chromosome X, complete
             sequence
          Length = 150121

 Score = 46.1 bits (23), Expect = 0.043
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 15    ataatagagatagatagatagat 37
             |||||||||||||||||||||||
Sbjct: 20026 ataatagagatagatagatagat 20048

to top

>gb|AC115013.18| Mus musculus chromosome 10, clone RP24-193P19, complete sequence
          Length = 183402

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 78522 atagagatagatagatagatga 78543



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 79378 atagagatagatagatagat 79397



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 78724 atagagatagatagatagat 78743

to top

>gb|AC105979.13| Mus musculus chromosome 14, clone RP24-301E12, complete sequence
          Length = 163688

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 118887 atagagatagatagatagatga 118866

to top

>gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosome 6, complete sequence
          Length = 182673

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 17    aatagagatagatagatagatg 38
             ||||||||||||||||||||||
Sbjct: 42292 aatagagatagatagatagatg 42271

to top

>gb|AC134898.4| Mus musculus BAC clone RP23-478H2 from chromosome 14, complete sequence
          Length = 213348

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 42390 atagagatagatagatagatga 42369

to top

>gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chromosome 7, complete
             sequence
          Length = 170605

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 14634 atagagatagatagatagatga 14613

to top

>gb|AC161121.3| Pan troglodytes BAC clone CH251-720M8 from chromosome 7, complete
             sequence
          Length = 183573

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 52299 atagagatagatagatagatga 52320

to top

>gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, complete sequence
          Length = 208458

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 16   taatagagatagatagatagat 37
            ||||||||||||||||||||||
Sbjct: 6748 taatagagatagatagatagat 6727

to top

>gb|AC139325.4| Mus musculus BAC clone RP24-373O11 from chromosome 16, complete sequence
          Length = 155728

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 22     agatagatagatagatgacanagta 46
              |||||||||||||||||||| ||||
Sbjct: 131452 agatagatagatagatgacagagta 131428

to top

>emb|CT010456.8| Mouse DNA sequence from clone RP23-96D14 on chromosome 12, complete
             sequence
          Length = 217223

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 48358 atagagatagatagatagatga 48379

to top

>gb|AC126693.3| Mus musculus BAC clone RP23-247E23 from chromosome 16, complete sequence
          Length = 199505

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 22     agatagatagatagatgacanagta 46
              |||||||||||||||||||| ||||
Sbjct: 151008 agatagatagatagatgacagagta 151032

to top

>gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosome 8, complete
            sequence
          Length = 197109

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 16   taatagagatagatagatagat 37
            ||||||||||||||||||||||
Sbjct: 5725 taatagagatagatagatagat 5746

to top

>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence
          Length = 191185

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 163168 atagagatagatagatagatga 163147



 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 163055 atagagatagatagatagatga 163034



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 163226 atagagatagatagatagat 163207



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 163193 atagagatagatagatagat 163174



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 162791 atagagatagatagatagat 162772

to top

>gb|AC162909.2| Mus musculus BAC clone RP24-308O19 from chromosome 17, complete
             sequence
          Length = 145512

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 92393 atagagatagatagatagatga 92372

to top

>emb|AL591521.8| Human DNA sequence from clone RP5-965F6 on chromosome 1 Contains the 5'
             end of a novel gene and a thioredoxin (TXN) pseudogene,
             complete sequence
          Length = 97110

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 16    taatagagatagatagatagat 37
             ||||||||||||||||||||||
Sbjct: 91120 taatagagatagatagatagat 91141

to top

>emb|AL512410.14| Human DNA sequence from clone RP11-100E6 on chromosome 6, complete
             sequence
          Length = 160891

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 20    agagatagatagatagatgaca 41
             ||||||||||||||||||||||
Sbjct: 89872 agagatagatagatagatgaca 89851

to top

>emb|AL512366.12| Human DNA sequence from clone RP11-449O16 on chromosome 10 Contains the
              gene for apobec-1 complementation factor (ACF) (ASP) and
              the 3' end of a variant of the gene for a novel protein
              similar to N-acylsphingosine amidohydrolase (non-lysosomal
              ceramidase) 2 (ASAH2), complete sequence
          Length = 175849

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 119267 atagagatagatagatagatga 119288

to top

>emb|AL441943.6| Human DNA sequence from clone RP11-69C17 on chromosome 10 Contains four
             novel genes (FLJ40155) (FLJ31539), complete sequence
          Length = 203234

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 14818 atagagatagatagatagatga 14839

to top

>emb|AL139376.17| Human DNA sequence from clone RP11-23E3 on chromosome 13 Contains a novel
              gene, the CLDN10 gene for claudin 10 (OSP-L, CPETRL3), the
              gene for novel zinc-finger protein (DZIP1, KIAA0996) and 3
              CpG islands, complete sequence
          Length = 152794

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 107847 atagagatagatagatagatga 107868

to top

>emb|AL139140.11| Human DNA sequence from clone RP5-1071P19 on chromosome 1p34.1-34.3
             Contains part of the CSMD2 gene for CUB and Sushi multiple
             domains 2, complete sequence
          Length = 78229

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 53107 atagagatagatagatagatga 53086

to top

>gb|AC009780.12| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 144454

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 102418 atagagatagatagatagatga 102397

to top

>dbj|AK139964.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230008F13
           product:unclassifiable, full insert sequence
          Length = 2165

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 17  aatagagatagatagatagatg 38
           ||||||||||||||||||||||
Sbjct: 795 aatagagatagatagatagatg 774

to top

>emb|BX936349.5| Mouse DNA sequence from clone RP23-416N9 on chromosome X, complete
             sequence
          Length = 96071

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 73336 atagagatagatagatagatga 73315

to top

>dbj|AK046241.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230359C11
           product:unclassifiable, full insert sequence
          Length = 1662

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 18  atagagatagatagatagatga 39
           ||||||||||||||||||||||
Sbjct: 456 atagagatagatagatagatga 477

to top

>gb|AC155725.3| Mus musculus 6 BAC RP24-231N5 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 167534

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 17   aatagagatagatagatagatg 38
            ||||||||||||||||||||||
Sbjct: 3727 aatagagatagatagatagatg 3748

to top

>gb|AC154549.2| Mus musculus BAC clone RP23-443L15 from chromosome 17, complete
             sequence
          Length = 191523

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 89302 atagagatagatagatagatga 89281



 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 15    ataatagagatagatagatagatga 39
             |||||||| ||||||||||||||||
Sbjct: 89214 ataatagatatagatagatagatga 89190

to top

>gb|AC151582.3| Pan troglodytes BAC clone RP43-3F18 from chromosome 7, complete
             sequence
          Length = 197992

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 73243 atagagatagatagatagatga 73222

to top

>gb|AC024887.22| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 99040

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 16    taatagagatagatagatagat 37
             ||||||||||||||||||||||
Sbjct: 65009 taatagagatagatagatagat 65030

to top

>gb|AC084879.23| Homo sapiens 12q BAC RP11-167N24 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 155589

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 18   atagagatagatagatagatga 39
            ||||||||||||||||||||||
Sbjct: 9967 atagagatagatagatagatga 9988

to top

>gb|AC067962.6| Homo sapiens BAC clone RP11-48K7 from 2, complete sequence
          Length = 73565

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 30894 atagagatagatagatagatga 30915

to top

>gb|AC154676.2| Mus musculus BAC clone RP23-146O19 from 17, complete sequence
          Length = 180352

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 20952 atagagatagatagatagatga 20931



 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 15    ataatagagatagatagatagatga 39
             |||||||| ||||||||||||||||
Sbjct: 20864 ataatagatatagatagatagatga 20840

to top

>gb|AC155271.1| Mus musculus BAC clone RP23-204F12 from 16, complete sequence
          Length = 204679

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 22     agatagatagatagatgacanagta 46
              |||||||||||||||||||| ||||
Sbjct: 178074 agatagatagatagatgacagagta 178098

to top

>gb|AC154643.2| Mus musculus BAC clone RP23-277M12 from 13, complete sequence
          Length = 182420

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 135715 atagagatagatagatagatga 135694

to top

>gb|AF054116.1|AF054116 Rattus norvegicus polymorphic marker D5UIA10 sequence
          Length = 531

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 12  attataatagagatagatagatagat 37
           |||||| |||||||||||||||||||
Sbjct: 157 attatattagagatagatagatagat 132

to top

>gb|AC148976.3| Mus musculus BAC clone RP23-391I5 from 7, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 20     agagatagatagatagatgaca 41
              ||||||||||||||||||||||
Sbjct: 104344 agagatagatagatagatgaca 104323



 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 20     agagatagatagatagatgaca 41
              ||||||||||||||||||||||
Sbjct: 104210 agagatagatagatagatgaca 104189

to top

>gb|AC123062.4| Mus musculus BAC clone RP23-218A9 from 13, complete sequence
          Length = 186601

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 21846 atagagatagatagatagatga 21825



 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 21733 atagagatagatagatagatga 21712



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 21904 atagagatagatagatagat 21885



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 21871 atagagatagatagatagat 21852



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 21469 atagagatagatagatagat 21450

to top

>gb|AC141895.4| Mus musculus BAC clone RP23-299L22 from 10, complete sequence
          Length = 178358

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 68179 atagagatagatagatagatga 68158

to top

>gb|AC140270.3| Mus musculus BAC clone RP23-456C8 from 6, complete sequence
          Length = 162117

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 84851 atagagatagatagatagatga 84830



 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 84755 atagagatagatagatagatga 84734

to top

>emb|AL807811.9| Mouse DNA sequence from clone RP23-247I1 on chromosome 4, complete
             sequence
          Length = 249021

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    atagagatagatagatagatga 39
             ||||||||||||||||||||||
Sbjct: 49216 atagagatagatagatagatga 49195



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 49480 atagagatagatagatagat 49461

to top

>emb|AL840626.7| Mouse DNA sequence from clone RP23-151M8 on chromosome 2, complete
              sequence
          Length = 181014

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     atagagatagatagatagatga 39
              ||||||||||||||||||||||
Sbjct: 103813 atagagatagatagatagatga 103834



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104935 atagagatagatagatagat 104954



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104888 atagagatagatagatagat 104907



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104615 atagagatagatagatagat 104634



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104354 atagagatagatagatagat 104373



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104091 atagagatagatagatagat 104110

to top

>gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, complete sequence
          Length = 173914

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 99616 tagagatagatagatagatga 99596

to top

>gb|AC126598.13| Mus musculus chromosome 5, clone RP24-486L9, complete sequence
          Length = 168471

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 20     agagatagatagatagatgac 40
              |||||||||||||||||||||
Sbjct: 136061 agagatagatagatagatgac 136081

to top

>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence
          Length = 171669

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 124512 aatagagatagatagatagat 124532

to top

>gb|AC099607.6| Mus musculus chromosome 5, clone RP23-361G20, complete sequence
          Length = 204179

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 18     atagagatagatagatagatg 38
              |||||||||||||||||||||
Sbjct: 110665 atagagatagatagatagatg 110685

to top

>gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, complete sequence
          Length = 158041

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 131868 aatagagatagatagatagat 131848

to top

>ref|NM_001013019.1| Mus musculus RIKEN cDNA 1110067I12 gene (1110067I12Rik), mRNA
          Length = 2685

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 2614 aatagagatagatagatagat 2634



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 22   agatagatagatagatgaca 41
            ||||||||||||||||||||
Sbjct: 2663 agatagatagatagatgaca 2682

to top

>gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, complete sequence
          Length = 158006

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 108336 aatagagatagatagatagat 108316

to top

>gb|AY324145.1| Desmognathus auriculatus clone Dau11 microsatellite sequence
          Length = 366

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 17  aatagagatagatagatagat 37
           |||||||||||||||||||||
Sbjct: 190 aatagagatagatagatagat 210

to top

>gb|U93889.1|MNU93889 Megaptera novaeangliae clone GATA019 microsatellite sequence
          Length = 997

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 17  aatagagatagatagatagat 37
           |||||||||||||||||||||
Sbjct: 611 aatagagatagatagatagat 591

to top

>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete
             sequence
          Length = 136150

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 11368 aatagagatagatagatagat 11348

to top

>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete
              sequence
          Length = 133983

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 102992 aatagagatagatagatagat 103012



 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 102837 aatagagatagatagatagat 102857

to top

>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence
          Length = 198736

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 131020 aatagagatagatagatagat 131000

to top

>gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17, complete sequence
          Length = 75612

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 4056 aatagagatagatagatagat 4036

to top

>gb|AC134411.7| Mus musculus chromosome 5, clone RP24-369N6, complete sequence
          Length = 150310

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 20    agagatagatagatagatgac 40
             |||||||||||||||||||||
Sbjct: 16605 agagatagatagatagatgac 16625

to top

>gb|AY526337.1| Panulirus argus clone Par3(4D19) microsatellite sequence
          Length = 229

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 17 aatagagatagatagatagat 37
          |||||||||||||||||||||
Sbjct: 61 aatagagatagatagatagat 81

to top

>gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, complete sequence
          Length = 173049

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 44941 aatagagatagatagatagat 44961



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 44920 atagagatagatagatagat 44939

to top

>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence
          Length = 215113

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 206509 aatagagatagatagatagat 206529

to top

>gb|AC109601.9| Oryza sativa chromosome 3 BAC OSJNBa0004G03 genomic sequence, complete
             sequence
          Length = 145590

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 14    tataatagagatagatagatagatg 38
             ||||||||| |||||||||||||||
Sbjct: 65709 tataatagaaatagatagatagatg 65685

to top

>gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, complete sequence
          Length = 112141

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 57598 aatagagatagatagatagat 57618

to top

>gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome 15, complete sequence
          Length = 198894

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 42475 aatagagatagatagatagat 42455

to top

>gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosome Y, complete sequence
          Length = 222176

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 22    agatagatagatagatgacanagt 45
             |||||||||||||||||||| |||
Sbjct: 18514 agatagatagatagatgacatagt 18537



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 79474 agatagatagatagatgaca 79493

to top

>gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosome 10, complete
             sequence
          Length = 195132

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 13    ttataatagagatagatagatagat 37
             |||||||| ||||||||||||||||
Sbjct: 35274 ttataatatagatagatagatagat 35298

to top

>gb|AC102195.14| Mus musculus chromosome 18, clone RP24-430B21, complete sequence
          Length = 173604

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 18630 aatagagatagatagatagat 18610

to top

>gb|AC149595.2| Xenopus tropicalis clone ISB-166A19, complete sequence
          Length = 87377

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 19  tagagatagatagatagatga 39
           |||||||||||||||||||||
Sbjct: 770 tagagatagatagatagatga 790

to top

>gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosome 3, complete sequence
          Length = 198637

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 11456 aatagagatagatagatagat 11436



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 154901 atagagatagatagatagat 154920

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 14       tataatagagatagatagatagatg 38
                ||||||||| |||||||||||||||
Sbjct: 22470462 tataatagaaatagatagatagatg 22470438

to top

>gb|AC164603.4| Mus musculus chromosome 8, clone RP24-114E3, complete sequence
          Length = 164927

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 91634 aatagagatagatagatagat 91654

to top

>gb|AC164102.2| Mus musculus BAC clone RP23-7E23 from chromosome 13, complete
            sequence
          Length = 234552

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 5967 aatagagatagatagatagat 5947

to top

>emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 in linkage group 1,
            complete sequence
          Length = 134952

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 8866 aatagagatagatagatagat 8886



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    tagagatagatagatagatg 38
             ||||||||||||||||||||
Sbjct: 39326 tagagatagatagatagatg 39345

to top

>emb|AL133390.7| Human DNA sequence from clone RP1-317G22 on chromosome 1, complete
             sequence
          Length = 71872

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 16978 aatagagatagatagatagat 16958

to top

>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence
          Length = 152908

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 73011 aatagagatagatagatagat 72991

to top

>gb|AC118607.12| Mus musculus chromosome 14, clone RP23-479D1, complete sequence
          Length = 218552

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 44612 aatagagatagatagatagat 44632

to top

>gb|AC125398.4| Mus musculus BAC clone RP24-217G23 from chromosome 18, complete
             sequence
          Length = 166948

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 66986 tagagatagatagatagatga 66966

to top

>gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosome 19, complete
             sequence
          Length = 175796

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 87314 aatagagatagatagatagat 87334



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 87363 agatagatagatagatgaca 87382

to top

>gb|AC112792.4| Mus musculus BAC clone RP23-192J17 from 18, complete sequence
          Length = 219784

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 173490 aatagagatagatagatagat 173470

to top

>gb|AC124752.4| Mus musculus BAC clone RP23-283G18 from 13, complete sequence
          Length = 215435

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 171786 aatagagatagatagatagat 171806

to top

>gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complete sequence
          Length = 189549

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 16333 aatagagatagatagatagat 16353



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 91303 atagagatagatagatagat 91322

to top

>gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, complete sequence
          Length = 150136

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 130946 aatagagatagatagatagat 130926

to top

>gb|AC114823.4| Mus musculus BAC clone RP23-209L10 from 2, complete sequence
          Length = 170884

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 163149 aatagagatagatagatagat 163169

to top

>gb|AC093714.2| Homo sapiens BAC clone RP11-458K10 from 7, complete sequence
          Length = 142751

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 12939 aatagagatagatagatagat 12919

to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 80728 aatagagatagatagatagat 80748

to top

>gb|AC123675.7| Mus musculus chromosome 15, clone RP23-271I6, complete sequence
          Length = 233422

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     tagagatagatagatagatga 39
              |||||||||||||||||||||
Sbjct: 224685 tagagatagatagatagatga 224705

to top

>gb|AC160638.6| Mus musculus BAC clone RP23-99K6 from chromosome 15, complete sequence
          Length = 218870

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 30541 tagagatagatagatagatga 30561

to top

>gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence
          Length = 174437

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 10     gtattata-atagagatagatagatagat 37
              |||||||| ||||||||||||||||||||
Sbjct: 133194 gtattatatatagagatagatagatagat 133222

to top

>emb|AL672277.20| Human DNA sequence from clone RP11-309M23 on chromosome X contains a
             novel gene and a ribosomal protein L14 (RPL14) pseudogene,
             complete sequence
          Length = 131682

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 87188 atagagatagatagatagatg 87168

to top

>emb|AL450445.6| Human DNA sequence from clone RP11-411G9 on chromosome 13, complete
             sequence
          Length = 141867

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 22    agatagatagatagatgacanagt 45
             |||||||||||||||||||| |||
Sbjct: 67398 agatagatagatagatgacagagt 67375

to top

>emb|AL138915.16| Human DNA sequence from clone RP11-288K24 on chromosome 6, complete
             sequence
          Length = 42569

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 26787 atagagatagatagatagatg 26807

to top

>gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, RP23-49P8 Complete
              Sequence, complete sequence
          Length = 220143

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 142683 aatagagatagatagatagat 142663



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     agatagatagatagatgaca 41
              ||||||||||||||||||||
Sbjct: 142634 agatagatagatagatgaca 142615

to top

>gb|AC165148.2| Mus musculus BAC clone RP24-278K24 from chromosome 14, complete sequence
          Length = 197531

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 125924 aatagagatagatagatagat 125944

to top

>emb|CR352297.14| Zebrafish DNA sequence from clone CH211-165L15 in linkage group 8,
             complete sequence
          Length = 159143

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 13    ttataatagagatagatagatagat 37
             |||||| ||||||||||||||||||
Sbjct: 13214 ttataagagagatagatagatagat 13238

to top

>emb|BX323089.13| Zebrafish DNA sequence from clone DKEYP-10D2 in linkage group 21,
            complete sequence
          Length = 87960

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 6964 aatagagatagatagatagat 6984

to top

>emb|AL713925.10| Mouse DNA sequence from clone RP23-298B18 on chromosome 11, complete
             sequence
          Length = 81699

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 18011 aatagagatagatagatagat 17991

to top

>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 203319

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 168420 aatagagatagatagatagat 168400

to top

>emb|BX276104.14| Mouse DNA sequence from clone RP24-313E3 on chromosome 4, complete
              sequence
          Length = 152376

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 130296 aatagagatagatagatagat 130316

to top

>emb|AL645970.15| Mouse DNA sequence from clone DN-258M5 on chromosome 3, complete
             sequence
          Length = 141160

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 30939 atagagatagatagatagatg 30959

to top

>emb|BX324181.26| Zebrafish DNA sequence from clone CH211-203O8 in linkage group 4,
             complete sequence
          Length = 141840

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 98782 tagagatagatagatagatga 98802



 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 51420 tagagatagatagatagatga 51440



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 98932 atagagatagatagatagat 98951



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 98191 atagagatagatagatagat 98210



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 50769 atagagatagatagatagat 50788



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 21253 atagagatagatagatagat 21272

to top

>gb|AC124771.4| Mus musculus BAC clone RP23-28G12 from chromosome 1, complete
            sequence
          Length = 209463

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 3554 aatagagatagatagatagat 3534

to top

>emb|BX629347.20| Zebrafish DNA sequence from clone DKEY-103K21 in linkage group 12,
             complete sequence
          Length = 200079

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 13    ttataatagagatagatagatagat 37
             |||||||| ||||||||||||||||
Sbjct: 17241 ttataataaagatagatagatagat 17217

to top

>gb|DQ402491.1| Liposcelis decolor microsatellite Lip135 sequence
          Length = 256

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 17  aatagagatagatagatagat 37
           |||||||||||||||||||||
Sbjct: 154 aatagagatagatagatagat 134

to top

>emb|AL844587.19| Zebrafish DNA sequence from clone DKEY-7E14 in linkage group 12, complete
              sequence
          Length = 254964

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 13     ttataatagagatagatagatagat 37
              |||||||| ||||||||||||||||
Sbjct: 170931 ttataataaagatagatagatagat 170907

to top

>gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence
          Length = 219626

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 1197 aatagagatagatagatagat 1177

to top

>gb|AC008249.14| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 184203

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 71619 aatagagatagatagatagat 71599

to top

>emb|BX571955.15| Zebrafish DNA sequence from clone DKEY-27B3 in linkage group 10, complete
              sequence
          Length = 272498

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 259235 aatagagatagatagatagat 259215

to top

>gb|AC104297.1| Homo sapiens chromosome 3 clone RP11-8D23, complete sequence
          Length = 151504

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 18     atagagatagatagatagatg 38
              |||||||||||||||||||||
Sbjct: 124561 atagagatagatagatagatg 124581

to top

>gb|AC006065.3| Homo sapiens 12q24.2 BAC RPCI11-407A16 (Roswell Park Cancer Institute
              Human BAC Library) complete sequence
          Length = 191134

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 160093 aatagagatagatagatagat 160113

to top

>gb|AC097515.5| Homo sapiens BAC clone RP11-446J8 from 4, complete sequence
          Length = 165973

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 73368 aatagagatagatagatagat 73348

to top

>gb|AY034584.1| Mus musculus cathepsin M (CtsM) pseudogene, partial sequence
          Length = 3981

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 17  aatagagatagatagatagat 37
           |||||||||||||||||||||
Sbjct: 317 aatagagatagatagatagat 297



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 22  agatagatagatagatgaca 41
           ||||||||||||||||||||
Sbjct: 377 agatagatagatagatgaca 358

to top

>gb|AC147620.5| Mus musculus BAC clone RP24-285H21 from chromosome 13, complete
             sequence
          Length = 172051

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 30229 aatagagatagatagatagat 30249

to top

>gb|AC174221.4| Mus musculus BAC clone RP24-237K1 from chromosome y, complete sequence
          Length = 171789

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 18818 atagagatagatagatagatg 18798



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 164346 atagagatagatagatagat 164365



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 20720 atagagatagatagatagat 20701



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 17733 atagagatagatagatagat 17714

to top

>emb|BX571983.11| Zebrafish DNA sequence from clone DKEY-18M7 in linkage group 11, complete
              sequence
          Length = 248929

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 166535 aatagagatagatagatagat 166555

to top

>gb|AC160128.2| Mus musculus BAC clone RP23-286G17 from chromosome 12, complete
             sequence
          Length = 202315

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 43311 atagagatagatagatagatg 43291

to top

>gb|AC012601.7| Homo sapiens chromosome 5 clone CTC-288O10, complete sequence
          Length = 110773

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 22    agatagatagatagatgacanagt 45
             |||||||||||||||||||| |||
Sbjct: 63559 agatagatagatagatgacagagt 63582

to top

>gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosome 12, complete sequence
          Length = 141293

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 13     ttataatagagatagatagatagat 37
              |||||||| ||||||||||||||||
Sbjct: 124261 ttataatatagatagatagatagat 124285

to top

>gb|AC138589.16| Mus musculus chromosome 1, clone RP24-153C14, complete sequence
          Length = 172545

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     tagagatagatagatagatga 39
              |||||||||||||||||||||
Sbjct: 162331 tagagatagatagatagatga 162351

to top

>dbj|AK087615.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN
            full-length enriched library, clone:E230025L24
            product:hypothetical protein, full insert sequence
          Length = 2693

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 2622 aatagagatagatagatagat 2642



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 22   agatagatagatagatgaca 41
            ||||||||||||||||||||
Sbjct: 2671 agatagatagatagatgaca 2690

to top

>dbj|AK049485.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:C430016H01
           product:unclassifiable, full insert sequence
          Length = 3374

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 684 ttataatatagatagatagatagat 708

to top

>dbj|AK049402.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430003N24
            product:unclassifiable, full insert sequence
          Length = 3980

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 13   ttataatagagatagatagatagat 37
            |||||||| ||||||||||||||||
Sbjct: 2418 ttataatatagatagatagatagat 2442

to top

>gb|AC006576.15| Homo sapiens Chromosome 12p13.3 BAC Clone 762c12, complete sequence
          Length = 116840

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 20430 aatagagatagatagatagat 20450

to top

>gb|AF226042.1|AF226038S5 Mus musculus isovaleryl CoA dehydrogenase (Ivd) gene, exons 8 through
            11
          Length = 2927

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 13   ttataatagagatagatagatagat 37
            |||||||| ||||||||||||||||
Sbjct: 2797 ttataatatagatagatagatagat 2773

to top

>gb|AC145619.4| Homo sapiens BAC clone RP11-722J20 from chromosome 2, complete
            sequence
          Length = 152973

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 18   atagagatagatagatagatg 38
            |||||||||||||||||||||
Sbjct: 3807 atagagatagatagatagatg 3827

to top

>ref|NG_002774.1| Mus musculus cathepsin M, pseudogene (Ctsm-ps) on chromosome 13
          Length = 3981

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 17  aatagagatagatagatagat 37
           |||||||||||||||||||||
Sbjct: 317 aatagagatagatagatagat 297



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 22  agatagatagatagatgaca 41
           ||||||||||||||||||||
Sbjct: 377 agatagatagatagatgaca 358

to top

>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 180996

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     tagagatagatagatagatga 39
              |||||||||||||||||||||
Sbjct: 137955 tagagatagatagatagatga 137975

to top

>emb|BX539340.7| Zebrafish DNA sequence from clone DKEY-57K2 in linkage group 2,
             complete sequence
          Length = 234470

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 50819 aatagagatagatagatagat 50839

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 14       tataatagagatagatagatagatg 38
                ||||||||| |||||||||||||||
Sbjct: 22463491 tataatagaaatagatagatagatg 22463467

to top

>emb|BX085194.14| Zebrafish DNA sequence from clone DKEY-242M13, complete sequence
          Length = 169865

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 157829 aatagagatagatagatagat 157809

to top

>gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone rp23-362c8, complete
              sequence
          Length = 238658

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 162778 aatagagatagatagatagat 162758

to top

>gb|AC093873.2| Homo sapiens BAC clone RP11-615B17 from 2, complete sequence
          Length = 210320

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 21     gagatagatagatagatgaca 41
              |||||||||||||||||||||
Sbjct: 141487 gagatagatagatagatgaca 141467

to top

>gb|AC080166.6| Homo sapiens BAC clone RP11-813C7 from 2, complete sequence
          Length = 179961

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 21    gagatagatagatagatgaca 41
             |||||||||||||||||||||
Sbjct: 29490 gagatagatagatagatgaca 29470

to top

>gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complete sequence
          Length = 134911

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 73526 aatagagatagatagatagat 73506

to top

>gb|AC102461.15| Mus musculus chromosome 8, clone RP24-319H6, complete sequence
          Length = 169510

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 72701 aatagagatagatagatagat 72721

to top

>gb|AC154389.1| Mus musculus BAC clone RP23-2H9 from chromosome 13, complete sequence
          Length = 215256

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 72095 tagagatagatagatagatga 72075

to top

>gb|AC005904.19| Homo sapiens 12 PAC RP4-751H1 (Roswell Park Cancer Institute Human PAC
             Library) complete sequence
          Length = 65139

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 38181 aatagagatagatagatagat 38201

to top

>gb|AC074264.3| Homo sapiens BAC clone RP11-410L9 from 2, complete sequence
          Length = 122472

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 39463 atagagatagatagatagatg 39483

to top

>gb|AY183109.1| Trifolium repens clone c3.10 microsatellite sequence
          Length = 620

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 249 ttataatatagatagatagatagat 225

to top

>gb|AY183098.1| Trifolium repens clone c1.9 microsatellite sequence
          Length = 620

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 372 ttataatatagatagatagatagat 396

to top

>gb|AY183073.1| Trifolium repens clone a2.22 microsatellite sequence
          Length = 619

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 249 ttataatatagatagatagatagat 225

to top

>gb|AY183071.1| Trifolium repens clone A2.10 microsatellite sequence
          Length = 611

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 249 ttataatatagatagatagatagat 225

to top

>gb|AF482426.1| Homo sapiens encephalopsin splice variant 1 (OPN3) gene, alternatively
             spliced; and choroideremia-like protein (CHML) gene,
             complete cds
          Length = 48497

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 47763 aatagagatagatagatagat 47783

to top

>gb|AC068812.13|AC068812 Homo sapiens chromosome N/A clone RP11-201E13, complete sequence
          Length = 177862

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 69886 aatagagatagatagatagat 69866

to top

>gb|AY178300.1| Trifolium repens microsatellite agr1012 sequence
          Length = 619

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 248 ttataatatagatagatagatagat 224

to top

>gb|AY178297.1| Trifolium repens microsatellite agr1009 sequence
          Length = 620

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 249 ttataatatagatagatagatagat 225

to top

>gb|AY178296.1| Trifolium repens microsatellite agr1007 sequence
          Length = 620

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 13  ttataatagagatagatagatagat 37
           |||||||| ||||||||||||||||
Sbjct: 372 ttataatatagatagatagatagat 396

to top

>gb|AC148974.5| Mus musculus BAC clone RP24-165K23 from chromosome y, complete sequence
          Length = 200783

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 83757 atagagatagatagatagatg 83777



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 84844 atagagatagatagatagat 84863



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 80361 atagagatagatagatagat 80380

to top

>gb|AC124982.13| Mus musculus chromosome 3, clone RP24-173F6, complete sequence
          Length = 180185

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 158045 aatagagatagatagatagat 158065

to top

>emb|BX855594.2| Mouse DNA sequence from clone RP24-322M2 on chromosome 4, complete
             sequence
          Length = 81134

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    tagagatagatagatagatga 39
             |||||||||||||||||||||
Sbjct: 30615 tagagatagatagatagatga 30595

to top

>emb|BX649621.5| Mouse DNA sequence from clone RP23-173F3 on chromosome X, complete
              sequence
          Length = 195039

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 192494 aatagagatagatagatagat 192474

to top

>dbj|BS000169.1| Pan troglodytes chromosome 22 clone:RP43-042E01, map 22, complete
             sequences
          Length = 228269

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 70482 aatagagatagatagatagat 70502

to top

>emb|AL713974.9| Mouse DNA sequence from clone RP23-135I10 on chromosome X, complete
              sequence
          Length = 191603

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 18     atagagatagatagatagatg 38
              |||||||||||||||||||||
Sbjct: 101793 atagagatagatagatagatg 101773

to top

>emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 in linkage group 20,
             complete sequence
          Length = 194459

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 13    ttataatagagatagatagatagat 37
             |||||||| ||||||||||||||||
Sbjct: 53171 ttataatatagatagatagatagat 53147

to top

>emb|BX000986.4| Zebrafish DNA sequence from clone CH211-210B19 in linkage group 19,
            complete sequence
          Length = 151501

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 5337 aatagagatagatagatagat 5317

to top

>emb|CR925790.6| Zebrafish DNA sequence from clone DKEY-275J21 in linkage group 10,
              complete sequence
          Length = 136117

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 107511 aatagagatagatagatagat 107491

to top

>emb|AL162464.5|CNS01RHT Human chromosome 14 DNA sequence BAC R-81F13 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 170110

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 9244 aatagagatagatagatagat 9264

to top

>emb|AL121775.3|CNS01DSG Human chromosome 14 DNA sequence BAC R-552K16 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 172576

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 163534 aatagagatagatagatagat 163554

to top

>gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, complete sequence
          Length = 222700

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 68900 aatagagatagatagatagat 68920

to top

>dbj|AP000626.5| Homo sapiens genomic DNA, chromosome 11q clone:CMB9-21B22, complete
             sequences
          Length = 106316

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 10033 aatagagatagatagatagat 10053

to top

>gb|AC109608.14| Mus musculus strain C57BL/6J chromosome 5 clone rp23-154k6, complete
              sequence
          Length = 216195

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 186600 aatagagatagatagatagat 186620

to top

>gb|AC109606.11| Mus musculus strain C57BL/6J chromosome 5 clone rp23-113m20, complete
              sequence
          Length = 210959

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 196720 aatagagatagatagatagat 196700

to top

>gb|AC161764.4| Mus musculus BAC clone RP23-193D1 from chromosome 14, complete sequence
          Length = 215230

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 201509 aatagagatagatagatagat 201529

to top

>gb|AF056032.1|AF056032 Homo sapiens kynurenine 3-hydroxylase mRNA, complete cds
          Length = 5000

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 2166 aatagagatagatagatagat 2146

to top

>emb|AL928547.12| Mouse DNA sequence from clone RP23-226B16 on chromosome 2, complete
             sequence
          Length = 131255

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 70368 aatagagatagatagatagat 70388

to top

>emb|CR974430.11| Mouse DNA sequence from clone RP23-373C24 on chromosome 17, complete
             sequence
          Length = 199120

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 58106 atagagatagatagatagatg 58086



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 43014 atagagatagatagatagat 42995

to top

>gb|AC114627.8| Mus musculus chromosome 3, clone RP24-108F9, complete sequence
          Length = 152152

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 19     tagagatagatagatagatga 39
              |||||||||||||||||||||
Sbjct: 102084 tagagatagatagatagatga 102064

to top

>emb|AL929565.16| Mouse DNA sequence from clone RP23-454N16 on chromosome 4, complete
             sequence
          Length = 120515

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 55147 aatagagatagatagatagat 55127

to top

>gb|AC145597.4| Mus musculus BAC clone RP24-323M2 from Y, complete sequence
          Length = 199904

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 22    agatagatagatagatgacanagt 45
             |||||||||||||||||||| |||
Sbjct: 75916 agatagatagatagatgacatagt 75893



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 14955 agatagatagatagatgaca 14936

to top

>emb|CT030233.6| Mouse DNA sequence from clone RP24-103C16 on chromosome 14, complete
              sequence
          Length = 216332

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 139615 aatagagatagatagatagat 139595

to top

>gb|AC134608.3| Mus musculus BAC clone RP23-68H13 from 13, complete sequence
          Length = 253539

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 180414 aatagagatagatagatagat 180394

to top

>gb|AC151578.1| Mus musculus BAC clone RP23-218K4 from 18, complete sequence
          Length = 192387

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 14727 aatagagatagatagatagat 14707

to top

>gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, complete sequence
          Length = 200656

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 37374 aatagagatagatagatagat 37394

to top

>gb|M25858.1|HUMVWFA31 Human von Willebrand factor gene, exon 39, 40, 41 and 42, and Alu
            repetitive element
          Length = 5285

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 1945 aatagagatagatagatagat 1925

to top

>gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete sequence
          Length = 197831

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 19   tagagatagatagatagatga 39
            |||||||||||||||||||||
Sbjct: 4646 tagagatagatagatagatga 4626

to top

>gb|AC161932.5| Mus musculus chromosome 18, clone RP24-78F20, complete sequence
          Length = 166896

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 80506 aatagagatagatagatagat 80526

to top

>ref|NM_003679.2| Homo sapiens kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
            (KMO), mRNA
          Length = 4992

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 2158 aatagagatagatagatagat 2138

to top

>emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chromosome 4, complete
              sequence
          Length = 204428

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 123782 aatagagatagatagatagat 123802

to top

>emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chromosome 4, complete
              sequence
          Length = 194837

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     aatagagatagatagatagat 37
              |||||||||||||||||||||
Sbjct: 181859 aatagagatagatagatagat 181879

to top

>emb|AL672106.9| Mouse DNA sequence from clone RP23-372E6 on chromosome X, complete
            sequence
          Length = 121764

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   aatagagatagatagatagat 37
            |||||||||||||||||||||
Sbjct: 2038 aatagagatagatagatagat 2058

to top

>emb|AL845500.6| Mouse DNA sequence from clone RP23-221K3 on chromosome 2, complete
             sequence
          Length = 204459

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aatagagatagatagatagat 37
             |||||||||||||||||||||
Sbjct: 61782 aatagagatagatagatagat 61802

to top

>emb|AL645723.11| Mouse DNA sequence from clone RP23-423N6 on chromosome 4, complete
              sequence
          Length = 220638

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 18     atagagatagatagatagatg 38
              |||||||||||||||||||||
Sbjct: 194257 atagagatagatagatagatg 194277

to top

>emb|AL772371.3| Mouse DNA sequence from clone RP23-234N12 on chromosome 4, complete
             sequence
          Length = 237282

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 22    agatagatagatagatgacanagt 45
             |||||||||||||||||||| |||
Sbjct: 84348 agatagatagatagatgacagagt 84325

to top

>emb|AL772255.12| Mouse DNA sequence from clone RP23-172B16 on chromosome 2, complete
              sequence
          Length = 205973

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 13     ttataatagagatagatagatagat 37
              |||||||| ||||||||||||||||
Sbjct: 173635 ttataatatagatagatagatagat 173611

to top

>emb|AL365336.20| Mouse DNA sequence from clone RP21-639N14 on chromosome 17, complete
             sequence
          Length = 58434

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    atagagatagatagatagatg 38
             |||||||||||||||||||||
Sbjct: 22422 atagagatagatagatagatg 22402



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 18   atagagatagatagatagat 37
            ||||||||||||||||||||
Sbjct: 7322 atagagatagatagatagat 7303

to top

>gb|AC154026.1| Mus musculus 6 NOVECTOR RP24-423A5 (Roswell Park Cancer Institute
              (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 172016

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 134823 atagagatagatagatagat 134804

to top

>gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, complete sequence
          Length = 196761

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 60159 atagagatagatagatagat 60178

to top

>gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, complete sequence
          Length = 213655

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 15775 atagagatagatagatagat 15756

to top

>gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, complete sequence
          Length = 183826

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 175027 atagagatagatagatagat 175046

to top

>gb|AC102156.16| Mus musculus chromosome 18, clone RP23-334L7, complete sequence
          Length = 221632

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     agatagatagatagatgaca 41
              ||||||||||||||||||||
Sbjct: 160760 agatagatagatagatgaca 160779

to top

>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence
          Length = 162962

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 47492 atagagatagatagatagat 47473

to top

>gb|AC116896.7| Mus musculus chromosome 8, clone RP24-531D19, complete sequence
          Length = 163072

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 141570 atagagatagatagatagat 141551

to top

>gb|AC130657.9| Mus musculus chromosome 1, clone RP23-307H3, complete sequence
          Length = 198570

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     agatagatagatagatgaca 41
              ||||||||||||||||||||
Sbjct: 158753 agatagatagatagatgaca 158772

to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 69039 agatagatagatagatgaca 69020

to top

>gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, complete sequence
          Length = 201204

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 130522 atagagatagatagatagat 130503

to top

>gb|AC110544.13| Mus musculus chromosome 3, clone RP23-112A11, complete sequence
          Length = 201027

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 94060 agatagatagatagatgaca 94041

to top

>gb|AC102297.12| Mus musculus chromosome 1, clone RP24-392K18, complete sequence
          Length = 167248

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 70001 agatagatagatagatgaca 69982



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 69982 agatagatagatagatgaca 69963

to top

>gb|AC160134.2| Mus musculus BAC clone RP23-139G11 from chromosome 9, complete sequence
          Length = 176272

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 76551 atagagatagatagatagat 76570

to top

>gb|AC153357.4| Mus musculus BAC clone RP24-124N8 from chromosome 10, complete sequence
          Length = 189789

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 51993 agatagatagatagatgaca 51974

to top

>gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, complete sequence
          Length = 174803

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 114700 atagagatagatagatagat 114719

to top

>gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, complete sequence
          Length = 168366

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 14     tataatagagatagatagatagat 37
              ||||||| ||||||||||||||||
Sbjct: 157105 tataatatagatagatagatagat 157128

to top

>gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome 12, complete sequence
          Length = 172492

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 116261 atagagatagatagatagat 116242

to top

>gb|AC153380.1| Mus musculus  BAC RP23-256G5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 160046

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 126045 atagagatagatagatagat 126026

to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 101330 atagagatagatagatagat 101349

to top

>gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, complete sequence
          Length = 211052

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 129898 atagagatagatagatagat 129917



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 129846 atagagatagatagatagat 129865

to top

>gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, complete sequence
          Length = 215135

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 71978 atagagatagatagatagat 71959

to top

>gb|AC170862.1| Mus musculus chromosome 19, clone wi1-593J16, complete sequence
          Length = 40693

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 20248 atagagatagatagatagat 20229

to top

>gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome 13, complete sequence
          Length = 188084

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 20129 atagagatagatagatagat 20148

to top

>gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, complete sequence
          Length = 171510

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 47143 atagagatagatagatagat 47124



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 47023 atagagatagatagatagat 47004

to top

>gb|AC171175.1| Mus musculus chromosome 19, clone wi1-1715L8, complete sequence
          Length = 37475

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 34302 agatagatagatagatgaca 34283

to top

>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence
          Length = 162317

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104456 atagagatagatagatagat 104437

to top

>gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome 13, complete sequence
          Length = 182805

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 61033 atagagatagatagatagat 61052

to top

>gb|AC164095.4| Mus musculus BAC clone RP23-355A22 from chromosome 7, complete sequence
          Length = 184356

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 124507 atagagatagatagatagat 124488

to top

>gb|AC164648.3| Mus musculus BAC clone RP23-434H4 from chromosome 18, complete sequence
          Length = 198430

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 60076 atagagatagatagatagat 60095

to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 131935 atagagatagatagatagat 131916



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 104540 atagagatagatagatagat 104521

to top

>gb|AC105173.10| Mus musculus chromosome 8, clone RP23-319J15, complete sequence
          Length = 186945

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    agatagatagatagatgaca 41
             ||||||||||||||||||||
Sbjct: 20925 agatagatagatagatgaca 20944

to top

>gb|AC134662.11| Mus musculus chromosome 15, clone RP24-445D14, complete sequence
          Length = 177038

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 133582 atagagatagatagatagat 133563

to top

>gb|AC116121.8| Mus musculus chromosome 8, clone RP23-79K4, complete sequence
          Length = 216001

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 205854 atagagatagatagatagat 205873

to top

>gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, complete sequence
          Length = 209808

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     atagagatagatagatagat 37
              ||||||||||||||||||||
Sbjct: 185831 atagagatagatagatagat 185850



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    atagagatagatagatagat 37
             ||||||||||||||||||||
Sbjct: 25661 atagagatagatagatagat 25642


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,775,901
Number of Sequences: 3902068
Number of extensions: 2775901
Number of successful extensions: 1120553
Number of sequences better than 10.0: 1685
Number of HSP's better than 10.0 without gapping: 1687
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 999503
Number of HSP's gapped (non-prelim): 120961
length of query: 210
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 188
effective length of database: 17,147,199,772
effective search space: 3223673557136
effective search space used: 3223673557136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result