Clone Information

BLAST Search Result

Clone Name	rbasd21g07
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AK068316.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	115	5e-23
2	gb\|AF542191.1\| Triticum aestivum ribosomal protein S8-like mRNA,...	107	1e-20
3	gb\|BT016841.1\| Zea mays clone Contig674 mRNA sequence	105	5e-20
4	gb\|AY105565.1\| Zea mays PCO103958 mRNA sequence	105	5e-20
5	ref\|XM_465742.1\| Oryza sativa (japonica cultivar-group), mRNA	103	2e-19
6	ref\|XM_506804.1\| PREDICTED Oryza sativa (japonica cultivar-group...	103	2e-19
7	dbj\|AK102757.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	2e-19
8	dbj\|AK102402.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	103	2e-19
9	dbj\|D38010.1\|RICRPS8 Oryza sativa (japonica cultivar-group) mRNA...	103	2e-19
10	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	101	8e-19
11	dbj\|AP004837.3\| Oryza sativa (japonica cultivar-group) genomic D...	101	8e-19
12	dbj\|AP004864.3\| Oryza sativa (japonica cultivar-group) genomic D...	101	8e-19
13	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	100	3e-18
14	gb\|BT016470.1\| Zea mays clone Contig303 mRNA sequence	98	1e-17
15	gb\|AY103570.1\| Zea mays PCO088401 mRNA sequence	98	1e-17
16	gb\|U64436.1\|ZMU64436 Zea mays ribosomal protein S8 mRNA, complet...	98	1e-17
17	ref\|NM_122036.2\| Arabidopsis thaliana structural constituent of ...	82	8e-13
18	gb\|AC171266.22\| Medicago truncatula clone mth2-14o4, complete se...	82	8e-13
19	gb\|AY091172.1\| Arabidopsis thaliana unknown protein (At5g20290) ...	82	8e-13
20	gb\|AY050937.1\| Arabidopsis thaliana unknown protein (At5g20290) ...	82	8e-13
21	gb\|AY061909.1\| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, co...	82	8e-13
22	dbj\|AK220812.1\| Arabidopsis thaliana mRNA for hypothetical prote...	82	8e-13
23	gb\|AY052338.1\| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, co...	82	8e-13
24	emb\|BX830341.1\|CNS0A1HO Arabidopsis thaliana Full-length cDNA Co...	82	8e-13
25	emb\|BX829884.1\|CNS0A1CS Arabidopsis thaliana Full-length cDNA Co...	82	8e-13
26	emb\|BX829620.1\|CNS0A1JH Arabidopsis thaliana Full-length cDNA Co...	82	8e-13
27	emb\|BX831734.1\|CNS0A135 Arabidopsis thaliana Full-length cDNA Co...	82	8e-13
28	gb\|AY086963.1\| Arabidopsis thaliana clone 29997 mRNA, complete s...	82	8e-13
29	gb\|AF296825.1\|F5O24 Arabidopsis thaliana BAC F5O24	76	5e-11
30	gb\|BT013650.1\| Lycopersicon esculentum clone 132457R, mRNA sequence	74	2e-10
31	gb\|DQ122869.1\| Chlamydomonas incerta 40S ribosomal protein S8 mR...	74	2e-10
32	gb\|AF071889.1\|AF071889 Prunus armeniaca 40S ribosomal protein S8...	74	2e-10
33	gb\|AY389686.1\| Hyacinthus orientalis ribosomal protein S8 (RPS8)...	70	3e-09
34	gb\|DQ428096.1\| Sorghum propinquum locus PRC0162 genomic sequence	70	3e-09
35	gb\|BT013911.1\| Lycopersicon esculentum clone 132908R, mRNA sequence	68	1e-08
36	emb\|CR735045.2\|CNS0GTXW Tetraodon nigroviridis full-length cDNA	68	1e-08
37	emb\|CR734945.2\|CNS0GTV4 Tetraodon nigroviridis full-length cDNA	68	1e-08
38	emb\|CR734337.2\|CNS0GTE8 Tetraodon nigroviridis full-length cDNA	68	1e-08
39	emb\|CR734850.1\|CNS0GTSH Tetraodon nigroviridis full-length cDNA	68	1e-08
40	emb\|CR734031.2\|CNS0GT5Q Tetraodon nigroviridis full-length cDNA	68	1e-08
41	emb\|CR730960.2\|CNS0GQYD Tetraodon nigroviridis full-length cDNA	68	1e-08
42	emb\|CR712335.2\|CNS0GCL7 Tetraodon nigroviridis full-length cDNA	68	1e-08
43	emb\|CR711539.2\|CNS0GBZ3 Tetraodon nigroviridis full-length cDNA	68	1e-08
44	emb\|CR720256.2\|CNS0GIP2 Tetraodon nigroviridis full-length cDNA	68	1e-08
45	emb\|CR720183.2\|CNS0GIN1 Tetraodon nigroviridis full-length cDNA	68	1e-08
46	emb\|CR723014.2\|CNS0GKTO Tetraodon nigroviridis full-length cDNA	68	1e-08
47	emb\|CR722946.2\|CNS0GKRS Tetraodon nigroviridis full-length cDNA	68	1e-08
48	emb\|CR722651.2\|CNS0GKJL Tetraodon nigroviridis full-length cDNA	68	1e-08
49	emb\|CR722436.2\|CNS0GKDM Tetraodon nigroviridis full-length cDNA	68	1e-08
50	emb\|CR722367.2\|CNS0GKBP Tetraodon nigroviridis full-length cDNA	68	1e-08
51	emb\|CR722332.2\|CNS0GKAQ Tetraodon nigroviridis full-length cDNA	68	1e-08
52	emb\|CR722067.2\|CNS0GK3D Tetraodon nigroviridis full-length cDNA	68	1e-08
53	emb\|CR721951.2\|CNS0GK05 Tetraodon nigroviridis full-length cDNA	68	1e-08
54	emb\|CR721902.2\|CNS0GJYS Tetraodon nigroviridis full-length cDNA	68	1e-08
55	emb\|CR721897.2\|CNS0GJYN Tetraodon nigroviridis full-length cDNA	68	1e-08
56	emb\|CR721779.2\|CNS0GJVD Tetraodon nigroviridis full-length cDNA	68	1e-08
57	emb\|CR721684.2\|CNS0GJSQ Tetraodon nigroviridis full-length cDNA	68	1e-08
58	emb\|CR721564.2\|CNS0GJPE Tetraodon nigroviridis full-length cDNA	68	1e-08
59	emb\|CR721419.2\|CNS0GJLD Tetraodon nigroviridis full-length cDNA	68	1e-08
60	emb\|CR721317.2\|CNS0GJIJ Tetraodon nigroviridis full-length cDNA	68	1e-08
61	emb\|CR720886.2\|CNS0GJ6K Tetraodon nigroviridis full-length cDNA	68	1e-08
62	emb\|CR720872.2\|CNS0GJ66 Tetraodon nigroviridis full-length cDNA	68	1e-08
63	emb\|CR720807.2\|CNS0GJ4D Tetraodon nigroviridis full-length cDNA	68	1e-08
64	emb\|CR720748.2\|CNS0GJ2Q Tetraodon nigroviridis full-length cDNA	68	1e-08
65	emb\|CR720600.2\|CNS0GIYM Tetraodon nigroviridis full-length cDNA	68	1e-08
66	emb\|CR720573.2\|CNS0GIXV Tetraodon nigroviridis full-length cDNA	68	1e-08
67	emb\|CR719791.2\|CNS0GIC5 Tetraodon nigroviridis full-length cDNA	68	1e-08
68	emb\|CR719771.2\|CNS0GIBL Tetraodon nigroviridis full-length cDNA	68	1e-08
69	emb\|CR719736.2\|CNS0GIAM Tetraodon nigroviridis full-length cDNA	68	1e-08
70	emb\|CR717679.2\|CNS0GGPH Tetraodon nigroviridis full-length cDNA	68	1e-08
71	emb\|CR717007.2\|CNS0GG6W Tetraodon nigroviridis full-length cDNA	68	1e-08
72	emb\|CR716808.2\|CNS0GG1D Tetraodon nigroviridis full-length cDNA	68	1e-08
73	emb\|CR715721.2\|CNS0GF79 Tetraodon nigroviridis full-length cDNA	68	1e-08
74	emb\|CR711488.2\|CNS0GBXO Tetraodon nigroviridis full-length cDNA	68	1e-08
75	emb\|CR712627.2\|CNS0GCTB Tetraodon nigroviridis full-length cDNA	68	1e-08
76	emb\|CR710554.2\|CNS0GB7Q Tetraodon nigroviridis full-length cDNA	68	1e-08
77	emb\|CR710457.2\|CNS0GB51 Tetraodon nigroviridis full-length cDNA	68	1e-08
78	emb\|CR709929.2\|CNS0GAQD Tetraodon nigroviridis full-length cDNA	68	1e-08
79	emb\|CR707548.2\|CNS0G8W8 Tetraodon nigroviridis full-length cDNA	68	1e-08
80	emb\|CR705744.2\|CNS0G7I4 Tetraodon nigroviridis full-length cDNA	68	1e-08
81	emb\|CR704947.2\|CNS0G6VZ Tetraodon nigroviridis full-length cDNA	68	1e-08
82	emb\|CR704099.2\|CNS0G68F Tetraodon nigroviridis full-length cDNA	68	1e-08
83	emb\|CR702883.2\|CNS0G5AN Tetraodon nigroviridis full-length cDNA	68	1e-08
84	emb\|CR702113.2\|CNS0G4P9 Tetraodon nigroviridis full-length cDNA	68	1e-08
85	emb\|CR702058.2\|CNS0G4NQ Tetraodon nigroviridis full-length cDNA	68	1e-08
86	emb\|CR700652.2\|CNS0G3KO Tetraodon nigroviridis full-length cDNA	68	1e-08
87	emb\|CR699548.2\|CNS0G2Q0 Tetraodon nigroviridis full-length cDNA	68	1e-08
88	emb\|CR699535.2\|CNS0G2PN Tetraodon nigroviridis full-length cDNA	68	1e-08
89	emb\|CR698592.2\|CNS0G1ZG Tetraodon nigroviridis full-length cDNA	68	1e-08
90	emb\|CR697866.2\|CNS0G1FA Tetraodon nigroviridis full-length cDNA	68	1e-08
91	emb\|CR695550.2\|CNS0FZMY Tetraodon nigroviridis full-length cDNA	68	1e-08
92	emb\|CR694942.2\|CNS0FZ62 Tetraodon nigroviridis full-length cDNA	68	1e-08
93	emb\|CR694808.2\|CNS0FZ2C Tetraodon nigroviridis full-length cDNA	68	1e-08
94	emb\|CR692722.2\|CNS0FXGE Tetraodon nigroviridis full-length cDNA	68	1e-08
95	emb\|CR691874.2\|CNS0FWSU Tetraodon nigroviridis full-length cDNA	68	1e-08
96	emb\|CR691460.2\|CNS0FWHC Tetraodon nigroviridis full-length cDNA	68	1e-08
97	emb\|CR689562.2\|CNS0FV0M Tetraodon nigroviridis full-length cDNA	68	1e-08
98	emb\|CR688242.2\|CNS0FTZY Tetraodon nigroviridis full-length cDNA	68	1e-08
99	emb\|CR688016.2\|CNS0FTTO Tetraodon nigroviridis full-length cDNA	68	1e-08
100	emb\|CR687337.2\|CNS0FTAT Tetraodon nigroviridis full-length cDNA	68	1e-08
101	emb\|CR685095.2\|CNS0FRKJ Tetraodon nigroviridis full-length cDNA	68	1e-08
102	emb\|CR682917.2\|CNS0FPW1 Tetraodon nigroviridis full-length cDNA	68	1e-08
103	emb\|CR682416.2\|CNS0FPI4 Tetraodon nigroviridis full-length cDNA	68	1e-08
104	emb\|CR681208.2\|CNS0FOKK Tetraodon nigroviridis full-length cDNA	68	1e-08
105	emb\|CR680779.2\|CNS0FO8N Tetraodon nigroviridis full-length cDNA	68	1e-08
106	emb\|CR680591.2\|CNS0FO3F Tetraodon nigroviridis full-length cDNA	68	1e-08
107	emb\|CR680308.2\|CNS0FNVK Tetraodon nigroviridis full-length cDNA	68	1e-08
108	emb\|CR679542.2\|CNS0FNAA Tetraodon nigroviridis full-length cDNA	68	1e-08
109	emb\|CR679505.2\|CNS0FN99 Tetraodon nigroviridis full-length cDNA	68	1e-08
110	emb\|CR677521.2\|CNS0FLQK Tetraodon nigroviridis full-length cDNA	68	1e-08
111	emb\|CR678680.2\|CNS0FMMC Tetraodon nigroviridis full-length cDNA	68	1e-08
112	emb\|CR678143.2\|CNS0FM7N Tetraodon nigroviridis full-length cDNA	68	1e-08
113	emb\|CR676640.2\|CNS0FL24 Tetraodon nigroviridis full-length cDNA	68	1e-08
114	emb\|CR675290.2\|CNS0FK0W Tetraodon nigroviridis full-length cDNA	68	1e-08
115	emb\|CR674989.2\|CNS0FJSJ Tetraodon nigroviridis full-length cDNA	68	1e-08
116	emb\|CR674933.2\|CNS0FJQZ Tetraodon nigroviridis full-length cDNA	68	1e-08
117	emb\|CR674790.2\|CNS0FJN0 Tetraodon nigroviridis full-length cDNA	68	1e-08
118	emb\|CR674704.2\|CNS0FJKM Tetraodon nigroviridis full-length cDNA	68	1e-08
119	emb\|CR674019.2\|CNS0FJ1L Tetraodon nigroviridis full-length cDNA	68	1e-08
120	emb\|CR673994.2\|CNS0FJ0W Tetraodon nigroviridis full-length cDNA	68	1e-08
121	emb\|CR673776.2\|CNS0FIUU Tetraodon nigroviridis full-length cDNA	68	1e-08
122	emb\|CR673483.2\|CNS0FIMP Tetraodon nigroviridis full-length cDNA	68	1e-08
123	emb\|CR673216.2\|CNS0FIFA Tetraodon nigroviridis full-length cDNA	68	1e-08
124	emb\|CR673089.2\|CNS0FIBR Tetraodon nigroviridis full-length cDNA	68	1e-08
125	emb\|CR672080.2\|CNS0FHJQ Tetraodon nigroviridis full-length cDNA	68	1e-08
126	emb\|CR671957.2\|CNS0FHGB Tetraodon nigroviridis full-length cDNA	68	1e-08
127	emb\|CR671070.2\|CNS0FGRO Tetraodon nigroviridis full-length cDNA	68	1e-08
128	emb\|CR671531.2\|CNS0FH4H Tetraodon nigroviridis full-length cDNA	68	1e-08
129	emb\|CR670425.2\|CNS0FG9R Tetraodon nigroviridis full-length cDNA	68	1e-08
130	emb\|CR670102.2\|CNS0FG0S Tetraodon nigroviridis full-length cDNA	68	1e-08
131	emb\|CR669246.2\|CNS0FFD0 Tetraodon nigroviridis full-length cDNA	68	1e-08
132	emb\|CR668499.2\|CNS0FES9 Tetraodon nigroviridis full-length cDNA	68	1e-08
133	emb\|CR668447.2\|CNS0FEQT Tetraodon nigroviridis full-length cDNA	68	1e-08
134	emb\|CR667668.2\|CNS0FE56 Tetraodon nigroviridis full-length cDNA	68	1e-08
135	emb\|CR667495.2\|CNS0FE0D Tetraodon nigroviridis full-length cDNA	68	1e-08
136	emb\|CR666848.2\|CNS0FDIE Tetraodon nigroviridis full-length cDNA	68	1e-08
137	emb\|CR666731.2\|CNS0FDF5 Tetraodon nigroviridis full-length cDNA	68	1e-08
138	emb\|CR666353.2\|CNS0FD4N Tetraodon nigroviridis full-length cDNA	68	1e-08
139	emb\|CR666226.2\|CNS0FD14 Tetraodon nigroviridis full-length cDNA	68	1e-08
140	emb\|CR665422.2\|CNS0FCES Tetraodon nigroviridis full-length cDNA	68	1e-08
141	emb\|CR664483.2\|CNS0FBOP Tetraodon nigroviridis full-length cDNA	68	1e-08
142	emb\|CR664233.2\|CNS0FBHR Tetraodon nigroviridis full-length cDNA	68	1e-08
143	emb\|CR662570.2\|CNS0FA7K Tetraodon nigroviridis full-length cDNA	68	1e-08
144	emb\|CR662296.2\|CNS0F9ZY Tetraodon nigroviridis full-length cDNA	68	1e-08
145	emb\|CR662131.2\|CNS0F9VD Tetraodon nigroviridis full-length cDNA	68	1e-08
146	emb\|CR661435.2\|CNS0F9C1 Tetraodon nigroviridis full-length cDNA	68	1e-08
147	emb\|CR661392.2\|CNS0F9AU Tetraodon nigroviridis full-length cDNA	68	1e-08
148	emb\|CR657995.2\|CNS0F6OH Tetraodon nigroviridis full-length cDNA	68	1e-08
149	emb\|CR660473.2\|CNS0F8LB Tetraodon nigroviridis full-length cDNA	68	1e-08
150	emb\|CR660472.2\|CNS0F8LA Tetraodon nigroviridis full-length cDNA	68	1e-08
151	emb\|CR659976.1\|CNS0F87I Tetraodon nigroviridis full-length cDNA	68	1e-08
152	emb\|CR657595.1\|CNS0F6DD Tetraodon nigroviridis full-length cDNA	68	1e-08
153	emb\|CR656812.2\|CNS0F5RM Tetraodon nigroviridis full-length cDNA	68	1e-08
154	emb\|CR656010.2\|CNS0F55C Tetraodon nigroviridis full-length cDNA	68	1e-08
155	emb\|CR653031.2\|CNS0F2UL Tetraodon nigroviridis full-length cDNA	68	1e-08
156	emb\|CR652567.2\|CNS0F2HP Tetraodon nigroviridis full-length cDNA	68	1e-08
157	emb\|CR650230.2\|CNS0F0OS Tetraodon nigroviridis full-length cDNA	68	1e-08
158	emb\|CR649650.2\|CNS0F08O Tetraodon nigroviridis full-length cDNA	68	1e-08
159	emb\|CR649036.2\|CNS0EZRM Tetraodon nigroviridis full-length cDNA	68	1e-08
160	emb\|CR646897.2\|CNS0EY47 Tetraodon nigroviridis full-length cDNA	68	1e-08
161	emb\|CR645504.2\|CNS0EX1I Tetraodon nigroviridis full-length cDNA	68	1e-08
162	emb\|CR645684.2\|CNS0EX6I Tetraodon nigroviridis full-length cDNA	68	1e-08
163	emb\|CR644665.2\|CNS0EWE7 Tetraodon nigroviridis full-length cDNA	68	1e-08
164	emb\|CR644659.2\|CNS0EWE1 Tetraodon nigroviridis full-length cDNA	68	1e-08
165	emb\|CR644566.2\|CNS0EWBG Tetraodon nigroviridis full-length cDNA	68	1e-08
166	emb\|CR642681.2\|CNS0EUV3 Tetraodon nigroviridis full-length cDNA	68	1e-08
167	emb\|CR638084.2\|CNS0ERBE Tetraodon nigroviridis full-length cDNA	68	1e-08
168	emb\|CR637233.2\|CNS0EQNR Tetraodon nigroviridis full-length cDNA	68	1e-08
169	emb\|CR635679.2\|CNS0EPGL Tetraodon nigroviridis full-length cDNA	68	1e-08
170	emb\|CR634602.2\|CNS0EOMO Tetraodon nigroviridis full-length cDNA	68	1e-08
171	emb\|CR634484.2\|CNS0EOJE Tetraodon nigroviridis full-length cDNA	68	1e-08
172	emb\|CR632771.2\|CNS0EN7T Tetraodon nigroviridis full-length cDNA	68	1e-08
173	emb\|CR634149.2\|CNS0EOA3 Tetraodon nigroviridis full-length cDNA	68	1e-08
174	emb\|CR633354.2\|CNS0ENO0 Tetraodon nigroviridis full-length cDNA	68	1e-08
175	emb\|CR633038.2\|CNS0ENF8 Tetraodon nigroviridis full-length cDNA	68	1e-08
176	emb\|CR632933.2\|CNS0ENCB Tetraodon nigroviridis full-length cDNA	68	1e-08
177	emb\|CR632644.2\|CNS0EN4A Tetraodon nigroviridis full-length cDNA	68	1e-08
178	emb\|CR632612.2\|CNS0EN3E Tetraodon nigroviridis full-length cDNA	68	1e-08
179	emb\|CR632450.2\|CNS0EMYW Tetraodon nigroviridis full-length cDNA	68	1e-08
180	emb\|CR631306.2\|CNS0EM33 Tetraodon nigroviridis full-length cDNA	68	1e-08
181	emb\|CR632202.2\|CNS0EMS0 Tetraodon nigroviridis full-length cDNA	68	1e-08
182	emb\|CR632038.2\|CNS0EMNG Tetraodon nigroviridis full-length cDNA	68	1e-08
183	emb\|CR631965.2\|CNS0EMLF Tetraodon nigroviridis full-length cDNA	68	1e-08
184	emb\|CR631764.2\|CNS0EMFU Tetraodon nigroviridis full-length cDNA	68	1e-08
185	emb\|BX829978.1\|CNS0A1LR Arabidopsis thaliana Full-length cDNA Co...	68	1e-08
186	emb\|CR666784.2\|CNS0FDGM Tetraodon nigroviridis full-length cDNA	66	4e-08
187	gb\|AF526213.1\| Argopecten irradians isolate iolsaicl55ct74cn79 r...	66	4e-08
188	gb\|DQ428095.1\| Sorghum bicolor voucher PI585454 locus PRC0162 ge...	64	2e-07
189	gb\|DQ428094.1\| Sorghum bicolor voucher PI267539 locus PRC0162 ge...	64	2e-07
190	gb\|DQ428093.1\| Sorghum bicolor voucher PI267408 locus PRC0162 ge...	64	2e-07
191	gb\|DQ428092.1\| Sorghum bicolor voucher PI152702 locus PRC0162 ge...	64	2e-07
192	gb\|DQ428091.1\| Sorghum bicolor voucher NSL92371 locus PRC0162 ge...	64	2e-07
193	gb\|DQ428090.1\| Sorghum bicolor voucher NSL87666 locus PRC0162 ge...	64	2e-07
194	gb\|DQ428089.1\| Sorghum bicolor voucher NSL56174 locus PRC0162 ge...	64	2e-07
195	gb\|DQ428088.1\| Sorghum bicolor voucher NSL56003 locus PRC0162 ge...	64	2e-07
196	gb\|DQ428087.1\| Sorghum bicolor voucher NSL55243 locus PRC0162 ge...	64	2e-07
197	gb\|DQ428086.1\| Sorghum bicolor voucher NSL51365 locus PRC0162 ge...	64	2e-07
198	gb\|DQ428085.1\| Sorghum bicolor voucher NSL51030 locus PRC0162 ge...	64	2e-07
199	gb\|DQ428084.1\| Sorghum bicolor voucher NSL50875 locus PRC0162 ge...	64	2e-07
200	ref\|NM_214793.1\| Danio rerio ribosomal protein S8 (rps8), mRNA	62	7e-07
201	gb\|AY561509.1\| Danio rerio ribosomal protein S8 (rps8) mRNA, com...	62	7e-07
202	gb\|BC076163.1\| Danio rerio ribosomal protein S8, mRNA (cDNA clon...	62	7e-07
203	emb\|BX569796.6\| Zebrafish DNA sequence from clone CH211-106K21 i...	62	7e-07
204	gb\|DQ200362.1\| Solanum tuberosum clone 054E02 unknown mRNA	60	3e-06
205	emb\|CR697575.2\|CNS0G177 Tetraodon nigroviridis full-length cDNA	60	3e-06
206	emb\|CR684778.2\|CNS0FRBQ Tetraodon nigroviridis full-length cDNA	60	3e-06
207	emb\|CR637883.2\|CNS0ER5T Tetraodon nigroviridis full-length cDNA	60	3e-06
208	emb\|CR631270.2\|CNS0EM23 Tetraodon nigroviridis full-length cDNA	60	3e-06
209	gb\|BT013849.1\| Lycopersicon esculentum clone 132809F, mRNA sequence	58	1e-05
210	emb\|CR677059.2\|CNS0FLDR Tetraodon nigroviridis full-length cDNA	58	1e-05
211	dbj\|AB180415.1\| Plutella xylostella mRNA for Ribosomal protein S...	58	1e-05
212	gb\|AY072291.1\| Spodoptera frugiperda ribosomal protein S8 mRNA, ...	52	7e-04
213	ref\|XM_754565.1\| Ustilago maydis 521 hypothetical protein (UM035...	50	0.003
214	emb\|CT009479.4\| M.truncatula DNA sequence from clone MTH2-164E3 ...	50	0.003
215	gb\|AF266243.1\|AF266243 Gillichthys mirabilis ribosomal protein S...	50	0.003
216	ref\|NM_125314.2\| Arabidopsis thaliana structural constituent of ...	48	0.011
217	gb\|AY643843.1\|AY643842S2 Hordeum vulgare subsp. vulgare clones B...	48	0.011
218	ref\|XM_857234.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
219	ref\|XM_857207.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
220	ref\|XM_857181.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
221	ref\|XM_857151.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
222	ref\|XM_857126.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
223	ref\|XM_857105.1\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
224	ref\|XM_532605.2\| PREDICTED: Canis familiaris similar to ribosoma...	48	0.011
225	gb\|BT004603.1\| Arabidopsis thaliana At5g59240 gene, complete cds	48	0.011
226	gb\|AY392169.1\| Scyliorhinus canicula ribosomal protein S8 mRNA, ...	46	0.042
227	gb\|AF266170.1\|AF266170 Gillichthys mirabilis 40S ribosomal prote...	46	0.042
228	gb\|AF078069.1\|AF078069 Griffithsia japonica 40S ribosomal protei...	46	0.042
229	emb\|AL589722.17\| Mouse DNA sequence from clone RP23-169M24 on ch...	44	0.16
230	gb\|AC090480.11\| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R...	44	0.16
231	gb\|DQ066206.1\| Ixodes scapularis isolate ISUFL48 ribosomal prote...	44	0.16
232	ref\|XM_212814.3\| PREDICTED: Rattus norvegicus similar to ribosom...	44	0.16
233	dbj\|AB095188.1\| Cyanidioschyzon merolae gene for ribosomal prote...	44	0.16
234	gb\|AC151573.2\| Mus musculus BAC clone RP23-410B24 from 8, comple...	44	0.16
235	emb\|AL805933.7\| Mouse DNA sequence from clone RP23-31P9 on chrom...	44	0.16
236	gb\|AY710429.1\| Cryptococcus gattii strain E566 MATa locus, compl...	42	0.65
237	gb\|AY618085.1\| Sterkiella histriomuscorum clone UGC1O0004_E14_R ...	42	0.65
238	gb\|AY618060.1\| Sterkiella histriomuscorum clone UGC1O0003_E10_R ...	42	0.65
239	gb\|AY618124.1\| Sterkiella histriomuscorum clone UGC1O0005_P22_R ...	42	0.65
240	gb\|AY617582.1\| Sterkiella histriomuscorum clone UGC1O0003_H04_R ...	42	0.65
241	emb\|CR664313.2\|CNS0FBJZ Tetraodon nigroviridis full-length cDNA	42	0.65
242	ref\|XM_502669.1\| Yarrowia lipolytica CLIB122, YALI0D10769g predi...	42	0.65
243	emb\|BX053509.1\|CNS09DG9 Single read from an extremity of a full-...	42	0.65
244	emb\|BX053508.1\|CNS09DG8 Single read from an extremity of a full-...	42	0.65
245	emb\|BX053461.1\|CNS09DEX Single read from an extremity of a full-...	42	0.65
246	emb\|BX053451.1\|CNS09DEN Single read from an extremity of a full-...	42	0.65
247	emb\|BX053450.1\|CNS09DEM Single read from an extremity of a full-...	42	0.65
248	emb\|BX072319.1\|CNS09RYR Single read from an extremity of a full-...	42	0.65
249	emb\|BX072318.1\|CNS09RYQ Single read from an extremity of a full-...	42	0.65
250	emb\|BX072237.1\|CNS09RWH Single read from an extremity of a full-...	42	0.65
251	emb\|BX071967.1\|CNS09ROZ Single read from an extremity of a full-...	42	0.65
252	emb\|BX071966.1\|CNS09ROY Single read from an extremity of a full-...	42	0.65
253	emb\|BX071961.1\|CNS09ROT Single read from an extremity of a full-...	42	0.65
254	emb\|BX071960.1\|CNS09ROS Single read from an extremity of a full-...	42	0.65
255	emb\|BX071850.1\|CNS09RLQ Single read from an extremity of a full-...	42	0.65
256	emb\|BX071849.1\|CNS09RLP Single read from an extremity of a full-...	42	0.65
257	emb\|BX071633.1\|CNS09RFP Single read from an extremity of a full-...	42	0.65
258	emb\|BX071632.1\|CNS09RFO Single read from an extremity of a full-...	42	0.65
259	emb\|BX071563.1\|CNS09RDR Single read from an extremity of a full-...	42	0.65
260	emb\|BX071562.1\|CNS09RDQ Single read from an extremity of a full-...	42	0.65
261	emb\|BX071525.1\|CNS09RCP Single read from an extremity of a full-...	42	0.65
262	emb\|BX071491.1\|CNS09RBR Single read from an extremity of a full-...	42	0.65
263	emb\|BX071244.1\|CNS09R4W Single read from an extremity of a full-...	42	0.65
264	emb\|BX071172.1\|CNS09R2W Single read from an extremity of a full-...	42	0.65
265	emb\|BX071171.1\|CNS09R2V Single read from an extremity of a full-...	42	0.65
266	emb\|BX071132.1\|CNS09R1S Single read from an extremity of a full-...	42	0.65
267	emb\|BX071131.1\|CNS09R1R Single read from an extremity of a full-...	42	0.65
268	emb\|BX071104.1\|CNS09R10 Single read from an extremity of a full-...	42	0.65
269	emb\|BX071103.1\|CNS09R0Z Single read from an extremity of a full-...	42	0.65
270	emb\|BX071100.1\|CNS09R0W Single read from an extremity of a full-...	42	0.65
271	emb\|BX071099.1\|CNS09R0V Single read from an extremity of a full-...	42	0.65
272	emb\|BX071415.1\|CNS09R9N Single read from an extremity of a full-...	42	0.65
273	emb\|BX071414.1\|CNS09R9M Single read from an extremity of a full-...	42	0.65
274	emb\|BX071289.1\|CNS09R65 Single read from an extremity of a full-...	42	0.65
275	emb\|BX071288.1\|CNS09R64 Single read from an extremity of a full-...	42	0.65
276	emb\|BX070769.1\|CNS09QRP Single read from an extremity of a full-...	42	0.65
277	emb\|BX070768.1\|CNS09QRO Single read from an extremity of a full-...	42	0.65
278	emb\|BX070764.1\|CNS09QRK Single read from an extremity of a full-...	42	0.65
279	emb\|BX070763.1\|CNS09QRJ Single read from an extremity of a full-...	42	0.65
280	emb\|BX070490.1\|CNS09QJY Single read from an extremity of a full-...	42	0.65
281	emb\|BX070489.1\|CNS09QJX Single read from an extremity of a full-...	42	0.65
282	emb\|BX070461.1\|CNS09QJ5 Single read from an extremity of a full-...	42	0.65
283	emb\|BX070398.1\|CNS09QHE Single read from an extremity of a full-...	42	0.65
284	emb\|BX070397.1\|CNS09QHD Single read from an extremity of a full-...	42	0.65
285	emb\|BX070386.1\|CNS09QH2 Single read from an extremity of a full-...	42	0.65
286	emb\|BX070329.1\|CNS09QFH Single read from an extremity of a full-...	42	0.65
287	emb\|BX070148.1\|CNS09QAG Single read from an extremity of a full-...	42	0.65
288	emb\|BX069994.1\|CNS09Q66 Single read from an extremity of a full-...	42	0.65
289	emb\|BX069993.1\|CNS09Q65 Single read from an extremity of a full-...	42	0.65
290	emb\|BX069955.1\|CNS09Q53 Single read from an extremity of a full-...	42	0.65
291	emb\|BX069954.1\|CNS09Q52 Single read from an extremity of a full-...	42	0.65
292	emb\|BX069881.1\|CNS09Q31 Single read from an extremity of a full-...	42	0.65
293	emb\|BX069880.1\|CNS09Q30 Single read from an extremity of a full-...	42	0.65
294	emb\|BX069866.1\|CNS09Q2M Single read from an extremity of a full-...	42	0.65
295	emb\|BX069865.1\|CNS09Q2L Single read from an extremity of a full-...	42	0.65
296	emb\|BX069820.1\|CNS09Q1C Single read from an extremity of a full-...	42	0.65
297	emb\|BX069819.1\|CNS09Q1B Single read from an extremity of a full-...	42	0.65
298	emb\|BX069796.1\|CNS09Q0O Single read from an extremity of a full-...	42	0.65
299	emb\|BX069795.1\|CNS09Q0N Single read from an extremity of a full-...	42	0.65
300	emb\|BX069794.1\|CNS09Q0M Single read from an extremity of a full-...	42	0.65
301	emb\|BX069793.1\|CNS09Q0L Single read from an extremity of a full-...	42	0.65
302	emb\|BX069774.1\|CNS09Q02 Single read from an extremity of a full-...	42	0.65
303	emb\|BX069773.1\|CNS09Q01 Single read from an extremity of a full-...	42	0.65
304	emb\|BX069735.1\|CNS09PYZ Single read from an extremity of a full-...	42	0.65
305	emb\|BX069734.1\|CNS09PYY Single read from an extremity of a full-...	42	0.65
306	emb\|BX069728.1\|CNS09PYS Single read from an extremity of a full-...	42	0.65
307	emb\|BX060990.1\|CNS09J82 Single read from an extremity of a full-...	42	0.65
308	emb\|BX060989.1\|CNS09J81 Single read from an extremity of a full-...	42	0.65
309	emb\|BX069590.1\|CNS09PUY Single read from an extremity of a full-...	42	0.65
310	emb\|BX069413.1\|CNS09PQ1 Single read from an extremity of a full-...	42	0.65
311	emb\|BX069377.1\|CNS09PP1 Single read from an extremity of a full-...	42	0.65
312	emb\|BX069333.1\|CNS09PNT Single read from an extremity of a full-...	42	0.65
313	emb\|BX069332.1\|CNS09PNS Single read from an extremity of a full-...	42	0.65
314	emb\|BX069274.1\|CNS09PM6 Single read from an extremity of a full-...	42	0.65
315	emb\|BX069273.1\|CNS09PM5 Single read from an extremity of a full-...	42	0.65
316	emb\|BX069096.1\|CNS09PH8 Single read from an extremity of a full-...	42	0.65
317	emb\|BX068944.1\|CNS09PD0 Single read from an extremity of a full-...	42	0.65
318	emb\|BX068831.1\|CNS09P9V Single read from an extremity of a full-...	42	0.65
319	emb\|BX068812.1\|CNS09P9C Single read from an extremity of a full-...	42	0.65
320	emb\|BX068811.1\|CNS09P9B Single read from an extremity of a full-...	42	0.65
321	emb\|BX068460.1\|CNS09OZK Single read from an extremity of a full-...	42	0.65
322	emb\|BX068459.1\|CNS09OZJ Single read from an extremity of a full-...	42	0.65
323	emb\|BX068395.1\|CNS09OXR Single read from an extremity of a full-...	42	0.65
324	emb\|BX068394.1\|CNS09OXQ Single read from an extremity of a full-...	42	0.65
325	emb\|BX068393.1\|CNS09OXP Single read from an extremity of a full-...	42	0.65
326	emb\|BX068317.1\|CNS09OVL Single read from an extremity of a full-...	42	0.65
327	emb\|BX068316.1\|CNS09OVK Single read from an extremity of a full-...	42	0.65
328	emb\|BX068275.1\|CNS09OUF Single read from an extremity of a full-...	42	0.65
329	emb\|BX068274.1\|CNS09OUE Single read from an extremity of a full-...	42	0.65
330	emb\|BX068231.1\|CNS09OT7 Single read from an extremity of a full-...	42	0.65
331	emb\|BX068222.1\|CNS09OSY Single read from an extremity of a full-...	42	0.65
332	emb\|BX068221.1\|CNS09OSX Single read from an extremity of a full-...	42	0.65
333	emb\|BX068202.1\|CNS09OSE Single read from an extremity of a full-...	42	0.65
334	emb\|BX068201.1\|CNS09OSD Single read from an extremity of a full-...	42	0.65
335	emb\|BX068176.1\|CNS09ORO Single read from an extremity of a full-...	42	0.65
336	emb\|BX068140.1\|CNS09OQO Single read from an extremity of a full-...	42	0.65
337	emb\|BX068040.1\|CNS09ONW Single read from an extremity of a full-...	42	0.65
338	emb\|BX068039.1\|CNS09ONV Single read from an extremity of a full-...	42	0.65
339	emb\|BX068008.1\|CNS09ON0 Single read from an extremity of a full-...	42	0.65
340	emb\|BX068007.1\|CNS09OMZ Single read from an extremity of a full-...	42	0.65
341	emb\|BX067834.1\|CNS09OI6 Single read from an extremity of a full-...	42	0.65
342	emb\|BX067833.1\|CNS09OI5 Single read from an extremity of a full-...	42	0.65
343	emb\|BX067830.1\|CNS09OI2 Single read from an extremity of a full-...	42	0.65
344	emb\|BX067829.1\|CNS09OI1 Single read from an extremity of a full-...	42	0.65
345	emb\|BX067718.1\|CNS09OEY Single read from an extremity of a full-...	42	0.65
346	emb\|BX067717.1\|CNS09OEX Single read from an extremity of a full-...	42	0.65
347	emb\|BX067688.1\|CNS09OE4 Single read from an extremity of a full-...	42	0.65
348	emb\|BX067687.1\|CNS09OE3 Single read from an extremity of a full-...	42	0.65
349	emb\|BX067557.1\|CNS09OAH Single read from an extremity of a full-...	42	0.65
350	emb\|BX067556.1\|CNS09OAG Single read from an extremity of a full-...	42	0.65
351	emb\|BX067017.1\|CNS09NVH Single read from an extremity of a full-...	42	0.65
352	emb\|BX067016.1\|CNS09NVG Single read from an extremity of a full-...	42	0.65
353	emb\|BX066981.1\|CNS09NUH Single read from an extremity of a full-...	42	0.65
354	emb\|BX066980.1\|CNS09NUG Single read from an extremity of a full-...	42	0.65
355	emb\|BX066960.1\|CNS09NTW Single read from an extremity of a full-...	42	0.65
356	emb\|BX066958.1\|CNS09NTU Single read from an extremity of a full-...	42	0.65
357	emb\|BX066957.1\|CNS09NTT Single read from an extremity of a full-...	42	0.65
358	emb\|BX066926.1\|CNS09NSY Single read from an extremity of a full-...	42	0.65
359	emb\|BX067234.1\|CNS09O1I Single read from an extremity of a full-...	42	0.65
360	emb\|BX067233.1\|CNS09O1H Single read from an extremity of a full-...	42	0.65
361	emb\|BX067192.1\|CNS09O0C Single read from an extremity of a full-...	42	0.65
362	emb\|BX067191.1\|CNS09O0B Single read from an extremity of a full-...	42	0.65
363	emb\|BX067144.1\|CNS09NZ0 Single read from an extremity of a full-...	42	0.65
364	emb\|BX067143.1\|CNS09NYZ Single read from an extremity of a full-...	42	0.65
365	emb\|BX066827.1\|CNS09NQ7 Single read from an extremity of a full-...	42	0.65
366	emb\|BX066826.1\|CNS09NQ6 Single read from an extremity of a full-...	42	0.65
367	emb\|BX066724.1\|CNS09NNC Single read from an extremity of a full-...	42	0.65
368	emb\|BX066723.1\|CNS09NNB Single read from an extremity of a full-...	42	0.65
369	emb\|BX066439.1\|CNS09NFF Single read from an extremity of a full-...	42	0.65
370	emb\|BX066438.1\|CNS09NFE Single read from an extremity of a full-...	42	0.65
371	emb\|BX066256.1\|CNS09NAC Single read from an extremity of a full-...	42	0.65
372	emb\|BX066255.1\|CNS09NAB Single read from an extremity of a full-...	42	0.65
373	emb\|BX066220.1\|CNS09N9C Single read from an extremity of a full-...	42	0.65
374	emb\|BX066175.1\|CNS09N83 Single read from an extremity of a full-...	42	0.65
375	emb\|BX066174.1\|CNS09N82 Single read from an extremity of a full-...	42	0.65
376	emb\|BX066057.1\|CNS09N4T Single read from an extremity of a full-...	42	0.65
377	emb\|BX066056.1\|CNS09N4S Single read from an extremity of a full-...	42	0.65
378	emb\|BX066054.1\|CNS09N4Q Single read from an extremity of a full-...	42	0.65
379	emb\|BX066022.1\|CNS09N3U Single read from an extremity of a full-...	42	0.65
380	emb\|BX066021.1\|CNS09N3T Single read from an extremity of a full-...	42	0.65
381	emb\|BX065906.1\|CNS09N0M Single read from an extremity of a full-...	42	0.65
382	emb\|BX065905.1\|CNS09N0L Single read from an extremity of a full-...	42	0.65
383	emb\|BX065807.1\|CNS09MXV Single read from an extremity of a full-...	42	0.65
384	emb\|BX065806.1\|CNS09MXU Single read from an extremity of a full-...	42	0.65
385	emb\|BX065724.1\|CNS09MVK Single read from an extremity of a full-...	42	0.65
386	emb\|BX065723.1\|CNS09MVJ Single read from an extremity of a full-...	42	0.65
387	emb\|BX065718.1\|CNS09MVE Single read from an extremity of a full-...	42	0.65
388	emb\|BX065717.1\|CNS09MVD Single read from an extremity of a full-...	42	0.65
389	emb\|BX065502.1\|CNS09MPE Single read from an extremity of a full-...	42	0.65
390	emb\|BX065358.1\|CNS09MLE Single read from an extremity of a full-...	42	0.65
391	emb\|BX065345.1\|CNS09ML1 Single read from an extremity of a full-...	42	0.65
392	emb\|BX065322.1\|CNS09MKE Single read from an extremity of a full-...	42	0.65
393	emb\|BX065321.1\|CNS09MKD Single read from an extremity of a full-...	42	0.65
394	emb\|BX065107.1\|CNS09MEF Single read from an extremity of a full-...	42	0.65
395	emb\|BX065000.1\|CNS09MBG Single read from an extremity of a full-...	42	0.65
396	emb\|BX064999.1\|CNS09MBF Single read from an extremity of a full-...	42	0.65
397	emb\|BX064801.1\|CNS09M5X Single read from an extremity of a full-...	42	0.65
398	emb\|BX064800.1\|CNS09M5W Single read from an extremity of a full-...	42	0.65
399	emb\|BX064629.1\|CNS09M15 Single read from an extremity of a full-...	42	0.65
400	emb\|BX064628.1\|CNS09M14 Single read from an extremity of a full-...	42	0.65
401	emb\|BX064497.1\|CNS09LXH Single read from an extremity of a full-...	42	0.65
402	emb\|BX064362.1\|CNS09LTQ Single read from an extremity of a full-...	42	0.65
403	emb\|BX064272.1\|CNS09LR8 Single read from an extremity of a full-...	42	0.65
404	emb\|BX064263.1\|CNS09LQZ Single read from an extremity of a full-...	42	0.65
405	emb\|BX064262.1\|CNS09LQY Single read from an extremity of a full-...	42	0.65
406	emb\|BX064000.1\|CNS09LJO Single read from an extremity of a full-...	42	0.65
407	emb\|BX063999.1\|CNS09LJN Single read from an extremity of a full-...	42	0.65
408	emb\|BX063959.1\|CNS09LIJ Single read from an extremity of a full-...	42	0.65
409	emb\|BX063958.1\|CNS09LII Single read from an extremity of a full-...	42	0.65
410	emb\|BX063947.1\|CNS09LI7 Single read from an extremity of a full-...	42	0.65
411	emb\|BX063946.1\|CNS09LI6 Single read from an extremity of a full-...	42	0.65
412	emb\|BX063797.1\|CNS09LE1 Single read from an extremity of a full-...	42	0.65
413	emb\|BX063796.1\|CNS09LE0 Single read from an extremity of a full-...	42	0.65
414	emb\|BX063511.1\|CNS09L63 Single read from an extremity of a full-...	42	0.65
415	emb\|BX063510.1\|CNS09L62 Single read from an extremity of a full-...	42	0.65
416	emb\|BX063501.1\|CNS09L5T Single read from an extremity of a full-...	42	0.65
417	emb\|BX063500.1\|CNS09L5S Single read from an extremity of a full-...	42	0.65
418	emb\|BX063273.1\|CNS09KZH Single read from an extremity of a full-...	42	0.65
419	emb\|BX063191.1\|CNS09KX7 Single read from an extremity of a full-...	42	0.65
420	emb\|BX063190.1\|CNS09KX6 Single read from an extremity of a full-...	42	0.65
421	emb\|BX063148.1\|CNS09KW0 Single read from an extremity of a full-...	42	0.65
422	emb\|BX063147.1\|CNS09KVZ Single read from an extremity of a full-...	42	0.65
423	emb\|BX063142.1\|CNS09KVU Single read from an extremity of a full-...	42	0.65
424	emb\|BX063141.1\|CNS09KVT Single read from an extremity of a full-...	42	0.65
425	emb\|BX063115.1\|CNS09KV3 Single read from an extremity of a full-...	42	0.65
426	emb\|BX063114.1\|CNS09KV2 Single read from an extremity of a full-...	42	0.65
427	emb\|BX063109.1\|CNS09KUX Single read from an extremity of a full-...	42	0.65
428	emb\|BX063108.1\|CNS09KUW Single read from an extremity of a full-...	42	0.65
429	emb\|BX063030.1\|CNS09KSQ Single read from an extremity of a full-...	42	0.65
430	emb\|BX062935.1\|CNS09KQ3 Single read from an extremity of a full-...	42	0.65
431	emb\|BX062934.1\|CNS09KQ2 Single read from an extremity of a full-...	42	0.65
432	emb\|BX062880.1\|CNS09KOK Single read from an extremity of a full-...	42	0.65
433	emb\|BX062782.1\|CNS09KLU Single read from an extremity of a full-...	42	0.65
434	emb\|BX062781.1\|CNS09KLT Single read from an extremity of a full-...	42	0.65
435	emb\|BX062699.1\|CNS09KJJ Single read from an extremity of a full-...	42	0.65
436	emb\|BX062698.1\|CNS09KJI Single read from an extremity of a full-...	42	0.65
437	emb\|BX062658.1\|CNS09KIE Single read from an extremity of a full-...	42	0.65
438	emb\|BX062657.1\|CNS09KID Single read from an extremity of a full-...	42	0.65
439	emb\|BX062489.1\|CNS09KDP Single read from an extremity of a full-...	42	0.65
440	emb\|BX062457.1\|CNS09KCT Single read from an extremity of a full-...	42	0.65
441	emb\|BX062456.1\|CNS09KCS Single read from an extremity of a full-...	42	0.65
442	emb\|BX062245.1\|CNS09K6X Single read from an extremity of a full-...	42	0.65
443	emb\|BX062244.1\|CNS09K6W Single read from an extremity of a full-...	42	0.65
444	emb\|BX062191.1\|CNS09K5F Single read from an extremity of a full-...	42	0.65
445	emb\|BX062122.1\|CNS09K3I Single read from an extremity of a full-...	42	0.65
446	emb\|BX062071.1\|CNS09K23 Single read from an extremity of a full-...	42	0.65
447	emb\|BX062070.1\|CNS09K22 Single read from an extremity of a full-...	42	0.65
448	emb\|BX061977.1\|CNS09JZH Single read from an extremity of a full-...	42	0.65
449	emb\|BX061976.1\|CNS09JZG Single read from an extremity of a full-...	42	0.65
450	emb\|BX061938.1\|CNS09JYE Single read from an extremity of a full-...	42	0.65
451	emb\|BX061937.1\|CNS09JYD Single read from an extremity of a full-...	42	0.65
452	emb\|BX061887.1\|CNS09JWZ Single read from an extremity of a full-...	42	0.65
453	emb\|BX061886.1\|CNS09JWY Single read from an extremity of a full-...	42	0.65
454	emb\|BX061764.1\|CNS09JTK Single read from an extremity of a full-...	42	0.65
455	emb\|BX061724.1\|CNS09JSG Single read from an extremity of a full-...	42	0.65
456	emb\|BX061723.1\|CNS09JSF Single read from an extremity of a full-...	42	0.65
457	emb\|BX061458.1\|CNS09JL2 Single read from an extremity of a full-...	42	0.65
458	emb\|BX061402.1\|CNS09JJI Single read from an extremity of a full-...	42	0.65
459	emb\|BX061283.1\|CNS09JG7 Single read from an extremity of a full-...	42	0.65
460	emb\|BX061282.1\|CNS09JG6 Single read from an extremity of a full-...	42	0.65
461	emb\|BX061275.1\|CNS09JFZ Single read from an extremity of a full-...	42	0.65
462	emb\|BX061274.1\|CNS09JFY Single read from an extremity of a full-...	42	0.65
463	emb\|BX061252.1\|CNS09JFC Single read from an extremity of a full-...	42	0.65
464	emb\|BX061251.1\|CNS09JFB Single read from an extremity of a full-...	42	0.65
465	emb\|BX061106.1\|CNS09JBA Single read from an extremity of a full-...	42	0.65
466	emb\|BX060774.1\|CNS09J22 Single read from an extremity of a full-...	42	0.65
467	emb\|BX060773.1\|CNS09J21 Single read from an extremity of a full-...	42	0.65
468	emb\|BX060561.1\|CNS09IW5 Single read from an extremity of a full-...	42	0.65
469	emb\|BX060560.1\|CNS09IW4 Single read from an extremity of a full-...	42	0.65
470	emb\|BX060533.1\|CNS09IVD Single read from an extremity of a full-...	42	0.65
471	emb\|BX060532.1\|CNS09IVC Single read from an extremity of a full-...	42	0.65
472	emb\|BX060505.1\|CNS09IUL Single read from an extremity of a full-...	42	0.65
473	emb\|BX060323.1\|CNS09IPJ Single read from an extremity of a full-...	42	0.65
474	emb\|BX060322.1\|CNS09IPI Single read from an extremity of a full-...	42	0.65
475	emb\|BX060158.1\|CNS09IKY Single read from an extremity of a full-...	42	0.65
476	emb\|BX060157.1\|CNS09IKX Single read from an extremity of a full-...	42	0.65
477	emb\|BX060093.1\|CNS09IJ5 Single read from an extremity of a full-...	42	0.65
478	emb\|BX060092.1\|CNS09IJ4 Single read from an extremity of a full-...	42	0.65
479	emb\|BX060061.1\|CNS09II9 Single read from an extremity of a full-...	42	0.65
480	emb\|BX060060.1\|CNS09II8 Single read from an extremity of a full-...	42	0.65
481	emb\|BX060058.1\|CNS09II6 Single read from an extremity of a full-...	42	0.65
482	emb\|BX059984.1\|CNS09IG4 Single read from an extremity of a full-...	42	0.65
483	emb\|BX059983.1\|CNS09IG3 Single read from an extremity of a full-...	42	0.65
484	emb\|BX059976.1\|CNS09IFW Single read from an extremity of a full-...	42	0.65
485	emb\|BX059965.1\|CNS09IFL Single read from an extremity of a full-...	42	0.65
486	emb\|BX059929.1\|CNS09IEL Single read from an extremity of a full-...	42	0.65
487	emb\|BX059501.1\|CNS09I2P Single read from an extremity of a full-...	42	0.65
488	emb\|BX059500.1\|CNS09I2O Single read from an extremity of a full-...	42	0.65
489	emb\|BX059198.1\|CNS09HUA Single read from an extremity of a full-...	42	0.65
490	emb\|BX059119.1\|CNS09HS3 Single read from an extremity of a full-...	42	0.65
491	emb\|BX059088.1\|CNS09HR8 Single read from an extremity of a full-...	42	0.65
492	emb\|BX059087.1\|CNS09HR7 Single read from an extremity of a full-...	42	0.65
493	emb\|BX059024.1\|CNS09HPG Single read from an extremity of a full-...	42	0.65
494	emb\|BX059003.1\|CNS09HOV Single read from an extremity of a full-...	42	0.65
495	emb\|BX059002.1\|CNS09HOU Single read from an extremity of a full-...	42	0.65
496	emb\|BX058937.1\|CNS09HN1 Single read from an extremity of a full-...	42	0.65
497	emb\|BX058936.1\|CNS09HN0 Single read from an extremity of a full-...	42	0.65
498	emb\|BX058934.1\|CNS09HMY Single read from an extremity of a full-...	42	0.65
499	emb\|BX058878.1\|CNS09HLE Single read from an extremity of a full-...	42	0.65
500	emb\|BX058877.1\|CNS09HLD Single read from an extremity of a full-...	42	0.65

>dbj|AK068316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C04, full
           insert sequence
          Length = 1022

 Score =  115 bits (58), Expect = 5e-23
 Identities = 73/78 (93%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           |||||||||||||||||| ||||||||||| ||||||||||||| ||||| |||||||| 
Sbjct: 754 gcacccttgcccttcttcctctggagcttcttcatgtagaactcaagctctttgccctcc 695

                             
Query: 172 aggatgtacccatcagct 189
           ||||||||||||||||||
Sbjct: 694 aggatgtacccatcagct 677

to top

>gb|AF542191.1| Triticum aestivum ribosomal protein S8-like mRNA, complete sequence
          Length = 806

 Score =  107 bits (54), Expect = 1e-20
 Identities = 66/69 (95%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                       
Query: 122 ccttcttctt-ctggagcttcctcatgtagaactccagctccttgccctcaaggatgtac 180
           |||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||
Sbjct: 740 ccttcttctttctggagcttcntcatgtagaactccagctccttgccctccaggatgtac 681

                    
Query: 181 ccatcagct 189
           |||||||||
Sbjct: 680 ccatcagct 672

to top

>gb|BT016841.1| Zea mays clone Contig674 mRNA sequence
          Length = 989

 Score =  105 bits (53), Expect = 5e-20
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                       
Query: 113 cacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaa 172
           ||||||||||||||||| ||||||||||| ||||||||||||| ||||| || |||||||
Sbjct: 756 cacccttgcccttcttcctctggagcttcttcatgtagaactcgagctctttaccctcaa 697

                            
Query: 173 ggatgtacccatcagct 189
           ||||||| |||||||||
Sbjct: 696 ggatgtagccatcagct 680

to top

>gb|AY105565.1| Zea mays PCO103958 mRNA sequence
          Length = 1091

 Score =  105 bits (53), Expect = 5e-20
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                       
Query: 113 cacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaa 172
           ||||||||||||||||| ||||||||||| ||||||||||||| ||||| || |||||||
Sbjct: 775 cacccttgcccttcttcctctggagcttcttcatgtagaactcgagctctttaccctcaa 716

                            
Query: 173 ggatgtacccatcagct 189
           ||||||| |||||||||
Sbjct: 715 ggatgtagccatcagct 699

to top

>ref|XM_465742.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 932

 Score =  103 bits (52), Expect = 2e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 685

                               
Query: 166 ccctcaaggatgtacccatc 185
           ||||||||||| || |||||
Sbjct: 684 ccctcaaggatatagccatc 665

to top

>ref|XM_506804.1| PREDICTED Oryza sativa (japonica cultivar-group), P0483C08.42 mRNA
          Length = 942

 Score =  103 bits (52), Expect = 2e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 746 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 687

                               
Query: 166 ccctcaaggatgtacccatc 185
           ||||||||||| || |||||
Sbjct: 686 ccctcaaggatatagccatc 667

to top

>dbj|AK102757.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107B18, full
           insert sequence
          Length = 932

 Score =  103 bits (52), Expect = 2e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 685

                               
Query: 166 ccctcaaggatgtacccatc 185
           ||||||||||| || |||||
Sbjct: 684 ccctcaaggatatagccatc 665

to top

>dbj|AK102402.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033092J19, full
           insert sequence
          Length = 940

 Score =  103 bits (52), Expect = 2e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 744 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 685

                               
Query: 166 ccctcaaggatgtacccatc 185
           ||||||||||| || |||||
Sbjct: 684 ccctcaaggatatagccatc 665

to top

>dbj|D38010.1|RICRPS8 Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           S8, complete cds
          Length = 849

 Score =  103 bits (52), Expect = 2e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 714 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 655

                               
Query: 166 ccctcaaggatgtacccatc 185
           ||||||||||| || |||||
Sbjct: 654 ccctcaaggatatagccatc 635

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  101 bits (51), Expect = 8e-19
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                            
Query: 106      gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
                |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 17137681 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 17137622

                           
Query: 166      ccctcaaggat 176
                |||||||||||
Sbjct: 17137621 ccctcaaggat 17137611

to top

>dbj|AP004837.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0483C08
          Length = 143855

 Score =  101 bits (51), Expect = 8e-19
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                          
Query: 106    gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
              |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 119054 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 118995

                         
Query: 166    ccctcaaggat 176
              |||||||||||
Sbjct: 118994 ccctcaaggat 118984

to top

>dbj|AP004864.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0048K16
          Length = 159891

 Score =  101 bits (51), Expect = 8e-19
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 106  gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
            |||| ||||||||||||||||||| ||||||||||| |||||||||| |||||||| |||
Sbjct: 8448 gctgaggcacccttgcccttcttcctctggagcttcttcatgtagaattccagctctttg 8389

                       
Query: 166  ccctcaaggat 176
            |||||||||||
Sbjct: 8388 ccctcaaggat 8378

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                            
Query: 112      gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
                |||||||||||||||||| ||||||||||| ||||||||||||| ||||| |||||||| 
Sbjct: 16659496 gcacccttgcccttcttcctctggagcttcttcatgtagaactcaagctctttgccctcc 16659555

                          
Query: 172      aggatgtacc 181
                ||||||||||
Sbjct: 16659556 aggatgtacc 16659565

to top

>gb|BT016470.1| Zea mays clone Contig303 mRNA sequence
          Length = 936

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           ||||||||||||| |||| |||||| ||||||||||||| ||||| || |||||||||||
Sbjct: 710 cttgcccttcttcctctgtagcttcttcatgtagaactcaagctctttaccctcaaggat 651

                        
Query: 177 gtacccatcagct 189
           |||||||||||||
Sbjct: 650 gtacccatcagct 638

to top

>gb|AY103570.1| Zea mays PCO088401 mRNA sequence
          Length = 1107

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           ||||||||||||| |||| |||||| ||||||||||||| ||||| || |||||||||||
Sbjct: 741 cttgcccttcttcctctgtagcttcttcatgtagaactcaagctctttaccctcaaggat 682

                        
Query: 177 gtacccatcagct 189
           |||||||||||||
Sbjct: 681 gtacccatcagct 669

to top

>gb|U64436.1|ZMU64436 Zea mays ribosomal protein S8 mRNA, complete cds
          Length = 843

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           ||||||||||||| |||| |||||| ||||||||||||| ||||| || |||||||||||
Sbjct: 688 cttgcccttcttcctctgtagcttcttcatgtagaactcaagctctttaccctcaaggat 629

                        
Query: 177 gtacccatcagct 189
           |||||||||||||
Sbjct: 628 gtacccatcagct 616

to top

>ref|NM_122036.2| Arabidopsis thaliana structural constituent of ribosome AT5G20290
           mRNA, complete cds
          Length = 934

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 713 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 654

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 653 aagatgtatccatcagc 637

to top

>gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete sequence
          Length = 137052

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 62/69 (89%)
 Strand = Plus / Minus

                                                                         
Query: 111   ggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctc 170
             ||||||||||||||||||||||||||| ||| |||||||||| || |||||||| || ||
Sbjct: 56155 ggcacccttgcccttcttcttctggagtttcttcatgtagaattctagctccttaccttc 56096

                      
Query: 171   aaggatgta 179
             ||| |||||
Sbjct: 56095 aagaatgta 56087



 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 111   ggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctcctt 164
             ||||| ||||||||||||  ||||||| ||| |||||||||| |||| ||||||
Sbjct: 49817 ggcactcttgcccttctttctctggagtttcttcatgtagaattccaactcctt 49764

to top

>gb|AY091172.1| Arabidopsis thaliana unknown protein (At5g20290) mRNA, complete cds
          Length = 700

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 662 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 603

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 602 aagatgtatccatcagc 586

to top

>gb|AY050937.1| Arabidopsis thaliana unknown protein (At5g20290) mRNA, complete cds
          Length = 940

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 703 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 644

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 643 aagatgtatccatcagc 627

to top

>gb|AY061909.1| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, complete cds
          Length = 669

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 662 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 603

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 602 aagatgtatccatcagc 586

to top

>dbj|AK220812.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-30-P17
          Length = 373

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 181 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 122

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 121 aagatgtatccatcagc 105

to top

>gb|AY052338.1| Arabidopsis thaliana AT5g20290/F5O24_180 mRNA, complete cds
          Length = 895

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 713 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 654

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 653 aagatgtatccatcagc 637

to top

>emb|BX830341.1|CNS0A1HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 660

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 475 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 416

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 415 aagatgtatccatcagc 399

to top

>emb|BX829884.1|CNS0A1CS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB43ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 697 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 638

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 637 aagatgtatccatcagc 621

to top

>emb|BX829620.1|CNS0A1JH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB25ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 697 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 638

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 637 aagatgtatccatcagc 621

to top

>emb|BX831734.1|CNS0A135 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH26ZH03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 867

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 683 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 624

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 623 aagatgtatccatcagc 607

to top

>gb|AY086963.1| Arabidopsis thaliana clone 29997 mRNA, complete sequence
          Length = 895

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           ||||||||||||||||||||||||| |||| ||||||||||||||| ||| || || || 
Sbjct: 713 gcacccttgcccttcttcttctggatcttcttcatgtagaactccaactctttaccttcc 654

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 653 aagatgtatccatcagc 637

to top

>gb|AF296825.1|F5O24 Arabidopsis thaliana BAC F5O24
          Length = 101458

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                           
Query: 112   gcacccttgcccttcttcttctggagcttcctcatgtagaactcca 157
             ||||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 56105 gcacccttgcccttcttcttctggatcttcttcatgtagaactcca 56150

to top

>gb|BT013650.1| Lycopersicon esculentum clone 132457R, mRNA sequence
          Length = 970

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctca 171
           |||||||| || ||||| ||||| |||||| ||||||| |||||||| ||||||||||| 
Sbjct: 718 gcacccttccctttctttttctgtagcttcttcatgtaaaactccagttccttgccctcc 659

                            
Query: 172 aggatgtacccatcagc 188
           | |||||| ||||||||
Sbjct: 658 aagatgtaaccatcagc 642

to top

>gb|DQ122869.1| Chlamydomonas incerta 40S ribosomal protein S8 mRNA, complete cds
          Length = 744

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 123 cttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||||||| | |||| ||||||||||||| |||||||||||||| ||||||||
Sbjct: 630 cttcttcttctgcatcttcttcatgtagaactcgagctccttgccctccaggatgta 574

to top

>gb|AF071889.1|AF071889 Prunus armeniaca 40S ribosomal protein S8 (RPS8) mRNA, complete cds
          Length = 1049

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 111 ggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctc 170
           ||||||||| ||||||||| ||||||||||  ||||||| |||||||| ||||| || ||
Sbjct: 729 ggcaccctttcccttcttcctctggagctttttcatgtaaaactccagttccttaccttc 670

                                
Query: 171 aaggatgtacccatcagcttt 191
            | ||||| ||||||||||||
Sbjct: 669 caagatgtccccatcagcttt 649

to top

>gb|AY389686.1| Hyacinthus orientalis ribosomal protein S8 (RPS8) mRNA, partial cds
          Length = 628

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 111 ggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctc 170
           ||||||||| ||||||||| ||||||||||  ||||||| ||||||||||| || || ||
Sbjct: 345 ggcacccttccccttcttcctctggagctttttcatgtaaaactccagctctttcccttc 286

                          
Query: 171 aaggatgtacccatc 185
            || |||||||||||
Sbjct: 285 cagtatgtacccatc 271

to top

>gb|DQ428096.1| Sorghum propinquum locus PRC0162 genomic sequence
          Length = 796

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 115 cccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaagg 174
           ||||||||||||||   ||| |||||| ||||||||||||| ||||| || |||||||||
Sbjct: 640 cccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctctttaccctcaagg 581

                  
Query: 175 atgtacc 181
           |||||||
Sbjct: 580 atgtacc 574

to top

>gb|BT013911.1| Lycopersicon esculentum clone 132908R, mRNA sequence
          Length = 833

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 116 ccttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaagga 175
           ||||||||||||||||||| || ||| |||| |||||||| || || |||||||| | ||
Sbjct: 707 ccttgcccttcttcttctgtagtttcttcatatagaactcaagttctttgccctccaaga 648

                         
Query: 176 tgtacccatcagct 189
           | ||||||||||||
Sbjct: 647 tatacccatcagct 634

to top

>emb|CR735045.2|CNS0GTXW Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR734945.2|CNS0GTV4 Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 601 cttcctcaggtagaactcaagctccttgccctcaaggatgta 560

to top

>emb|CR734337.2|CNS0GTE8 Tetraodon nigroviridis full-length cDNA
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR734850.1|CNS0GTSH Tetraodon nigroviridis full-length cDNA
          Length = 689

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR734031.2|CNS0GT5Q Tetraodon nigroviridis full-length cDNA
          Length = 660

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR730960.2|CNS0GQYD Tetraodon nigroviridis full-length cDNA
          Length = 704

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 638 cttcctcaggtagaactcaagctccttgccctcaaggatgta 597

to top

>emb|CR712335.2|CNS0GCL7 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR711539.2|CNS0GBZ3 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR720256.2|CNS0GIP2 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR720183.2|CNS0GIN1 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR723014.2|CNS0GKTO Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 630 cttcctcaggtagaactcaagctccttgccctcaaggatgta 589

to top

>emb|CR722946.2|CNS0GKRS Tetraodon nigroviridis full-length cDNA
          Length = 536

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 476 cttcctcaggtagaactcaagctccttgccctcaaggatgta 435

to top

>emb|CR722651.2|CNS0GKJL Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR722436.2|CNS0GKDM Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR722367.2|CNS0GKBP Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR722332.2|CNS0GKAQ Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR722067.2|CNS0GK3D Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR721951.2|CNS0GK05 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR721902.2|CNS0GJYS Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR721897.2|CNS0GJYN Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR721779.2|CNS0GJVD Tetraodon nigroviridis full-length cDNA
          Length = 663

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 597 cttcctcaggtagaactcaagctccttgccctcaaggatgta 556

to top

>emb|CR721684.2|CNS0GJSQ Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR721564.2|CNS0GJPE Tetraodon nigroviridis full-length cDNA
          Length = 670

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR721419.2|CNS0GJLD Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR721317.2|CNS0GJIJ Tetraodon nigroviridis full-length cDNA
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 627 cttcctcaggtagaactcaagctccttgccctcaaggatgta 586

to top

>emb|CR720886.2|CNS0GJ6K Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 627 cttcctcaggtagaactcaagctccttgccctcaaggatgta 586

to top

>emb|CR720872.2|CNS0GJ66 Tetraodon nigroviridis full-length cDNA
          Length = 637

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 571 cttcctcaggtagaactcaagctccttgccctcaaggatgta 530

to top

>emb|CR720807.2|CNS0GJ4D Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR720748.2|CNS0GJ2Q Tetraodon nigroviridis full-length cDNA
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR720600.2|CNS0GIYM Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR720573.2|CNS0GIXV Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR719791.2|CNS0GIC5 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR719771.2|CNS0GIBL Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR719736.2|CNS0GIAM Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR717679.2|CNS0GGPH Tetraodon nigroviridis full-length cDNA
          Length = 689

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR717007.2|CNS0GG6W Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR716808.2|CNS0GG1D Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR715721.2|CNS0GF79 Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR711488.2|CNS0GBXO Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 629 cttcctcaggtagaactcaagctccttgccctcaaggatgta 588

to top

>emb|CR712627.2|CNS0GCTB Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR710554.2|CNS0GB7Q Tetraodon nigroviridis full-length cDNA
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR710457.2|CNS0GB51 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR709929.2|CNS0GAQD Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR707548.2|CNS0G8W8 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR705744.2|CNS0G7I4 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR704947.2|CNS0G6VZ Tetraodon nigroviridis full-length cDNA
          Length = 706

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 640 cttcctcaggtagaactcaagctccttgccctcaaggatgta 599

to top

>emb|CR704099.2|CNS0G68F Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR702883.2|CNS0G5AN Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR702113.2|CNS0G4P9 Tetraodon nigroviridis full-length cDNA
          Length = 689

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 cttcctcaggtagaactcaagctccttgccctcaaggatgta 582

to top

>emb|CR702058.2|CNS0G4NQ Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR700652.2|CNS0G3KO Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR699548.2|CNS0G2Q0 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR699535.2|CNS0G2PN Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR698592.2|CNS0G1ZG Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR697866.2|CNS0G1FA Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR695550.2|CNS0FZMY Tetraodon nigroviridis full-length cDNA
          Length = 498

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 432 cttcctcaggtagaactcaagctccttgccctcaaggatgta 391

to top

>emb|CR694942.2|CNS0FZ62 Tetraodon nigroviridis full-length cDNA
          Length = 702

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 636 cttcctcaggtagaactcaagctccttgccctcaaggatgta 595

to top

>emb|CR694808.2|CNS0FZ2C Tetraodon nigroviridis full-length cDNA
          Length = 671

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR692722.2|CNS0FXGE Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR691874.2|CNS0FWSU Tetraodon nigroviridis full-length cDNA
          Length = 651

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 585 cttcctcaggtagaactcaagctccttgccctcaaggatgta 544

to top

>emb|CR691460.2|CNS0FWHC Tetraodon nigroviridis full-length cDNA
          Length = 596

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 528 cttcctcaggtagaactcaagctccttgccctcaaggatgta 487

to top

>emb|CR689562.2|CNS0FV0M Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR688242.2|CNS0FTZY Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR688016.2|CNS0FTTO Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR687337.2|CNS0FTAT Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR685095.2|CNS0FRKJ Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR682917.2|CNS0FPW1 Tetraodon nigroviridis full-length cDNA
          Length = 700

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 630 cttcctcaggtagaactcaagctccttgccctcaaggatgta 589

to top

>emb|CR682416.2|CNS0FPI4 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR681208.2|CNS0FOKK Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR680779.2|CNS0FO8N Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 597 cttcctcaggtagaactcaagctccttgccctcaaggatgta 556

to top

>emb|CR680591.2|CNS0FO3F Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR680308.2|CNS0FNVK Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR679542.2|CNS0FNAA Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR679505.2|CNS0FN99 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR677521.2|CNS0FLQK Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR678680.2|CNS0FMMC Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR678143.2|CNS0FM7N Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR676640.2|CNS0FL24 Tetraodon nigroviridis full-length cDNA
          Length = 693

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 cttcctcaggtagaactcaagctccttgccctcaaggatgta 582

to top

>emb|CR675290.2|CNS0FK0W Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR674989.2|CNS0FJSJ Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR674933.2|CNS0FJQZ Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR674790.2|CNS0FJN0 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR674704.2|CNS0FJKM Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 601 cttcctcaggtagaactcaagctccttgccctcaaggatgta 560

to top

>emb|CR674019.2|CNS0FJ1L Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 635 cttcctcaggtagaactcaagctccttgccctcaaggatgta 594

to top

>emb|CR673994.2|CNS0FJ0W Tetraodon nigroviridis full-length cDNA
          Length = 688

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 622 cttcctcaggtagaactcaagctccttgccctcaaggatgta 581

to top

>emb|CR673776.2|CNS0FIUU Tetraodon nigroviridis full-length cDNA
          Length = 653

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 584 cttcctcaggtagaactcaagctccttgccctcaaggatgta 543

to top

>emb|CR673483.2|CNS0FIMP Tetraodon nigroviridis full-length cDNA
          Length = 282

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 217 cttcctcaggtagaactcaagctccttgccctcaaggatgta 176

to top

>emb|CR673216.2|CNS0FIFA Tetraodon nigroviridis full-length cDNA
          Length = 564

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 494 cttcctcaggtagaactcaagctccttgccctcaaggatgta 453

to top

>emb|CR673089.2|CNS0FIBR Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR672080.2|CNS0FHJQ Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 636 cttcctcaggtagaactcaagctccttgccctcaaggatgta 595

to top

>emb|CR671957.2|CNS0FHGB Tetraodon nigroviridis full-length cDNA
          Length = 662

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 602 cttcctcaggtagaactcaagctccttgccctcaaggatgta 561

to top

>emb|CR671070.2|CNS0FGRO Tetraodon nigroviridis full-length cDNA
          Length = 686

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 636 cttcctcaggtagaactcaagctccttgccctcaaggatgta 595

to top

>emb|CR671531.2|CNS0FH4H Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR670425.2|CNS0FG9R Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR670102.2|CNS0FG0S Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR669246.2|CNS0FFD0 Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 630 cttcctcaggtagaactcaagctccttgccctcaaggatgta 589

to top

>emb|CR668499.2|CNS0FES9 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR668447.2|CNS0FEQT Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR667668.2|CNS0FE56 Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 631 cttcctcaggtagaactcaagctccttgccctcaaggatgta 590

to top

>emb|CR667495.2|CNS0FE0D Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR666848.2|CNS0FDIE Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR666731.2|CNS0FDF5 Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR666353.2|CNS0FD4N Tetraodon nigroviridis full-length cDNA
          Length = 704

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 643 cttcctcaggtagaactcaagctccttgccctcaaggatgta 602

to top

>emb|CR666226.2|CNS0FD14 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR665422.2|CNS0FCES Tetraodon nigroviridis full-length cDNA
          Length = 675

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 605 cttcctcaggtagaactcaagctccttgccctcaaggatgta 564

to top

>emb|CR664483.2|CNS0FBOP Tetraodon nigroviridis full-length cDNA
          Length = 669

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR664233.2|CNS0FBHR Tetraodon nigroviridis full-length cDNA
          Length = 667

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR662570.2|CNS0FA7K Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR662296.2|CNS0F9ZY Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR662131.2|CNS0F9VD Tetraodon nigroviridis full-length cDNA
          Length = 655

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 601 cttcctcaggtagaactcaagctccttgccctcaaggatgta 560

to top

>emb|CR661435.2|CNS0F9C1 Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR661392.2|CNS0F9AU Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR657995.2|CNS0F6OH Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR660473.2|CNS0F8LB Tetraodon nigroviridis full-length cDNA
          Length = 706

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 636 cttcctcaggtagaactcaagctccttgccctcaaggatgta 595

to top

>emb|CR660472.2|CNS0F8LA Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR659976.1|CNS0F87I Tetraodon nigroviridis full-length cDNA
          Length = 567

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 557 cttcctcaggtagaactcaagctccttgccctcaaggatgta 516

to top

>emb|CR657595.1|CNS0F6DD Tetraodon nigroviridis full-length cDNA
          Length = 634

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR656812.2|CNS0F5RM Tetraodon nigroviridis full-length cDNA
          Length = 663

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgta 559

to top

>emb|CR656010.2|CNS0F55C Tetraodon nigroviridis full-length cDNA
          Length = 689

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 cttcctcaggtagaactcaagctccttgccctcaaggatgta 582

to top

>emb|CR653031.2|CNS0F2UL Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR652567.2|CNS0F2HP Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR650230.2|CNS0F0OS Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR649650.2|CNS0F08O Tetraodon nigroviridis full-length cDNA
          Length = 548

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 482 cttcctcaggtagaactcaagctccttgccctcaaggatgta 441

to top

>emb|CR649036.2|CNS0EZRM Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR646897.2|CNS0EY47 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR645504.2|CNS0EX1I Tetraodon nigroviridis full-length cDNA
          Length = 272

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 206 cttcctcaggtagaactcaagctccttgccctcaaggatgta 165

to top

>emb|CR645684.2|CNS0EX6I Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR644665.2|CNS0EWE7 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR644659.2|CNS0EWE1 Tetraodon nigroviridis full-length cDNA
          Length = 688

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 622 cttcctcaggtagaactcaagctccttgccctcaaggatgta 581

to top

>emb|CR644566.2|CNS0EWBG Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR642681.2|CNS0EUV3 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR638084.2|CNS0ERBE Tetraodon nigroviridis full-length cDNA
          Length = 708

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 640 cttcctcaggtagaactcaagctccttgccctcaaggatgta 599

to top

>emb|CR637233.2|CNS0EQNR Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR635679.2|CNS0EPGL Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR634602.2|CNS0EOMO Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 627 cttcctcaggtagaactcaagctccttgccctcaaggatgta 586

to top

>emb|CR634484.2|CNS0EOJE Tetraodon nigroviridis full-length cDNA
          Length = 618

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 552 cttcctcaggtagaactcaagctccttgccctcaaggatgta 511

to top

>emb|CR632771.2|CNS0EN7T Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR634149.2|CNS0EOA3 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttcctcaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR633354.2|CNS0ENO0 Tetraodon nigroviridis full-length cDNA
          Length = 689

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR633038.2|CNS0ENF8 Tetraodon nigroviridis full-length cDNA
          Length = 685

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 622 cttcctcaggtagaactcaagctccttgccctcaaggatgta 581

to top

>emb|CR632933.2|CNS0ENCB Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR632644.2|CNS0EN4A Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR632612.2|CNS0EN3E Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 438 cttcctcaggtagaactcaagctccttgccctcaaggatgta 397

to top

>emb|CR632450.2|CNS0EMYW Tetraodon nigroviridis full-length cDNA
          Length = 688

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 622 cttcctcaggtagaactcaagctccttgccctcaaggatgta 581

to top

>emb|CR631306.2|CNS0EM33 Tetraodon nigroviridis full-length cDNA
          Length = 688

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcaggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR632202.2|CNS0EMS0 Tetraodon nigroviridis full-length cDNA
          Length = 687

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 cttcctcaggtagaactcaagctccttgccctcaaggatgta 582

to top

>emb|CR632038.2|CNS0EMNG Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|CR631965.2|CNS0EMLF Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 365 cttcctcaggtagaactcaagctccttgccctcaaggatgta 324

to top

>emb|CR631764.2|CNS0EMFU Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 625 cttcctcaggtagaactcaagctccttgccctcaaggatgta 584

to top

>emb|BX829978.1|CNS0A1LR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 112 gcacccttgcccttcttcttctggagcttcctcatgtagaactcca 157
           |||||||| |||||||||||||||| |||| |||||||||||||||
Sbjct: 697 gcaccctttcccttcttcttctggatcttcttcatgtagaactcca 652

to top

>emb|CR666784.2|CNS0FDGM Tetraodon nigroviridis full-length cDNA
          Length = 668

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgt 178
           |||||||| ||||||||| ||||||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagctccttgccctcaaggatgt 560

to top

>gb|AF526213.1| Argopecten irradians isolate iolsaicl55ct74cn79 ribosomal protein
           S8 mRNA, complete cds
          Length = 700

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 135 gagcttcctcatgtagaactccagctccttgccctcaaggatgta 179
           ||||||||||| |||||| ||||||||||| ||||||||||||||
Sbjct: 636 gagcttcctcaggtagaattccagctccttaccctcaaggatgta 592

to top

>gb|DQ428095.1| Sorghum bicolor voucher PI585454 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428094.1| Sorghum bicolor voucher PI267539 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428093.1| Sorghum bicolor voucher PI267408 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428092.1| Sorghum bicolor voucher PI152702 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428091.1| Sorghum bicolor voucher NSL92371 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428090.1| Sorghum bicolor voucher NSL87666 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428089.1| Sorghum bicolor voucher NSL56174 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428088.1| Sorghum bicolor voucher NSL56003 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428087.1| Sorghum bicolor voucher NSL55243 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428086.1| Sorghum bicolor voucher NSL51365 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428085.1| Sorghum bicolor voucher NSL51030 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>gb|DQ428084.1| Sorghum bicolor voucher NSL50875 locus PRC0162 genomic sequence
          Length = 797

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 106 gctgtggcacccttgcccttcttcttctggagcttcctcatgtagaactccagctccttg 165
           |||| ||| ||||||||||||||   ||| |||||| ||||||||||||| ||||| || 
Sbjct: 650 gctgcggcgcccttgcccttcttgcgctgaagcttcttcatgtagaactcaagctcttta 591

                           
Query: 166 ccctcaaggatgtacc 181
           |||||||| |||||||
Sbjct: 590 ccctcaagaatgtacc 575

to top

>ref|NM_214793.1| Danio rerio ribosomal protein S8 (rps8), mRNA
          Length = 698

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgtacccatcagc 188
           |||||||| |||||||||||| || ||||||||||||| ||| ||||||||
Sbjct: 626 cttcctcaggtagaactccagttctttgccctcaaggacgtagccatcagc 576

to top

>gb|AY561509.1| Danio rerio ribosomal protein S8 (rps8) mRNA, complete cds
          Length = 698

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgtacccatcagc 188
           |||||||| |||||||||||| || ||||||||||||| ||| ||||||||
Sbjct: 626 cttcctcaggtagaactccagttctttgccctcaaggacgtagccatcagc 576

to top

>gb|BC076163.1| Danio rerio ribosomal protein S8, mRNA (cDNA clone MGC:92679
           IMAGE:7073896), complete cds
          Length = 714

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgtacccatcagc 188
           |||||||| |||||||||||| || ||||||||||||| ||| ||||||||
Sbjct: 626 cttcctcaggtagaactccagttctttgccctcaaggacgtagccatcagc 576

to top

>emb|BX569796.6| Zebrafish DNA sequence from clone CH211-106K21 in linkage group 2,
             complete sequence
          Length = 109947

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                
Query: 138   cttcctcatgtagaactccagctccttgccctcaaggatgtacccatcagc 188
             |||||||| |||||||||||| || ||||||||||||| ||| ||||||||
Sbjct: 28772 cttcctcaggtagaactccagttctttgccctcaaggacgtagccatcagc 28722

to top

>gb|DQ200362.1| Solanum tuberosum clone 054E02 unknown mRNA
          Length = 856

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           |||||| ||||||||||| || ||| ||||||||||||| ||||| || ||||| |  ||
Sbjct: 663 cttgcctttcttcttctgtagtttcttcatgtagaactcaagctcttttccctccaaaat 604

                     
Query: 177 gtacccatca 186
           ||||||||||
Sbjct: 603 gtacccatca 594

to top

>emb|CR697575.2|CNS0G177 Tetraodon nigroviridis full-length cDNA
          Length = 686

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||||| ||| |||||||||||||||||||||||
Sbjct: 628 cttcctcaggtagagctcaagctccttgccctcaaggatgta 587

to top

>emb|CR684778.2|CNS0FRBQ Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||  ||||||||| |||||||||||||||||||||||
Sbjct: 624 cttcctcgggtagaactcaagctccttgccctcaaggatgta 583

to top

>emb|CR637883.2|CNS0ER5T Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||| | ||||||||| |||||||||||||||||||||||
Sbjct: 626 cttccttaggtagaactcaagctccttgccctcaaggatgta 585

to top

>emb|CR631270.2|CNS0EM23 Tetraodon nigroviridis full-length cDNA
          Length = 688

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgta 179
           |||||||| ||| ||||| |||||||||||||||||||||||
Sbjct: 622 cttcctcaggtaaaactcaagctccttgccctcaaggatgta 581

to top

>gb|BT013849.1| Lycopersicon esculentum clone 132809F, mRNA sequence
          Length = 879

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 118 ttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggatg 177
           ||||| ||||||||||| || ||| ||||||||||||| ||||| || ||||| |  |||
Sbjct: 703 ttgcctttcttcttctgtagtttcttcatgtagaactcaagctcttttccctccaaaatg 644

                    
Query: 178 tacccatca 186
           |||||||||
Sbjct: 643 tacccatca 635

to top

>emb|CR677059.2|CNS0FLDR Tetraodon nigroviridis full-length cDNA
          Length = 665

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 138 cttcctcatgtagaactccagctccttgccctcaaggatgt 178
           |||||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 600 cttcctcaggtagaactcaagccccttgccctcaaggatgt 560

to top

>dbj|AB180415.1| Plutella xylostella mRNA for Ribosomal protein S8, complete cds
          Length = 687

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 138 cttcctcatgtagaactccagctccttgccctc 170
           |||||||| ||||||||||||||||||||||||
Sbjct: 617 cttcctcaggtagaactccagctccttgccctc 585

to top

>gb|AY072291.1| Spodoptera frugiperda ribosomal protein S8 mRNA, complete cds
          Length = 664

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 147 gtagaactccagctccttgccctcaaggatgtacccatcagc 188
           ||||||||| ||||||||||| || |||||||| ||||||||
Sbjct: 603 gtagaactcaagctccttgccttctaggatgtagccatcagc 562

to top

>ref|XM_754565.1| Ustilago maydis 521 hypothetical protein (UM03511.1) partial mRNA
          Length = 633

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           ||||||||| |||||||||||||| ||||||||
Sbjct: 597 gtagaactcgagctccttgccctcgaggatgta 565

to top

>emb|CT009479.4| M.truncatula DNA sequence from clone MTH2-164E3 on chromosome 3,
            complete sequence
          Length = 133351

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 123  cttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggatgta 179
            |||||||||||| || ||| ||||||| || ||||||||||| || || ||||||||
Sbjct: 3720 cttcttcttctgcagtttcttcatgtaaaattccagctccttaccttccaggatgta 3776



 Score = 40.1 bits (20), Expect = 2.6
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 125 tcttcttctggagcttcctcatgtagaactccagctcctt 164
           ||||||| ||||| ||| ||||||| || |||||||||||
Sbjct: 184 tcttcttttggagtttcttcatgtaaaattccagctcctt 223

to top

>gb|AF266243.1|AF266243 Gillichthys mirabilis ribosomal protein S8 mRNA, partial cds
          Length = 294

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 139 ttcctcatgtagaactccagctccttgccctcaagga 175
           ||||||| ||||||||| |||||||||||||| ||||
Sbjct: 265 ttcctcaggtagaactcgagctccttgccctccagga 229

to top

>ref|NM_125314.2| Arabidopsis thaliana structural constituent of ribosome AT5G59240
           mRNA, complete cds
          Length = 851

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           ||||||||||||||| || || ||| |||||||||| || ||||| || || || |  ||
Sbjct: 678 cttgcccttcttcttttgaagtttcttcatgtagaattcgagctctttaccttctaatat 619

                       
Query: 177 gtacccatcagc 188
           ||||||||||||
Sbjct: 618 gtacccatcagc 607

to top

>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness
             locus region
          Length = 129099

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 106   gctgtggcacccttgcccttcttc 129
             ||||||||||||||||||||||||
Sbjct: 74208 gctgtggcacccttgcccttcttc 74231

to top

>ref|XM_857234.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 8 (LOC475381), mRNA
          Length = 738

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 659 ttcctcagatagaactccagctccttgccctc 628

to top

>ref|XM_857207.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 7 (LOC475381), mRNA
          Length = 1010

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 562 ttcctcagatagaactccagctccttgccctc 531

to top

>ref|XM_857181.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 6 (LOC475381), mRNA
          Length = 1098

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 650 ttcctcagatagaactccagctccttgccctc 619

to top

>ref|XM_857151.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 5 (LOC475381), mRNA
          Length = 1113

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 665 ttcctcagatagaactccagctccttgccctc 634

to top

>ref|XM_857126.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 4 (LOC475381), mRNA
          Length = 993

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 611 ttcctcagatagaactccagctccttgccctc 580

to top

>ref|XM_857105.1| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 3 (LOC475381), mRNA
          Length = 1080

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 632 ttcctcagatagaactccagctccttgccctc 601

to top

>ref|XM_532605.2| PREDICTED: Canis familiaris similar to ribosomal protein S8,
           transcript variant 1 (LOC475381), mRNA
          Length = 1107

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 139 ttcctcatgtagaactccagctccttgccctc 170
           |||||||  |||||||||||||||||||||||
Sbjct: 659 ttcctcagatagaactccagctccttgccctc 628

to top

>gb|BT004603.1| Arabidopsis thaliana At5g59240 gene, complete cds
          Length = 633

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                       
Query: 117 cttgcccttcttcttctggagcttcctcatgtagaactccagctccttgccctcaaggat 176
           ||||||||||||||| || || ||| |||||||||| || ||||| || || || |  ||
Sbjct: 615 cttgcccttcttcttttgaagtttcttcatgtagaattcgagctctttaccttctaatat 556

                       
Query: 177 gtacccatcagc 188
           ||||||||||||
Sbjct: 555 gtacccatcagc 544

to top

>gb|AY392169.1| Scyliorhinus canicula ribosomal protein S8 mRNA, partial cds
          Length = 571

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 147 gtagaactccagctccttgccctcaaggatgtacccatcagct 189
           |||||| ||||||||||| || ||||||| ||| |||||||||
Sbjct: 568 gtagaattccagctcctttccttcaaggacgtagccatcagct 526

to top

>gb|AF266170.1|AF266170 Gillichthys mirabilis 40S ribosomal protein S8 mRNA, partial cds
          Length = 298

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 139 ttcctcatgtagaactccagctccttgccctcaagga 175
           ||||||| |||| |||| |||||||||||||| ||||
Sbjct: 267 ttcctcaggtagractcgagctccttgccctccagga 231

to top

>gb|AF078069.1|AF078069 Griffithsia japonica 40S ribosomal protein S8 mRNA, complete cds
          Length = 777

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 148 tagaactccagctccttgccctc 170
           |||||||||||||||||||||||
Sbjct: 617 tagaactccagctccttgccctc 595

to top

>emb|AL589722.17| Mouse DNA sequence from clone RP23-169M24 on chromosome 13 Contains the
              gene for a novel protein similar to ribosomal protein S8
              (Rps8) and a CpG island, complete sequence
          Length = 200125

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 148    tagaactccagctccttgccctcaag 173
              |||||||||||||||||||| |||||
Sbjct: 123855 tagaactccagctccttgccttcaag 123830

to top

>gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-248L18, Complete
             Sequence, complete sequence
          Length = 231039

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 140   tcctcatgtagaactccagctccttg 165
             |||||||||||||||||| |||||||
Sbjct: 21179 tcctcatgtagaactccatctccttg 21154

to top

>gb|DQ066206.1| Ixodes scapularis isolate ISUFL48 ribosomal protein S8 mRNA,
           complete cds
          Length = 630

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 146 tgtagaactccagctccttgccctcaaggatgta 179
           ||||||| || |||||||||||||| ||||||||
Sbjct: 598 tgtagaattcgagctccttgccctccaggatgta 565

to top

>ref|XM_212814.3| PREDICTED: Rattus norvegicus similar to ribosomal protein S8
           (LOC291353), mRNA
          Length = 686

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 138 cttcctcatgtagaactccagctccttgcc 167
           ||||| || |||||||||||||||||||||
Sbjct: 610 cttccgcaggtagaactccagctccttgcc 581

to top

>dbj|AB095188.1| Cyanidioschyzon merolae gene for ribosomal protein S8, complete cds
          Length = 630

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 151 aactccagctccttgccctcaaggatgtacccatcagc 188
           ||||| |||||||||||||| |||||||| || |||||
Sbjct: 590 aactcgagctccttgccctcgaggatgtagccgtcagc 553

to top

>gb|AC151573.2| Mus musculus BAC clone RP23-410B24 from 8, complete sequence
          Length = 202731

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 140   tcctcatgtagaactccagctccttg 165
             |||||||||||||||||| |||||||
Sbjct: 90877 tcctcatgtagaactccatctccttg 90902

to top

>emb|AL805933.7| Mouse DNA sequence from clone RP23-31P9 on chromosome X, complete
              sequence
          Length = 209410

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 148    tagaactccagctccttgccctcaag 173
              |||||||||||||||||||| |||||
Sbjct: 184792 tagaactccagctccttgccttcaag 184767

to top

>gb|AY710429.1| Cryptococcus gattii strain E566 MATa locus, complete sequence
          Length = 144400

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     gaaccgtttacagaaaatggt 26
             |||||||||||||||||||||
Sbjct: 32590 gaaccgtttacagaaaatggt 32570

to top

>gb|AY618085.1| Sterkiella histriomuscorum clone UGC1O0004_E14_R genomic sequence
          Length = 510

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 145 atgtagaactccagctccttgccctcaaggatgtacccatcagct 189
           ||||||||||| || || ||||| || |||||||| |||||||||
Sbjct: 352 atgtagaactcgagttctttgccttcgaggatgtaaccatcagct 396

to top

>gb|AY618060.1| Sterkiella histriomuscorum clone UGC1O0003_E10_R genomic sequence
          Length = 1087

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 145 atgtagaactccagctccttgccctcaaggatgtacccatcagct 189
           ||||||||||| || || ||||| || |||||||| |||||||||
Sbjct: 351 atgtagaactcgagttctttgccttcgaggatgtaaccatcagct 395

to top

>gb|AY618124.1| Sterkiella histriomuscorum clone UGC1O0005_P22_R genomic sequence
          Length = 1089

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 145 atgtagaactccagctccttgccctcaaggatgtacccatcagct 189
           ||||||||||| || || ||||| || |||||||| |||||||||
Sbjct: 351 atgtagaactcgagttctttgccttcgaggatgtaaccatcagct 395

to top

>gb|AY617582.1| Sterkiella histriomuscorum clone UGC1O0003_H04_R genomic sequence
          Length = 1082

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 145 atgtagaactccagctccttgccctcaaggatgtacccatcagct 189
           ||||||||||| || || ||||| || |||||||| |||||||||
Sbjct: 731 atgtagaactcgagttctttgccttcgaggatgtaaccatcagct 687

to top

>emb|CR664313.2|CNS0FBJZ Tetraodon nigroviridis full-length cDNA
          Length = 695

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||| |||| ||| |||||||||||||||||||
Sbjct: 620 gtagtactcaagccccttgccctcaaggatgta 588

to top

>ref|XM_502669.1| Yarrowia lipolytica CLIB122, YALI0D10769g predicted mRNA
          Length = 984

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 113 cacccttgcccttcttcttct 133
           |||||||||||||||||||||
Sbjct: 307 cacccttgcccttcttcttct 287

to top

>emb|BX053509.1|CNS09DG9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 333 gtagaattcaagctccttgccctccaggatgta 365

to top

>emb|BX053508.1|CNS09DG8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 623 gtagaattcaagctccttgccctccaggatgta 591

to top

>emb|BX053461.1|CNS09DEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 619 gtagaattcaagctccttgccctccaggatgta 587

to top

>emb|BX053451.1|CNS09DEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 338 gtagaattcaagctccttgccctccaggatgta 370

to top

>emb|BX053450.1|CNS09DEM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 615 gtagaattcaagctccttgccctccaggatgta 583

to top

>emb|BX072319.1|CNS09RYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 374 gtagaattcaagctccttgccctccaggatgta 406

to top

>emb|BX072318.1|CNS09RYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 497 gtagaattcaagctccttgccctccaggatgta 465

to top

>emb|BX072237.1|CNS09RWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 147 gtagaactccagctccttgccctcaaggatgta 179
           |||||| || |||||||||||||| ||||||||
Sbjct: 116 gtagaattcaagctccttgccctccaggatgta 84


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,622,797
Number of Sequences: 3902068
Number of extensions: 2622797
Number of successful extensions: 134831
Number of sequences better than 10.0: 973
Number of HSP's better than 10.0 without gapping: 973
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 133667
Number of HSP's gapped (non-prelim): 1164
length of query: 203
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 181
effective length of database: 17,147,199,772
effective search space: 3103643158732
effective search space used: 3103643158732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result