ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd21f22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_469689.1| Oryza sativa (japonica cultivar-group), mRNA 488 e-134
2dbj|AK120299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 488 e-134
3gb|BT016248.1| Zea mays clone Contig81 mRNA sequence 436 e-119
4gb|AY104056.1| Zea mays PCO122239 mRNA sequence 434 e-118
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 383 e-103
6gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic ... 383 e-103
7gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genom... 383 e-103
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 383 e-103
9ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative... 234 3e-58
10dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 226 7e-56
11gb|AF193345.1|AF193345 Oryza sativa H2A protein mRNA, complete cds 210 4e-51
12gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 204 2e-49
13dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
14gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 204 2e-49
15gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 204 2e-49
16dbj|AP006681.1| Lotus japonicus genomic DNA, chromosome 1, clone... 190 4e-45
17ref|NM_187762.1| Oryza sativa (japonica cultivar-group), predic... 182 9e-43
18gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome... 182 9e-43
19dbj|AK121533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 9e-43
20dbj|AK061605.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 9e-43
21gb|AY104725.1| Zea mays PCO121651 mRNA sequence 182 9e-43
22gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histon... 168 1e-38
23gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histon... 168 1e-38
24gb|DQ215049.1| Taeniopygia guttata clone 0058P0049H09 H2A histon... 168 1e-38
25gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histon... 168 1e-38
26gb|DQ215046.1| Taeniopygia guttata clone 0058P0036G12 H2A histon... 168 1e-38
27gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histon... 161 3e-36
28gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histon... 161 3e-36
29emb|CR719262.2|CNS0GHXG Tetraodon nigroviridis full-length cDNA 155 2e-34
30emb|CR714103.2|CNS0GDYB Tetraodon nigroviridis full-length cDNA 155 2e-34
31emb|CR710974.2|CNS0GBJE Tetraodon nigroviridis full-length cDNA 155 2e-34
32emb|CR708160.2|CNS0G9D8 Tetraodon nigroviridis full-length cDNA 155 2e-34
33emb|CR706063.2|CNS0G7QZ Tetraodon nigroviridis full-length cDNA 155 2e-34
34emb|CR706962.2|CNS0G8FY Tetraodon nigroviridis full-length cDNA 155 2e-34
35emb|CR705074.2|CNS0G6ZI Tetraodon nigroviridis full-length cDNA 155 2e-34
36emb|CR678084.2|CNS0FM61 Tetraodon nigroviridis full-length cDNA 155 2e-34
37emb|CR676044.2|CNS0FKLU Tetraodon nigroviridis full-length cDNA 155 2e-34
38emb|CR673909.2|CNS0FIYJ Tetraodon nigroviridis full-length cDNA 155 2e-34
39emb|CR671294.2|CNS0FGXW Tetraodon nigroviridis full-length cDNA 155 2e-34
40gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence 153 8e-34
41gb|BC049523.1| Danio rerio similar to H2A histone family, member... 147 5e-32
42emb|CR711930.2|CNS0GC9Y Tetraodon nigroviridis full-length cDNA 147 5e-32
43ref|XM_693453.1| PREDICTED: Danio rerio similar to H2A histone f... 147 5e-32
44gb|BT014555.1| Lycopersicon esculentum clone 133985F, mRNA sequence 145 2e-31
45emb|CR671361.2|CNS0FGZR Tetraodon nigroviridis full-length cDNA 141 3e-30
46gb|AC144617.10| Medicago truncatula clone mth2-7m9, complete seq... 139 1e-29
47ref|NM_115313.3| Arabidopsis thaliana DNA binding AT3G54560 mRNA... 127 4e-26
48emb|Y12575.1|ATH2AV Arabidopsis thaliana mRNA for histone H2A.F/Z 127 4e-26
49emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, B... 127 4e-26
50emb|BX825753.1|CNS0A65Y Arabidopsis thaliana Full-length cDNA Co... 127 4e-26
51gb|BT005205.1| Arabidopsis thaliana At3g54560 mRNA, complete cds 127 4e-26
52gb|AY087232.1| Arabidopsis thaliana clone 33085 mRNA, complete s... 127 4e-26
53emb|CR733482.2|CNS0GSQH Tetraodon nigroviridis full-length cDNA 119 1e-23
54emb|CR732601.2|CNS0GS7Y Tetraodon nigroviridis full-length cDNA 119 1e-23
55emb|CR725413.2|CNS0GMOB Tetraodon nigroviridis full-length cDNA 119 1e-23
56emb|CR694893.1|CNS0FZ4P Tetraodon nigroviridis full-length cDNA 119 1e-23
57emb|BX822865.1|CNS0A7LY Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
58gb|BC049019.1| Danio rerio H2A histone family, member Z, mRNA (c... 111 3e-21
59ref|NM_153644.1| Danio rerio H2A histone family, member Z (h2afz... 111 3e-21
60gb|AF414110.1|AF414110 Danio rerio histone variant H2A.F/Z mRNA,... 111 3e-21
61ref|XM_702461.1| PREDICTED: Danio rerio similar to H2A histone f... 111 3e-21
62ref|XM_679474.1| PREDICTED: Danio rerio similar to H2A histone f... 111 3e-21
63emb|CR692524.2|CNS0FXAW Tetraodon nigroviridis full-length cDNA 109 1e-20
64gb|AY190700.1| Pagrus major histone H2A.F/Z variant mRNA, partia... 103 6e-19
65gb|BC078599.1| Xenopus laevis MGC85536 protein, mRNA (cDNA clone... 101 3e-18
66emb|X05547.1|SPH2AFZ Sea urchin mRNA fragment for histone H2A.F/Z 100 1e-17
67ref|XM_504921.1| Yarrowia lipolytica CLIB122, YALI0F02827g predi... 98 4e-17
68ref|XM_786337.1| PREDICTED: Strongylocentrotus purpuratus histon... 98 4e-17
69emb|X07485.1|DMH2AVD D. melanogaster H2AvD mRNA for histone 2A v... 98 4e-17
70gb|AY118910.1| Drosophila melanogaster LD21568 full insert cDNA 98 4e-17
71ref|NM_079795.2| Drosophila melanogaster Histone H2A variant CG5... 98 4e-17
72emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 98 4e-17
73ref|XM_970375.1| PREDICTED: Tribolium castaneum similar to H2A h... 96 2e-16
74emb|V00414.1|GGHI01 Gallus gallus mRNA coding for a variant hist... 96 2e-16
75ref|NM_179968.2| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 6e-16
76ref|NM_129438.2| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 6e-16
77ref|NM_179967.1| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 6e-16
78gb|AC007133.7| Arabidopsis thaliana chromosome 2 clone F13I13 ma... 94 6e-16
79dbj|AK220868.1| Arabidopsis thaliana mRNA for histone H2A, compl... 94 6e-16
80emb|BX821413.1|CNS0AA9R Arabidopsis thaliana Full-length cDNA Co... 94 6e-16
81emb|BX821514.1|CNS0A96I Arabidopsis thaliana Full-length cDNA Co... 94 6e-16
82gb|AY088573.1| Arabidopsis thaliana clone 8 mRNA, complete sequence 94 6e-16
83gb|DQ215814.1| Taeniopygia guttata clone 0058P0009E02 histone H2... 92 2e-15
84gb|DQ215811.1| Taeniopygia guttata clone 0063P0013F11 histone H2... 92 2e-15
85gb|DQ215810.1| Taeniopygia guttata clone 0061P0002G07 histone H2... 92 2e-15
86gb|DQ215809.1| Taeniopygia guttata clone 0058P0022F11 histone H2... 92 2e-15
87gb|DQ215807.1| Taeniopygia guttata clone 0065P0002B11 histone H2... 92 2e-15
88gb|DQ215806.1| Taeniopygia guttata clone 0058P0039A02 histone H2... 92 2e-15
89gb|DQ215804.1| Taeniopygia guttata clone 0058P0059H06 histone H2... 92 2e-15
90gb|DQ215803.1| Taeniopygia guttata clone 0058P0052E09 histone H2... 92 2e-15
91emb|BX070691.1|CNS09QPJ Single read from an extremity of a full-... 88 4e-14
92emb|X15549.1|DMH2AVDG D.melanogaster H2AvD gene for histone H2A ... 88 4e-14
93gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, r... 88 4e-14
94ref|XM_310818.2| Anopheles gambiae str. PEST ENSANGP00000015579 ... 88 4e-14
95gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96... 88 4e-14
96gb|BC086348.1| Rattus norvegicus H2A histone family, member Z, m... 86 2e-13
97gb|BC074203.1| Xenopus laevis MGC82121 protein, mRNA (cDNA clone... 86 2e-13
98gb|BC060564.1| Rattus norvegicus H2A histone family, member Z, m... 86 2e-13
99ref|NM_068168.2| Caenorhabditis elegans R08C7.3 (R08C7.3) mRNA, ... 86 2e-13
100ref|NM_001016178.2| Xenopus tropicalis hypothetical protein LOC5... 86 2e-13
101gb|BC091605.1| Xenopus tropicalis hypothetical protein LOC548932... 86 2e-13
102ref|NM_022674.1| Rattus norvegicus H2A histone family, member Z ... 86 2e-13
103gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence 86 2e-13
104emb|X52316.1|RSH2AZ Rat mRNA for histone H2A.Z 86 2e-13
105emb|CR761860.2| Xenopus tropicalis finished cDNA, clone TGas096d24 86 2e-13
106gb|M37584.1|RATHIS2AZ Rat histone (H2A.Z) mRNA, complete cds 86 2e-13
107gb|DQ215813.1| Taeniopygia guttata clone 0058P0052D09 histone H2... 84 6e-13
108gb|DQ215808.1| Taeniopygia guttata clone 0058P0029H07 histone H2... 84 6e-13
109gb|DQ215805.1| Taeniopygia guttata clone 0061P0010E11 histone H2... 84 6e-13
110gb|BC079903.1| Mus musculus H2A histone family, member Z, mRNA (... 84 6e-13
111ref|NM_016750.1| Mus musculus H2A histone family, member Z (H2af... 84 6e-13
112ref|XM_978064.1| PREDICTED: Mus musculus similar to H2A histone ... 84 6e-13
113ref|XM_001000476.1| PREDICTED: Mus musculus similar to H2A histo... 84 6e-13
114ref|XM_001003000.1| PREDICTED: Mus musculus H2A histone family, ... 84 6e-13
115ref|XM_760084.1| Theileria parva strain Muguga histone H2A (TP02... 84 6e-13
116ref|XM_381803.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 84 6e-13
117ref|XM_947008.1| Theileria annulata strain Ankara histone H2A va... 84 6e-13
118dbj|AB225651.1| Aspergillus oryzae cDNA, contig sequence: AoEST2506 84 6e-13
119dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 84 6e-13
120dbj|AK151052.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
121dbj|AK146181.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 84 6e-13
122gb|AY074806.1| Mus musculus histone H2A.Z mRNA, complete cds 84 6e-13
123dbj|AK151868.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
124dbj|AK143572.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 84 6e-13
125dbj|AK152848.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
126dbj|AK151509.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
127dbj|AK152398.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
128dbj|AK150454.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
129dbj|AK168178.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 84 6e-13
130dbj|AK169003.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 84 6e-13
131dbj|AK088704.1| Mus musculus 2 days neonate thymus thymic cells ... 84 6e-13
132dbj|AK044932.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 84 6e-13
133dbj|AK028176.1| Mus musculus 10 days embryo whole body cDNA, RIK... 84 6e-13
134gb|AC147612.5| Mus musculus BAC clone RP23-374K9 from 6, complet... 84 6e-13
135gb|U70494.1|MMU70494 Mus musculus histone H2A.Z (H2A.Z) mRNA, co... 84 6e-13
136gb|AF502246.1| Toxoplasma gondii histone H2A.F/Z mRNA, complete cds 82 2e-12
137gb|BC004274.1| Homo sapiens H2A histone family, member V, transc... 80 9e-12
138gb|BC014885.2| Homo sapiens H2A histone family, member V, transc... 80 9e-12
139gb|BC000098.2| Homo sapiens H2A histone family, member V, transc... 80 9e-12
140ref|NM_201436.1| Homo sapiens H2A histone family, member V (H2AF... 80 9e-12
141ref|NM_012412.3| Homo sapiens H2A histone family, member V (H2AF... 80 9e-12
142emb|CR602318.1| full-length cDNA clone CS0DC004YN11 of Neuroblas... 80 9e-12
143dbj|AK129989.1| Homo sapiens cDNA FLJ26479 fis, clone KDN05022, ... 80 9e-12
144gb|AF030235.1|AF030235 Oryctolagus cuniculus histone H2A.F/Z var... 80 9e-12
145gb|AF081192.1|AF081192 Homo sapiens histone H2A.F/Z variant (H2A... 80 9e-12
146gb|BC070169.1| Homo sapiens H2A histone family, member V, mRNA (... 80 9e-12
147dbj|AB209001.1| Homo sapiens mRNA for H2A histone family, member... 80 9e-12
148gb|DQ215812.1| Taeniopygia guttata clone 0064P0008A04 histone H2... 78 4e-11
149ref|XM_532724.2| PREDICTED: Canis familiaris similar to H2A hist... 78 4e-11
150ref|XM_857381.1| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
151ref|XM_857355.1| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
152ref|XM_535671.2| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
153emb|BX284748.1|NCB15B24 Neurospora crassa DNA linkage group II B... 78 4e-11
154gb|BC109743.1| Bos taurus H2A histone family, member Z, mRNA (cD... 78 4e-11
155ref|NM_174809.2| Bos taurus H2A histone family, member Z (H2AFZ)... 78 4e-11
156emb|X52318.1|BTH2AZ Bovine mRNA for histone H2A.Z 78 4e-11
157gb|M37585.1|BOVHIS2AZ Cow histone (H2A.Z) mRNA, complete cds 78 4e-11
158gb|AF069441.1| Arabidopsis thaliana BAC T19B17 from chromosome I... 76 1e-10
159ref|XM_369251.1| Magnaporthe grisea 70-15 chromosome III hypothe... 76 1e-10
160ref|XM_958245.1| Neurospora crassa OR74A hypothetical protein (N... 76 1e-10
161ref|XM_325201.1| Neurospora crassa OR74A hypothetical protein (N... 76 1e-10
162emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, ... 76 1e-10
163gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 76 1e-10
164ref|NM_208740.1| Eremothecium gossypii ACL017Cp (ACL017C), mRNA 76 1e-10
165gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chrom... 76 1e-10
166ref|XM_743054.1| Aspergillus fumigatus Af293 histone H2A (Afu5g0... 74 6e-10
167emb|AL672076.10| Mouse DNA sequence from clone RP23-161N17 on ch... 72 2e-09
168ref|XM_676216.1| Aspergillus nidulans FGSC A4 hypothetical prote... 70 9e-09
169ref|NM_201517.1| Homo sapiens H2A histone family, member V (H2AF... 70 9e-09
170ref|XM_850699.1| PREDICTED: Canis familiaris similar to H2A hist... 70 9e-09
171gb|AY074805.1| Ovis aries histone H2A.Z mRNA, complete cds 70 9e-09
172gb|AF414111.1|AF414111 Danio rerio histone variant H2A.F/Z gene,... 70 9e-09
173emb|BX322550.7| Zebrafish DNA sequence from clone DKEY-202N14 in... 70 9e-09
174dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 70 9e-09
175emb|BX821662.1|CNS0A98O Arabidopsis thaliana Full-length cDNA Co... 70 9e-09
176ref|NM_001009270.1| Ovis aries histone H2A.Z (LOC443235), mRNA 70 9e-09
177dbj|AP005770.3| Oryza sativa (japonica cultivar-group) genomic D... 70 9e-09
178dbj|AP004180.3| Oryza sativa (japonica cultivar-group) genomic D... 70 9e-09
179dbj|AK102414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 9e-09
180dbj|AK060832.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 9e-09
181emb|AL954191.5| Zebrafish DNA sequence from clone CH211-230G14, ... 70 9e-09
182ref|XM_517363.1| PREDICTED: Pan troglodytes similar to H2A histo... 66 1e-07
183ref|NM_002106.3| Homo sapiens H2A histone family, member Z (H2AF... 66 1e-07
184gb|BC103743.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 1e-07
185gb|AY597416.1| Homo sapiens chromosome 13 carcinoma associated a... 66 1e-07
186ref|XM_567962.1| Cryptococcus neoformans var. neoformans JEC21 h... 66 1e-07
187emb|CR858439.1| Pongo pygmaeus mRNA; cDNA DKFZp468O2423 (from cl... 66 1e-07
188emb|CR616797.1| full-length cDNA clone CS0DI067YA11 of Placenta ... 66 1e-07
189emb|CR611014.1| full-length cDNA clone CS0DJ002YA13 of T cells (... 66 1e-07
190emb|CR599577.1| full-length cDNA clone CS0DI079YK23 of Placenta ... 66 1e-07
191emb|CR457415.1| Homo sapiens full open reading frame cDNA clone ... 66 1e-07
192gb|BC020936.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 1e-07
193gb|BC018002.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 1e-07
194emb|X52317.1|HSH2AZ Human mRNA for histone H2A.Z 66 1e-07
195gb|M37583.1|HUMHIS2AZ Human histone (H2A.Z) mRNA, complete cds 66 1e-07
196ref|XM_978028.1| PREDICTED: Mus musculus similar to H2A histone ... 64 6e-07
197ref|XM_001000460.1| PREDICTED: Mus musculus similar to H2A histo... 64 6e-07
198ref|XM_001002995.1| PREDICTED: Mus musculus H2A histone family, ... 64 6e-07
199ref|XM_985882.1| PREDICTED: Mus musculus similar to H2A histone ... 64 6e-07
200gb|AF483074.1| Boltenia villosa histone 2A Z variant (h2az) mRNA... 64 6e-07
201emb|BX008098.1|CNS08EEU Single read from an extremity of a full-... 64 6e-07
202dbj|AK151462.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 64 6e-07
203ref|NM_001031374.1| Gallus gallus H2A histone family, member V (... 62 2e-06
204gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chr... 62 2e-06
205gb|AC130809.25| Medicago truncatula clone mth2-15i12, complete s... 62 2e-06
206gb|AC151823.11| Medicago truncatula clone mth2-45h2, complete se... 62 2e-06
207emb|AJ719448.1| Gallus gallus mRNA for hypothetical protein, clo... 62 2e-06
208ref|NM_138635.2| Homo sapiens H2A histone family, member V (H2AF... 60 9e-06
209gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosom... 60 9e-06
210gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome... 60 9e-06
211dbj|AK023973.1| Homo sapiens cDNA FLJ13911 fis, clone Y79AA10002... 60 9e-06
212gb|BC077029.1| Xenopus tropicalis MGC89861 protein, mRNA (cDNA c... 58 3e-05
213gb|AY814205.1| Schistosoma japonicum SJCHGC05820 protein mRNA, c... 58 3e-05
214ref|XR_003857.1| PREDICTED: Mus musculus hypothetical LOC631864 ... 58 3e-05
215gb|AY147422.1| Drosophila rufa isolate YY001328 histone H2A gene... 58 3e-05
216emb|CT025399.2| Xenopus tropicalis finished cDNA, clone TGas068j09 58 3e-05
217gb|AC055772.16| Mus musculus chromosome 12, clone RP23-291K4, co... 58 3e-05
218ref|NM_001005097.1| Xenopus tropicalis MGC89861 protein (MGC8986... 58 3e-05
219emb|CR761793.2| Xenopus tropicalis finished cDNA, clone TGas044m04 58 3e-05
220emb|CR761734.2| Xenopus tropicalis finished cDNA, clone TGas104o01 58 3e-05
221gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 58 3e-05
222ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
223ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
224ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 56 1e-04
225ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 56 1e-04
226ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
227ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af... 56 1e-04
228gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 56 1e-04
229ref|NM_001038197.1| Bos taurus H2A histone family, member V (H2A... 56 1e-04
230ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ... 56 1e-04
231emb|AJ306721.1|PPI306721 Pinus pinaster mRNA for putative histon... 56 1e-04
232gb|BC109673.1| Bos taurus cDNA clone MGC:133654 IMAGE:8054570, c... 56 1e-04
233dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 56 1e-04
234gb|L17501.1|MIRHIS2AF3 Mirounga leonina histone H2AF gene, exon ... 56 1e-04
235gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete seq... 56 1e-04
236gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (... 56 1e-04
237ref|XM_509711.1| PREDICTED: Pan troglodytes similar to H2A histo... 54 5e-04
238gb|BT016569.1| Zea mays clone Contig402 mRNA sequence 54 5e-04
239ref|XM_430420.1| PREDICTED: Gallus gallus hypothetical gene supp... 54 5e-04
240ref|XM_989419.1| PREDICTED: Mus musculus H2A histone family, mem... 54 5e-04
241ref|XM_907680.2| PREDICTED: Mus musculus H2A histone family, mem... 54 5e-04
242ref|XM_126043.7| PREDICTED: Mus musculus H2A histone family, mem... 54 5e-04
243emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on ch... 54 5e-04
244emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, ... 54 5e-04
245emb|AL049656.1|ATT6G15 Arabidopsis thaliana DNA chromosome 4, BA... 54 5e-04
246dbj|AK155105.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 54 5e-04
247dbj|AK168110.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 54 5e-04
248dbj|AK021267.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 54 5e-04
249gb|AY103710.1| Zea mays PCO123562 mRNA sequence 54 5e-04
250gb|BC028539.1| Mus musculus H2A histone family, member V, mRNA (... 54 5e-04
251emb|AJ296915.1|MMU296915 Mus musculus SDS-stable vimentin-bound ... 54 5e-04
252gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG... 52 0.002
253ref|NM_117431.1| Arabidopsis thaliana DNA binding AT4G13570 mRNA... 52 0.002
254ref|XM_519801.1| PREDICTED: Pan troglodytes similar to H2A histo... 52 0.002
255ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA 52 0.002
256gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds 52 0.002
257ref|XM_612235.2| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
258ref|XM_867604.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
259ref|XM_880526.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
260ref|XM_880511.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
261ref|XM_880487.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
262ref|XM_880467.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
263ref|XM_880438.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
264ref|XM_880415.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
265ref|NG_005179.1| Homo sapiens H2A histone family, member Z, pseu... 52 0.002
266ref|XM_850665.1| PREDICTED: Canis familiaris similar to H2A hist... 52 0.002
267ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
268ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
269ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
270ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
271gb|BC113287.1| Bos taurus similar to H2A histone family, member ... 52 0.002
272emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 52 0.002
273gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, co... 52 0.002
274emb|X13894.1|GGH2AF Chicken histone H2A.F gene 52 0.002
275dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409... 52 0.002
276gb|AF315729.1|AF315729 Carassius auratus histone H2A mRNA, compl... 52 0.002
277dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
278dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
279gb|AY781308.1| Cercopithecus aethiops int22h-2 duplicon sequence 52 0.002
280gb|AY781307.1| Cercopithecus aethiops int22h-1 duplicon sequence 52 0.002
281gb|AY609643.1| Sus scrofa clone Clu_23151.scr.msk.p1.Contig2, mR... 52 0.002
282gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,... 52 0.002
283gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple... 52 0.002
284gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ... 50 0.008
285gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ... 50 0.008
286ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo... 50 0.008
287ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 50 0.008
288ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 50 0.008
289gb|AY617305.1| Sterkiella histriomuscorum clone UGC1O0001_L03_F ... 50 0.008
290gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 50 0.008
291ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
292ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
293ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
294ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
295ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
296ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.008
297ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 50 0.008
298ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 50 0.008
299ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 50 0.008
300ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA 50 0.008
301ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 50 0.008
302ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA 50 0.008
303ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA 50 0.008
304gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 50 0.008
305ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 50 0.008
306gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
307gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
308gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
309gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
310gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
311gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.008
312ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
313ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
314ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
315ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
316ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
317ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
318ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
319ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
320ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
321ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
322ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ... 50 0.008
323ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
324ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
325ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ... 50 0.008
326ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ... 50 0.008
327gb|AC004854.3| Homo sapiens PAC clone RP4-673M15 from 7, complet... 50 0.008
328ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ... 50 0.008
329gb|AY147427.1| Drosophila bocki isolate YY001333 histone H2A gen... 50 0.008
330gb|AY147423.1| Drosophila tani isolate YY001329 histone H2A gene... 50 0.008
331ref|XM_540293.2| PREDICTED: Canis familiaris similar to histone ... 50 0.008
332ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ... 50 0.008
333ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
334ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
335ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.008
336gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar... 50 0.008
337emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 50 0.008
338emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 50 0.008
339emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene 50 0.008
340emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene 50 0.008
341emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 50 0.008
342ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA 50 0.008
343emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 50 0.008
344emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 50 0.008
345emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 50 0.008
346emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 50 0.008
347emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 50 0.008
348gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG... 50 0.008
349emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 50 0.008
350ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA 50 0.008
351emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 50 0.008
352emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 50 0.008
353emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 50 0.008
354emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 50 0.008
355gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG... 50 0.008
356gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG... 50 0.008
357ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R... 50 0.008
358dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 50 0.008
359dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 50 0.008
360dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 50 0.008
361ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA 50 0.008
362gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,... 50 0.008
363gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ... 50 0.008
364gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 50 0.008
365gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 50 0.008
366dbj|AB179140.1| Macaca fascicularis testis cDNA clone: QtsA-1353... 50 0.008
367ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA 50 0.008
368ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA 50 0.008
369ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA 50 0.008
370gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 50 0.008
371dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 50 0.008
372dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l... 50 0.008
373ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA 50 0.008
374ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA 50 0.008
375ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA 50 0.008
376ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone... 50 0.008
377ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone... 50 0.008
378ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p... 50 0.008
379ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone... 50 0.008
380gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple... 50 0.008
381gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple... 50 0.008
382gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 50 0.008
383gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp... 50 0.008
384gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp... 50 0.008
385gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp... 50 0.008
386gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp... 50 0.008
387gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp... 50 0.008
388gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 50 0.008
389gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp... 50 0.008
390gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp... 50 0.008
391gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp... 50 0.008
392gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp... 50 0.008
393gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp... 50 0.008
394gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 50 0.008
395gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 50 0.008
396gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 50 0.008
397gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 50 0.008
398dbj|AK216150.1| Mus musculus cDNA, clone:Y2G0137G02, strand:minu... 50 0.008
399dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu... 50 0.008
400ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA 50 0.008
401ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA 50 0.008
402gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 50 0.008
403gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 50 0.008
404gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (... 50 0.008
405dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple... 50 0.008
406gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co... 50 0.008
407gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ... 50 0.008
408gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c... 50 0.008
409gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co... 50 0.008
410gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet... 50 0.008
411gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet... 50 0.008
412gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com... 50 0.008
413gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ... 50 0.008
414gb|AY576483.1| Litopenaeus vannamei tissue-type gill histone H2A... 48 0.033
415gb|BC101409.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.033
416gb|BC101415.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.033
417ref|XM_529212.1| PREDICTED: Pan troglodytes coagulation factor V... 48 0.033
418ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 48 0.033
419gb|BC101418.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.033
420gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.033
421gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.033
422gb|BC101417.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.033
423ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8... 48 0.033
424ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 48 0.033
425ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 48 0.033
426ref|XM_866661.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 48 0.033
427ref|NM_001017991.1| Homo sapiens H2A histone family, member B2 (... 48 0.033
428ref|NM_080720.1| Homo sapiens H2A histone family, member B3 (H2A... 48 0.033
429ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA 48 0.033
430emb|CT025637.1| Pan troglodytes chromosome X clone PTB-011B24 ma... 48 0.033
431ref|XM_538635.2| PREDICTED: Canis familiaris similar to H2A hist... 48 0.033
432emb|BX682237.6| Human DNA sequence from clone RP11-810M4 on chro... 48 0.033
433emb|BX276110.5| Human DNA sequence from clone RP11-218L14 on chr... 48 0.033
434emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X 48 0.033
435ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A.... 48 0.033
436gb|AC163771.5| Pan troglodytes BAC clone CH251-57G17 from chromo... 48 0.033
437emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ... 48 0.033
438emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ... 48 0.033
439gb|AF254576.1|AF254576 Homo sapiens histone H2A variant Barr-bod... 48 0.033
440ref|XM_574181.1| PREDICTED: Rattus norvegicus similar to H2A his... 48 0.033
441ref|XM_214093.2| PREDICTED: Rattus norvegicus H2A histone family... 48 0.033
442gb|AC160653.3| Pan troglodytes BAC clone CH251-453K4 from chromo... 48 0.033
443gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp... 48 0.033
444dbj|AK207984.1| Mus musculus cDNA, clone:Y2G0109L23, strand:minu... 48 0.033
445gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281.... 48 0.033
446gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836.... 48 0.033
447gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.033
448gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.033
449gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.033
450gb|AY781306.1| Pan troglodytes int22h-2 and int22h-3 duplicon se... 48 0.033
451gb|AY781305.1| Pan troglodytes int22h-1 duplicon sequence 48 0.033
452gb|AY620001.1| Homo sapiens isolate Int22h-3 F8a gene, complete cds 48 0.033
453gb|AY620000.1| Homo sapiens isolate Int22h-2 F8a gene, complete cds 48 0.033
454dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple... 48 0.033
455gb|AC159036.3| Pan troglodytes BAC clone CH251-318E5 from chromo... 48 0.033
456gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds 48 0.033
457gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 48 0.033
458gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds 48 0.033
459gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple... 48 0.033
460gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple... 48 0.033
461gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds 46 0.13
462gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.13
463ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 46 0.13
464gb|BC006955.1| Mus musculus H2A histone family, member Y, mRNA (... 46 0.13
465ref|XM_984914.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.13
466ref|XM_985028.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.13
467ref|XM_984999.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.13
468ref|XM_984970.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.13
469ref|XM_923889.2| PREDICTED: Mus musculus H2A histone family, mem... 46 0.13
470ref|NM_012015.1| Mus musculus H2A histone family, member Y (H2af... 46 0.13
471emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA 46 0.13
472ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF... 46 0.13
473emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X 46 0.13
474emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ... 46 0.13
475emb|AL034559.4|PFMAL3P7 Plasmodium falciparum MAL3P7, complete s... 46 0.13
476gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.13
477emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas... 46 0.13
478dbj|AK143498.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN ... 46 0.13
479emb|AL732295.24| Mouse DNA sequence from clone RP23-77F19 on chr... 46 0.13
480dbj|AK039274.1| Mus musculus adult male spinal cord cDNA, RIKEN ... 46 0.13
481gb|AF171080.1|AF171080 Mus musculus histone macroH2A1.2 variant ... 46 0.13
482gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)... 46 0.13
483ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p... 46 0.13
484dbj|AK204242.1| Mus musculus cDNA, clone:Y1G0147L15, strand:minu... 46 0.13
485dbj|AB071988.2| Mus musculus mRNA for MacroH2A1.2, complete cds 46 0.13
486gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.13
487dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C... 46 0.13
488gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp... 46 0.13
489ref|XM_510606.1| PREDICTED: Pan troglodytes similar to H2A histo... 44 0.52
490ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.52
491ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H... 44 0.52
492ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic... 44 0.52
493gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 44 0.52
494gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 44 0.52
495ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic... 44 0.52
496ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA 44 0.52
497gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence 44 0.52
498gb|BT016168.1| Zea mays clone Contig1 mRNA sequence 44 0.52
499gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
500gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52

>ref|XM_469689.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 671

 Score =  488 bits (246), Expect = e-134
 Identities = 361/398 (90%), Gaps = 1/398 (0%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 590 ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 531

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 530 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 471

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
           | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 470 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 411

                                                                       
Query: 374 gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
           ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 410 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 351

                                                                       
Query: 434 cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
           |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 350 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 291

                                                                       
Query: 494 ggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggcgg 553
           |||| || ||||||||||||||||||| ||||||||||||||||||||||||||| || |
Sbjct: 290 ggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgccg 231

                                                 
Query: 554 tcttggcgggccgtcgtcttggccgcgagcaggccctt 591
            |||||| |||||||||||| || ||||||| ||||||
Sbjct: 230 acttggc-ggccgtcgtcttcgcggcgagcaagccctt 194



to top

>dbj|AK120299.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052C06, full
           insert sequence
          Length = 1004

 Score =  488 bits (246), Expect = e-134
 Identities = 361/398 (90%), Gaps = 1/398 (0%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 605 ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 546

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 545 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 486

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
           | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 485 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 426

                                                                       
Query: 374 gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
           ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 425 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 366

                                                                       
Query: 434 cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
           |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 365 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 306

                                                                       
Query: 494 ggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggcgg 553
           |||| || ||||||||||||||||||| ||||||||||||||||||||||||||| || |
Sbjct: 305 ggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgccg 246

                                                 
Query: 554 tcttggcgggccgtcgtcttggccgcgagcaggccctt 591
            |||||| |||||||||||| || ||||||| ||||||
Sbjct: 245 acttggc-ggccgtcgtcttcgcggcgagcaagccctt 209



to top

>gb|BT016248.1| Zea mays clone Contig81 mRNA sequence
          Length = 623

 Score =  436 bits (220), Expect = e-119
 Identities = 325/360 (90%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||| ||||||||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 370 ttcactccttggaggacttgttgatcagggacttgtgaatgtgcgggatgacacctccgc 311

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           | || ||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 310 ctgcgatggtgcccttgatgagggtgtccagctcctcgtctccacgaatggctagctgca 251

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
             ||  ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 250 aatggggaggggtgatacgcttcaccttcagatccttgctagcattcccagccagctcca 191

                                                                       
Query: 374 gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
           |||||||||  |||| |||||| ||||| ||||| |||||||| || || || |||||||
Sbjct: 190 gaacctcgggagtcaagtactccaggatggcagcggagtagacggctgcggtggcaccaa 131

                                                                       
Query: 434 cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
           | || ||||| ||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 130 cgcgaccatttgcctgagtcctttgcttcagctgacggtggatacgcccaacagggaact 71

                                                                       
Query: 494 ggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggcgg 553
           |||| ||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 70  ggaggccggcgcgggaggagcgtgagattggggccttcttccccttgtccttctcggcgg 11



to top

>gb|AY104056.1| Zea mays PCO122239 mRNA sequence
          Length = 924

 Score =  434 bits (219), Expect = e-118
 Identities = 349/391 (89%), Gaps = 1/391 (0%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||| ||||||||||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 633 ttcactccttggaggacttgttgatcagggacttgtggatgtgcgggatgacgcctccac 574

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           | || |||||||||||||||||||| || |||||||||||||| || ||||||| ||| |
Sbjct: 573 ctgcgatggtgcccttgatgagggtatccagctcctcgtctccgcgaatggccaactgta 514

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 513 ggtggcgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 454

                                                                       
Query: 374 gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
           |||||||||| || | |||||| ||||| || || |||||||| || ||||| |||||||
Sbjct: 453 gaacctcggcagttaagtactccaggatggcggcggagtagacggctgcagtggcaccaa 394

                                                                       
Query: 434 cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
           | |||||||| ||||| |||||||||||||||||||| ||||| || |||||||| ||||
Sbjct: 393 cgcggccatttgcctgagtcctttgcttcagctgacggtggattcgtccaacaggaaact 334

                                                                       
Query: 494 ggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggcgg 553
           |||| || |||||||| || || |||||||||||||||||||||||||||||||| || |
Sbjct: 333 ggaggcccgcgcgggaggaccgtgagatgggggccttcttccccttgtccttctccgccg 274

                                          
Query: 554 tcttggcgggccgtcgtcttggccgcgagca 584
            ||||||  ||||||||||| || |||||||
Sbjct: 273 acttggc-cgccgtcgtcttcgcggcgagca 244



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Minus

                                                                            
Query: 194      ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
                ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 30223813 ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 30223754

                                                                            
Query: 254      cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
                |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 30223753 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 30223694

                                                                            
Query: 314      ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
                | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 30223693 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 30223634

                                                                            
Query: 374      gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
                ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 30223633 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 30223574

                                                                            
Query: 434      cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
                |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 30223573 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 30223514

                 
Query: 494      g 494
                |
Sbjct: 30223513 g 30223513



 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                           
Query: 195     tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
               |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 3353717 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 3353658

                                                                           
Query: 255     agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
                || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 3353657 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 3353598

                                                                           
Query: 315     gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
                || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 3353597 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 3353538

                                       
Query: 375     aacctcggccgtcaggtactcgag 398
                |||||||| || |||||||||||
Sbjct: 3353537 gacctcggcggttaggtactcgag 3353514



 Score =  111 bits (56), Expect = 3e-21
 Identities = 90/100 (90%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                            
Query: 492      ctggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggc 551
                |||||| || ||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 30221870 ctggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgc 30221811

                                                        
Query: 552      ggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
                 | |||||| |||||||||||| || ||||||| ||||||
Sbjct: 30221810 cgacttggc-ggccgtcgtcttcgcggcgagcaagccctt 30221772



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/106 (85%), Gaps = 4/106 (3%)
 Strand = Plus / Minus

                                                                           
Query: 492     ctggagcccggcgcgggacgagcgggagatgggggccttcttc---cccttgtccttctc 548
               |||||| ||||||||||| |||||||||| |||||||||||||    |||||||||| ||
Sbjct: 3353263 ctggaggccggcgcgggaggagcgggagacgggggccttcttcttgtccttgtccttgtc 3353204

                                                             
Query: 549     ggcggtcttggcgggccgtcgtcttggccgcgagcaggcccttgcc 594
               |||| |||| ||  ||||| |||||||||||||| || ||||||||
Sbjct: 3353203 ggcgctctttgc-cgccgtggtcttggccgcgaggagccccttgcc 3353159



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 474     gatacggccaacagggaactggagcccggc 503
               ||||||||| || |||||||||||||||||
Sbjct: 9471591 gatacggccgacggggaactggagcccggc 9471620



to top

>gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic sequence, complete
           sequence
          Length = 163972

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Plus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 82  ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 141

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 142 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 201

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
           | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 202 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 261

                                                                       
Query: 374 gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
           ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 262 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 321

                                                                       
Query: 434 cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
           |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 322 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 381

            
Query: 494 g 494
           |
Sbjct: 382 g 382



 Score =  111 bits (56), Expect = 3e-21
 Identities = 90/100 (90%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                        
Query: 492  ctggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggc 551
            |||||| || ||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 2025 ctggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgc 2084

                                                    
Query: 552  ggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
             | |||||| |||||||||||| || ||||||| ||||||
Sbjct: 2085 cgacttggc-ggccgtcgtcttcgcggcgagcaagccctt 2123



to top

>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete
             sequence
          Length = 130359

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Minus

                                                                         
Query: 194   ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
             ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 15493 ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 15434

                                                                         
Query: 254   cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
             |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 15433 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 15374

                                                                         
Query: 314   ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
             | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 15373 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 15314

                                                                         
Query: 374   gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
             ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 15313 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 15254

                                                                         
Query: 434   cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
             |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 15253 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 15194

              
Query: 494   g 494
             |
Sbjct: 15193 g 15193



 Score =  111 bits (56), Expect = 3e-21
 Identities = 90/100 (90%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                         
Query: 492   ctggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggc 551
             |||||| || ||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 13550 ctggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgc 13491

                                                     
Query: 552   ggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
              | |||||| |||||||||||| || ||||||| ||||||
Sbjct: 13490 cgacttggc-ggccgtcgtcttcgcggcgagcaagccctt 13452



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Minus

                                                                            
Query: 194      ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
                ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 30315235 ttcactctttggaggacttgttgatcagggacttgtggatgtgaggaatgacacctccac 30315176

                                                                            
Query: 254      cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
                |||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 30315175 cagcgatggtacccttgatgagagtgtcgagctcctcatctccacggatggcaagctgca 30315116

                                                                            
Query: 314      ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
                | || ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 30315115 gatggcgaggggtgatacgcttgaccttcagatccttgctagcgttcccagccagttcca 30315056

                                                                            
Query: 374      gaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaa 433
                ||||||| || || | |||||| || |||||||||||||| || || |||||||||||||
Sbjct: 30315055 gaacctcagctgttaagtactccagaatagcagcagagtaaactgcggcagtagcaccaa 30314996

                                                                            
Query: 434      cacggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaact 493
                |||| ||||| ||||| ||||||||||||| ||| |||||||||||||||||||||||||
Sbjct: 30314995 cacgtccatttgcctgagtcctttgcttcaactggcgatggatacggccaacagggaact 30314936

                 
Query: 494      g 494
                |
Sbjct: 30314935 g 30314935



 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                           
Query: 195     tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
               |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 3353828 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 3353769

                                                                           
Query: 255     agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
                || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 3353768 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 3353709

                                                                           
Query: 315     gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
                || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 3353708 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 3353649

                                       
Query: 375     aacctcggccgtcaggtactcgag 398
                |||||||| || |||||||||||
Sbjct: 3353648 gacctcggcggttaggtactcgag 3353625



 Score =  111 bits (56), Expect = 3e-21
 Identities = 90/100 (90%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                            
Query: 492      ctggagcccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctcggc 551
                |||||| || ||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 30313292 ctggagaccagcgcgggacgagcgggagacgggggccttcttccccttgtccttctccgc 30313233

                                                        
Query: 552      ggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
                 | |||||| |||||||||||| || ||||||| ||||||
Sbjct: 30313232 cgacttggc-ggccgtcgtcttcgcggcgagcaagccctt 30313194



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/106 (85%), Gaps = 4/106 (3%)
 Strand = Plus / Minus

                                                                           
Query: 492     ctggagcccggcgcgggacgagcgggagatgggggccttcttc---cccttgtccttctc 548
               |||||| ||||||||||| |||||||||| |||||||||||||    |||||||||| ||
Sbjct: 3353374 ctggaggccggcgcgggaggagcgggagacgggggccttcttcttgtccttgtccttgtc 3353315

                                                             
Query: 549     ggcggtcttggcgggccgtcgtcttggccgcgagcaggcccttgcc 594
               |||| |||| ||  ||||| |||||||||||||| || ||||||||
Sbjct: 3353314 ggcgctctttgc-cgccgtggtcttggccgcgaggagccccttgcc 3353270



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 474     gatacggccaacagggaactggagcccggc 503
               ||||||||| || |||||||||||||||||
Sbjct: 9469712 gatacggccgacggggaactggagcccggc 9469741



to top

>ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative histone H2A
           (OSJNBa0061K21.20), mRNA
          Length = 420

 Score =  234 bits (118), Expect = 3e-58
 Identities = 300/360 (83%), Gaps = 3/360 (0%)
 Strand = Plus / Minus

                                                                       
Query: 197 actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
           |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 418 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 359

                                                                       
Query: 257 caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
           | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 358 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 299

                                                                       
Query: 317 gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
           | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 298 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 239

                                                                       
Query: 377 cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
           |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 238 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 179

                                                                       
Query: 437 ggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaactgga 496
           |||| ||||||     |||   ||||||||| |  |||||||| || || ||||||||||
Sbjct: 178 ggccgttcgccgacaccctccccttcagctgcctgtggatacgccccaccgggaactgga 119

                                                                       
Query: 497 gcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctcggcgg 553
            |||||||||||| |||||||||| ||| |||||||| |   |||||||||| |||||||
Sbjct: 118 tcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtcggcgg 59



to top

>dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025E19, full
           insert sequence
          Length = 804

 Score =  226 bits (114), Expect = 7e-56
 Identities = 299/360 (83%), Gaps = 3/360 (0%)
 Strand = Plus / Minus

                                                                       
Query: 197 actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
           |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 500 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 441

                                                                       
Query: 257 caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
           | |||||||||||||| |||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 440 ctatggtgcccttgattagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 381

                                                                       
Query: 317 gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
           | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 380 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 321

                                                                       
Query: 377 cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
           |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 320 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 261

                                                                       
Query: 437 ggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaactgga 496
           |||| ||||||     |||   ||||||||| |  |||||||| || || ||||||||||
Sbjct: 260 ggccgttcgccgacaccctccccttcagctgcctgtggatacgccccaccgggaactgga 201

                                                                       
Query: 497 gcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctcggcgg 553
            |||||||||||| |||||||||| ||| |||||||| |   |||||||||| |||||||
Sbjct: 200 tcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtcggcgg 141



to top

>gb|AF193345.1|AF193345 Oryza sativa H2A protein mRNA, complete cds
          Length = 948

 Score =  210 bits (106), Expect = 4e-51
 Identities = 297/360 (82%), Gaps = 3/360 (0%)
 Strand = Plus / Minus

                                                                       
Query: 197 actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
           |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 624 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 565

                                                                       
Query: 257 caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
           | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 564 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 505

                                                                       
Query: 317 gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
           | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 504 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 445

                                                                       
Query: 377 cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
           ||||  ||||||||||||||||||| || || | ||| |||||||| || || || ||  
Sbjct: 444 cctcccccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgg 385

                                                                       
Query: 437 ggccattcgcctgggtcctttgcttcagctgacgatggatacggccaacagggaactgga 496
           |||| ||||||     |||   ||||||||| |  |||||||| || || ||||||||||
Sbjct: 384 ggccgttcgccgacaccctccccttcagctgcctgtggatacgccccaccgggaactgga 325

                                                                       
Query: 497 gcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctcggcgg 553
            |||||||||||| ||| |||||| ||| |||||||| |   |||||||||| |||||||
Sbjct: 324 tcccggcgcgggaggagggggagaggggcgccttcttgcggtccttgtccttgtcggcgg 265



to top

>gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare Clone OSJNBa0061K21 From Chromosome 10, complete
              sequence
          Length = 112721

 Score =  204 bits (103), Expect = 2e-49
 Identities = 214/251 (85%)
 Strand = Plus / Minus

                                                                          
Query: 197    actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
              |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 104418 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 104359

                                                                          
Query: 257    caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
              | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 104358 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 104299

                                                                          
Query: 317    gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
              | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 104298 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 104239

                                                                          
Query: 377    cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
              |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 104238 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 104179

                         
Query: 437    ggccattcgcc 447
              |||| ||||||
Sbjct: 104178 ggccgttcgcc 104168



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                          
Query: 492    ctggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctc 548
              ||||| |||||||||||| |||||||||| ||| |||||||| |   |||||||||| ||
Sbjct: 103753 ctggatcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtc 103694

                   
Query: 549    ggcgg 553
              |||||
Sbjct: 103693 ggcgg 103689



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  204 bits (103), Expect = 2e-49
 Identities = 214/251 (85%)
 Strand = Plus / Minus

                                                                            
Query: 197      actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
                |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 14164890 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 14164831

                                                                            
Query: 257      caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
                | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 14164830 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 14164771

                                                                            
Query: 317      gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
                | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 14164770 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 14164711

                                                                            
Query: 377      cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
                |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 14164710 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 14164651

                           
Query: 437      ggccattcgcc 447
                |||| ||||||
Sbjct: 14164650 ggccgttcgcc 14164640



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                            
Query: 492      ctggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctc 548
                ||||| |||||||||||| |||||||||| ||| |||||||| |   |||||||||| ||
Sbjct: 14164225 ctggatcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtc 14164166

                     
Query: 549      ggcgg 553
                |||||
Sbjct: 14164165 ggcgg 14164161



to top

>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome 10,
             complete sequence
          Length = 142737

 Score =  204 bits (103), Expect = 2e-49
 Identities = 214/251 (85%)
 Strand = Plus / Minus

                                                                         
Query: 197   actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
             |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 36963 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 36904

                                                                         
Query: 257   caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
             | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 36903 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 36844

                                                                         
Query: 317   gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
             | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 36843 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 36784

                                                                         
Query: 377   cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
             |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 36783 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 36724

                        
Query: 437   ggccattcgcc 447
             |||| ||||||
Sbjct: 36723 ggccgttcgcc 36713



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                         
Query: 492   ctggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctc 548
             ||||| |||||||||||| |||||||||| ||| |||||||| |   |||||||||| ||
Sbjct: 36298 ctggatcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtc 36239

                  
Query: 549   ggcgg 553
             |||||
Sbjct: 36238 ggcgg 36234



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  204 bits (103), Expect = 2e-49
 Identities = 214/251 (85%)
 Strand = Plus / Minus

                                                                            
Query: 197      actctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccag 256
                |||| |||| || ||||||||| ||||||||||||||||| ||||| || || || || |
Sbjct: 14173132 actccttggcggtcttgttgatgagggacttgtggatgtgcgggatgacgccgccgccgg 14173073

                                                                            
Query: 257      caatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggt 316
                | ||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||
Sbjct: 14173072 ctatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgcaggt 14173013

                                                                            
Query: 317      gacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaa 376
                | || |||||||| ||||||||||| || |||||||| ||||| || || |||||||| |
Sbjct: 14173012 ggcgcggggtgatgcgcttcaccttgaggtccttgctggcgttgccggcgagctccagga 14172953

                                                                            
Query: 377      cctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
                |||| |||||||||||||||||||| || || | ||| |||||||| || || || || |
Sbjct: 14172952 cctccgccgtcaggtactcgaggatcgccgccgtgtacaccgccgccgtcgcccccacgc 14172893

                           
Query: 437      ggccattcgcc 447
                |||| ||||||
Sbjct: 14172892 ggccgttcgcc 14172882



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                            
Query: 492      ctggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtccttctc 548
                ||||| |||||||||||| |||||||||| ||| |||||||| |   |||||||||| ||
Sbjct: 14172467 ctggatcccggcgcgggaggagcgggagacgggcgccttcttgcggtccttgtccttgtc 14172408

                     
Query: 549      ggcgg 553
                |||||
Sbjct: 14172407 ggcgg 14172403



to top

>dbj|AP006681.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45D03, TM0375b,
             complete sequence
          Length = 61653

 Score =  190 bits (96), Expect = 4e-45
 Identities = 171/196 (87%)
 Strand = Plus / Minus

                                                                         
Query: 194   ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
             |||||||||||||||  |||||||||| ||||||||| ||||| ||||| ||||| ||||
Sbjct: 37561 ttcactctttggaggttttgttgatcaaggacttgtgaatgtgagggatgacaccaccac 37502

                                                                         
Query: 254   cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
             |||||||||| || |||||||||||||||||||| || ||||| | ||| || |||||||
Sbjct: 37501 cagcaatggttcctttgatgagggtgtcaagctcttcatctcccctgatagcgagctgca 37442

                                                                         
Query: 314   ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
              |||||| || ||||| | ||||||||||||||||||||| || ||||||||||||||||
Sbjct: 37441 agtgacgcggtgtgatcctcttcaccttcagatccttgcttgcattcccagccagctcca 37382

                             
Query: 374   gaacctcggccgtcag 389
             | ||||| || |||||
Sbjct: 37381 gcacctcagcagtcag 37366



to top

>ref|NM_187762.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 417

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
           |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 417 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 358

                                                                       
Query: 255 agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
            || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 357 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 298

                                                                       
Query: 315 gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
            || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 297 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 238

                                   
Query: 375 aacctcggccgtcaggtactcgag 398
            |||||||| || |||||||||||
Sbjct: 237 gacctcggcggttaggtactcgag 214



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 108/126 (85%), Gaps = 4/126 (3%)
 Strand = Plus / Minus

                                                                       
Query: 472 tggatacggccaacagggaactggagcccggcgcgggacgagcgggagatgggggccttc 531
           |||||||| || || ||||||||||| ||||||||||| |||||||||| ||||||||||
Sbjct: 140 tggatacgccccaccgggaactggaggccggcgcgggaggagcgggagacgggggccttc 81

                                                                       
Query: 532 ttc---cccttgtccttctcggcggtcttggcgggccgtcgtcttggccgcgagcaggcc 588
           |||    |||||||||| |||||| |||| ||  ||||| |||||||||||||| || ||
Sbjct: 80  ttcttgtccttgtccttgtcggcgctctttgc-cgccgtggtcttggccgcgaggagccc 22

                 
Query: 589 cttgcc 594
           ||||||
Sbjct: 21  cttgcc 16



to top

>gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12,
             complete sequence
          Length = 177327

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                         
Query: 195   tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
             |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 75497 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 75556

                                                                         
Query: 255   agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
              || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 75557 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 75616

                                                                         
Query: 315   gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
              || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 75617 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 75676

                                     
Query: 375   aacctcggccgtcaggtactcgag 398
              |||||||| || |||||||||||
Sbjct: 75677 gacctcggcggttaggtactcgag 75700



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/106 (85%), Gaps = 4/106 (3%)
 Strand = Plus / Plus

                                                                         
Query: 492   ctggagcccggcgcgggacgagcgggagatgggggccttcttc---cccttgtccttctc 548
             |||||| ||||||||||| |||||||||| |||||||||||||    |||||||||| ||
Sbjct: 75951 ctggaggccggcgcgggaggagcgggagacgggggccttcttcttgtccttgtccttgtc 76010

                                                           
Query: 549   ggcggtcttggcgggccgtcgtcttggccgcgagcaggcccttgcc 594
             |||| |||| ||  ||||| |||||||||||||| || ||||||||
Sbjct: 76011 ggcgctctttgc-cgccgtggtcttggccgcgaggagccccttgcc 76055



to top

>dbj|AK121533.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030P21, full
           insert sequence
          Length = 817

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
           |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 512 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 453

                                                                       
Query: 255 agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
            || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 452 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 393

                                                                       
Query: 315 gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
            || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 392 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 333

                                   
Query: 375 aacctcggccgtcaggtactcgag 398
            |||||||| || |||||||||||
Sbjct: 332 gacctcggcggttaggtactcgag 309



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 108/126 (85%), Gaps = 4/126 (3%)
 Strand = Plus / Minus

                                                                       
Query: 472 tggatacggccaacagggaactggagcccggcgcgggacgagcgggagatgggggccttc 531
           |||||||| || || ||||||||||| ||||||||||| |||||||||| ||||||||||
Sbjct: 235 tggatacgccccaccgggaactggaggccggcgcgggaggagcgggagacgggggccttc 176

                                                                       
Query: 532 ttc---cccttgtccttctcggcggtcttggcgggccgtcgtcttggccgcgagcaggcc 588
           |||    |||||||||| |||||| |||| ||  ||||| |||||||||||||| || ||
Sbjct: 175 ttcttgtccttgtccttgtcggcgctctttgc-cgccgtggtcttggccgcgaggagccc 117

                 
Query: 589 cttgcc 594
           ||||||
Sbjct: 116 cttgcc 111



to top

>dbj|AK061605.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-C05, full
           insert sequence
          Length = 785

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 tcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccacc 254
           |||||||||||||| ||||||||| || ||||||||||| || ||||| || || || ||
Sbjct: 507 tcactctttggaggtcttgttgatgagcgacttgtggatatgggggatgacgccaccgcc 448

                                                                       
Query: 255 agcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcag 314
            || ||||||||||||||||| ||||| |||||||| || || |||||||| ||||| ||
Sbjct: 447 ggcgatggtgcccttgatgagcgtgtcgagctcctcatccccgcggatggctagctggag 388

                                                                       
Query: 315 gtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccag 374
            || || |||||||||||||||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 387 atggcgcggggtgatacgcttcaccttgagatccttgctcgcgttgccggccagctccag 328

                                   
Query: 375 aacctcggccgtcaggtactcgag 398
            |||||||| || |||||||||||
Sbjct: 327 gacctcggcggttaggtactcgag 304



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 108/126 (85%), Gaps = 4/126 (3%)
 Strand = Plus / Minus

                                                                       
Query: 472 tggatacggccaacagggaactggagcccggcgcgggacgagcgggagatgggggccttc 531
           |||||||| || || ||||||||||| ||||||||||| |||||||||| ||||||||||
Sbjct: 230 tggatacgccccaccgggaactggaggccggcgcgggaggagcgggagacgggggccttc 171

                                                                       
Query: 532 ttc---cccttgtccttctcggcggtcttggcgggccgtcgtcttggccgcgagcaggcc 588
           |||    |||||||||| |||||| |||| ||  ||||| |||||||||||||| || ||
Sbjct: 170 ttcttgtccttgtccttgtcggcgctctttgc-cgccgtggtcttggccgcgaggagccc 112

                 
Query: 589 cttgcc 594
           ||||||
Sbjct: 111 cttgcc 106



to top

>gb|AY104725.1| Zea mays PCO121651 mRNA sequence
          Length = 716

 Score =  182 bits (92), Expect = 9e-43
 Identities = 179/208 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||| |||| || ||||||||| || |||||||||||||| ||||| || || || |
Sbjct: 521 ttcactccttggcggtcttgttgatgagcgacttgtggatgtgcgggatgacgccgcccc 462

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           | || ||||||||||||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 461 cggcgatggtgcccttgatgagggtgtcgagctcctcgtccccgcggatggcgagctgca 402

                                                                       
Query: 314 ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcca 373
           |||| || |||||||| ||||| ||||| || |||||||| ||||| || |||||||| |
Sbjct: 401 ggtggcgcggggtgatgcgcttgaccttgaggtccttgctggcgttgccggccagctcga 342

                                       
Query: 374 gaacctcggccgtcaggtactcgaggat 401
           | |||||||| || ||||||||||||||
Sbjct: 341 ggacctcggcggtgaggtactcgaggat 314



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/108 (86%), Gaps = 4/108 (3%)
 Strand = Plus / Minus

                                                                       
Query: 487 gggaactggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtcc 543
           ||||||||||| ||||||||||| ||||| || | ||||||||||||||   ||||||||
Sbjct: 228 gggaactggaggccggcgcgggaagagcgcgacacgggggccttcttcctgtccttgtcc 169

                                                           
Query: 544 ttctcggcggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
           || |||| | |||||||  ||||||||||||||||| ||||| |||||
Sbjct: 168 ttgtcggtgctcttggc-cgccgtcgtcttggccgccagcagaccctt 122



to top

>gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 707

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 406 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 347

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 346 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 287

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || ||||||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 286 actttcagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 227

                
Query: 397 aggat 401
           |||||
Sbjct: 226 aggat 222



to top

>gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 701

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 400 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 341

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 340 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 281

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || ||||||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 280 actttcagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 221

                
Query: 397 aggat 401
           |||||
Sbjct: 220 aggat 216



to top

>gb|DQ215049.1| Taeniopygia guttata clone 0058P0049H09 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 685

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 383 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 324

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 323 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 264

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || ||||||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 263 actttcagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 204

                
Query: 397 aggat 401
           |||||
Sbjct: 203 aggat 199



to top

>gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 685

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 383 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 324

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 323 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 264

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || ||||||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 263 actttcagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 204

                
Query: 397 aggat 401
           |||||
Sbjct: 203 aggat 199



to top

>gb|DQ215046.1| Taeniopygia guttata clone 0058P0036G12 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 661

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 347 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 288

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 287 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 228

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || ||||||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 227 actttcagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 168

                
Query: 397 aggat 401
           |||||
Sbjct: 167 aggat 163



to top

>gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 704

 Score =  161 bits (81), Expect = 3e-36
 Identities = 159/185 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 403 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 344

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 343 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 284

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || |||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 283 actttgagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 224

                
Query: 397 aggat 401
           |||||
Sbjct: 223 aggat 219



to top

>gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 729

 Score =  161 bits (81), Expect = 3e-36
 Identities = 159/185 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || |||||||||||||| |||||| | ||||| || 
Sbjct: 428 atcagagacttgtggatgtggggaatgacacctccaccagcgatggtggctttgatcagc 369

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||| || || |||||||||||||||||||| || || ||||| ||||||
Sbjct: 368 gagtccagctcctcatcgccgcggatggccagctgcaggtgccggggcgtgatccgcttc 309

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || |||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| 
Sbjct: 308 actttgagatccttggaagcgttcccggccagctccagcacctcagccgtcaggtactcc 249

                
Query: 397 aggat 401
           |||||
Sbjct: 248 aggat 244



to top

>emb|CR719262.2|CNS0GHXG Tetraodon nigroviridis full-length cDNA
          Length = 831

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 440 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 381

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 380 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 321

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 320 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 261

                 
Query: 396 gaggat 401
            |||||
Sbjct: 260 caggat 255



to top

>emb|CR714103.2|CNS0GDYB Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 454 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 395

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 394 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 335

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 334 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 275

                 
Query: 396 gaggat 401
            |||||
Sbjct: 274 caggat 269



to top

>emb|CR710974.2|CNS0GBJE Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 453 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 394

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 393 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 334

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 333 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 274

                 
Query: 396 gaggat 401
            |||||
Sbjct: 273 caggat 268



to top

>emb|CR708160.2|CNS0G9D8 Tetraodon nigroviridis full-length cDNA
          Length = 832

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 446 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 387

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 386 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 327

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 326 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 267

                 
Query: 396 gaggat 401
            |||||
Sbjct: 266 caggat 261



to top

>emb|CR706063.2|CNS0G7QZ Tetraodon nigroviridis full-length cDNA
          Length = 809

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 424 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 365

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 364 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 305

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 304 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 245

                 
Query: 396 gaggat 401
            |||||
Sbjct: 244 caggat 239



to top

>emb|CR706962.2|CNS0G8FY Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 454 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 395

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 394 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 335

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 334 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 275

                 
Query: 396 gaggat 401
            |||||
Sbjct: 274 caggat 269



to top

>emb|CR705074.2|CNS0G6ZI Tetraodon nigroviridis full-length cDNA
          Length = 786

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 397 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 338

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 337 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 278

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 277 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 218

                 
Query: 396 gaggat 401
            |||||
Sbjct: 217 caggat 212



to top

>emb|CR678084.2|CNS0FM61 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 450 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 391

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 390 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 331

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 330 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 271

                 
Query: 396 gaggat 401
            |||||
Sbjct: 270 caggat 265



to top

>emb|CR676044.2|CNS0FKLU Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 453 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 394

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 393 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 334

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 333 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 274

                 
Query: 396 gaggat 401
            |||||
Sbjct: 273 caggat 268



to top

>emb|CR673909.2|CNS0FIYJ Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 454 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 395

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 394 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 335

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 334 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 275

                 
Query: 396 gaggat 401
            |||||
Sbjct: 274 caggat 269



to top

>emb|CR671294.2|CNS0FGXW Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 427 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 368

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 367 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgctt 308

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 307 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 248

                 
Query: 396 gaggat 401
            |||||
Sbjct: 247 caggat 242



to top

>gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence
          Length = 675

 Score =  153 bits (77), Expect = 8e-34
 Identities = 177/209 (84%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                       
Query: 194 ttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctccac 253
           ||||||| |||| || ||||||||| || |||||||||||||| ||||| || || || |
Sbjct: 524 ttcactccttggcggtcttgttgatgagcgacttgtggatgtgcgggatgacgccgcccc 465

                                                                       
Query: 254 cagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           | || ||||||||| ||||||||||||| ||||||||||| || |||||||| |||||||
Sbjct: 464 cggcgatggtgcccctgatgagggtgtcgagctcctcgtccccgcggatggcgagctgca 405

                                                                       
Query: 314 -ggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcc 372
            |||| || ||||| || ||||| ||||| || |||||||| ||||| || |||||||| 
Sbjct: 404 gggtggcgcggggtaatgcgcttgaccttgaggtccttgctggcgttgccggccagctcg 345

                                        
Query: 373 agaacctcggccgtcaggtactcgaggat 401
           || |||||||| || ||||||||||||||
Sbjct: 344 aggacctcggcggtgaggtactcgaggat 316



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/108 (86%), Gaps = 4/108 (3%)
 Strand = Plus / Minus

                                                                       
Query: 487 gggaactggagcccggcgcgggacgagcgggagatgggggccttcttcc---ccttgtcc 543
           ||||||||||| ||||||||||| ||||| || | ||||||||||||||   ||||||||
Sbjct: 230 gggaactggaggccggcgcgggaggagcgcgacacgggggccttcttcctgtccttgtcc 171

                                                           
Query: 544 ttctcggcggtcttggcgggccgtcgtcttggccgcgagcaggccctt 591
           || |||| | |||||||  ||||||||||||||||| ||||| |||||
Sbjct: 170 ttgtcggtgctcttggc-cgccgtcgtcttggccgccagcagaccctt 124



to top

>gb|BC049523.1| Danio rerio similar to H2A histone family, member V, mRNA (cDNA
           clone IMAGE:6033710), partial cds
          Length = 843

 Score =  147 bits (74), Expect = 5e-32
 Identities = 188/226 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || || ||||| |||||||||||| ||||||| || 
Sbjct: 420 atcagagacttgtggatgtgaggaatgactcctcctccagcaatggtggccttgataagc 361

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||||||||| |||||||||||||| |  || |  || ||||| ||||||
Sbjct: 360 gagtccagctcctcgtctccgcggatggccagctgtaaatgtctgggagtgattcgcttc 301

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           ||||||||||||||   |||||| ||||||| |||||| ||||| || || || ||||| 
Sbjct: 300 accttcagatccttagaagcgtttccagccaactccagcacctcagcggtgagatactcc 241

                                                         
Query: 397 aggatagcagcagagtagaccgccgcagtagcaccaacacggccat 442
           ||||||||||||  ||| ||||| || ||||| || ||||||||||
Sbjct: 240 aggatagcagcactgtaaaccgcagctgtagctccgacacggccat 195



to top

>emb|CR711930.2|CNS0GC9Y Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score =  147 bits (74), Expect = 5e-32
 Identities = 158/186 (84%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 454 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 395

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || ||||||||||| || |||||||||||||||||||| || |||||||| ||| |
Sbjct: 394 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgcct 335

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| |||||||| ||||| ||||| || || ||||||||
Sbjct: 334 caccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactc 275

                 
Query: 396 gaggat 401
            |||||
Sbjct: 274 caggat 269



to top

>ref|XM_693453.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           (H2AV), mRNA
          Length = 718

 Score =  147 bits (74), Expect = 5e-32
 Identities = 188/226 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| || || || ||||| |||||||||||| ||||||| || 
Sbjct: 314 atcagagacttgtggatgtgaggaatgactcctcctccagcaatggtggccttgataagc 255

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |||||||||||||| |||||||||||||| |  || |  || ||||| ||||||
Sbjct: 254 gagtccagctcctcgtctccgcggatggccagctgtaaatgtctgggagtgattcgcttc 195

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           ||||||||||||||   |||||| ||||||| |||||| ||||| || || || ||||| 
Sbjct: 194 accttcagatccttagaagcgtttccagccaactccagcacctcagcggtgagatactcc 135

                                                         
Query: 397 aggatagcagcagagtagaccgccgcagtagcaccaacacggccat 442
           ||||||||||||  ||| ||||| || ||||| || ||||||||||
Sbjct: 134 aggatagcagcactgtaaaccgcagctgtagctccgacacggccat 89



to top

>gb|BT014555.1| Lycopersicon esculentum clone 133985F, mRNA sequence
          Length = 772

 Score =  145 bits (73), Expect = 2e-31
 Identities = 184/221 (83%)
 Strand = Plus / Minus

                                                                       
Query: 193 tttcactctttggaggacttgttgatcagggacttgtggatgtgtgggatcacacctcca 252
           |||||||| |||| ||  ||||| || || || ||||| ||||| ||||| ||||| |||
Sbjct: 528 tttcactccttggtggttttgtttatgagtgatttgtgaatgtgagggatgacaccgcca 469

                                                                       
Query: 253 ccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgc 312
           ||||||||||| || || || ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 468 ccagcaatggtccctttaataagggtgtcaagttcctcatctccacgaatggccagctgc 409

                                                                       
Query: 313 aggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctcc 372
           || || |  || ||||| | ||||||||||||||||||||| || || |||||||  || 
Sbjct: 408 agatgcctgggtgtgatcctcttcaccttcagatccttgcttgcattgccagccaattca 349

                                                    
Query: 373 agaacctcggccgtcaggtactcgaggatagcagcagagta 413
           |||||||| || |||||||| || || ||||||||||||||
Sbjct: 348 agaacctctgctgtcaggtattccagaatagcagcagagta 308



to top

>emb|CR671361.2|CNS0FGZR Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  141 bits (71), Expect = 3e-30
 Identities = 159/187 (85%), Gaps = 1/187 (0%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| |||||||||||||| ||||| |||||| | ||||| | 
Sbjct: 454 gatcagagacttgtggatgtgcgggatcacacctccgccagcgatggtggctttgatcaa 395

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacg-aggggtgatacgct 334
           ||  || ||||||||||| || |||||||||||||||||||| ||  |||||||| ||||
Sbjct: 394 ggaatccagctcctcgtcgcctcggatggccagctgcaggtggcgcgggggtgattcgct 335

                                                                       
Query: 335 tcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtact 394
           |||||||||| ||||||   ||||| |||||||| ||||| ||||| || || |||||||
Sbjct: 334 tcaccttcaggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtact 275

                  
Query: 395 cgaggat 401
           | |||||
Sbjct: 274 ccaggat 268



to top

>gb|AC144617.10| Medicago truncatula clone mth2-7m9, complete sequence
          Length = 122853

 Score =  139 bits (70), Expect = 1e-29
 Identities = 235/290 (81%)
 Strand = Plus / Minus

                                                                        
Query: 205  gaggacttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtg 264
            |||||||||||||| || ||||||||||| || || || ||||| |||||||| || || 
Sbjct: 1666 gaggacttgttgataagagacttgtggatatgaggaataacaccaccaccagctattgtt 1607

                                                                        
Query: 265  cccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggg 324
            || |||||||| |||||||| || |||||||||||||| || || || || || | ||| 
Sbjct: 1606 cctttgatgagagtgtcaagttcttcgtctccacggatagcaagttgtagatgtctaggt 1547

                                                                        
Query: 325  gtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggcc 384
            || |||||||||||||||||||||||||| || || ||||||| |||||  ||||| || 
Sbjct: 1546 gtaatacgcttcaccttcagatccttgcttgcattgccagccaactccaacacctctgca 1487

                                                                        
Query: 385  gtcaggtactcgaggatagcagcagagtagaccgccgcagtagcaccaacacggccattc 444
            || |  ||||| |||||||||||||| || || || || ||||| ||||| |  ||||  
Sbjct: 1486 gttaaatactccaggatagcagcagaataaactgcagctgtagccccaactcttccatgt 1427

                                                              
Query: 445  gcctgggtcctttgcttcagctgacgatggatacggccaacagggaactg 494
            |||   |||||   ||||||  ||||||||||||| ||||||||||||||
Sbjct: 1426 gccattgtcctcgacttcagaagacgatggatacgtccaacagggaactg 1377



to top

>ref|NM_115313.3| Arabidopsis thaliana DNA binding AT3G54560 mRNA, complete cds
          Length = 685

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 485 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 426

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 425 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 366

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 365 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 306

                                                       
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
           ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 305 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 262



to top

>emb|Y12575.1|ATH2AV Arabidopsis thaliana mRNA for histone H2A.F/Z
          Length = 714

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 493 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 434

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 433 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 374

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 373 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 314

                                                       
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
           ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 313 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 270



to top

>emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, BAC clone T14E10
          Length = 94911

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                         
Query: 211   ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
             |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 66178 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 66119

                                                                         
Query: 271   atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
             ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 66118 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 66059

                                                                         
Query: 331   cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
             | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 66058 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 65999

                                                         
Query: 391   tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
             ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 65998 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 65955



to top

>emb|BX825753.1|CNS0A65Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZA04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 616

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 453 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 394

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 393 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 334

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 333 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 274

                                                       
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
           ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 273 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 230



to top

>gb|BT005205.1| Arabidopsis thaliana At3g54560 mRNA, complete cds
          Length = 411

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 395 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 336

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 335 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 276

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 275 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 216

                                                       
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
           ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 215 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 172



to top

>gb|AY087232.1| Arabidopsis thaliana clone 33085 mRNA, complete sequence
          Length = 669

 Score =  127 bits (64), Expect = 4e-26
 Identities = 184/224 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 484 ttgttgatgagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 425

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 424 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 365

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||||||||||| || |||||||||| ||| |||||||| || ||||| 
Sbjct: 364 ctcttcactttgagatccttgctcgcattcccagccaactcaagaacctctgctgtcaga 305

                                                       
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaac 434
           ||||| ||||| | ||| | |||||| || ||||| ||||||||
Sbjct: 304 tactccaggattgaagctgtgtagacggctgcagtggcaccaac 261



to top

>emb|CR733482.2|CNS0GSQH Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 agggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtg 279
           ||||| |||||||||||||| || |||||||| || ||||| ||  |||||||||||| |
Sbjct: 414 agggatttgtggatgtgtggaatgacacctcctccggcaattgttgccttgatgagggag 355

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           || | ||||||||| || |||||||||||||||| ||| ||||| |||||||||||||||
Sbjct: 354 tccaactcctcgtcaccgcggatggccagctgcaagtggcgaggagtgatacgcttcacc 295

               
Query: 340 ttca 343
           ||||
Sbjct: 294 ttca 291



to top

>emb|CR732601.2|CNS0GS7Y Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 agggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtg 279
           ||||| |||||||||||||| || |||||||| || ||||| ||  |||||||||||| |
Sbjct: 415 agggatttgtggatgtgtggaatgacacctcctccggcaattgttgccttgatgagggag 356

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           || | ||||||||| || |||||||||||||||| ||| ||||| |||||||||||||||
Sbjct: 355 tccaactcctcgtcaccgcggatggccagctgcaagtggcgaggagtgatacgcttcacc 296

               
Query: 340 ttca 343
           ||||
Sbjct: 295 ttca 292



to top

>emb|CR725413.2|CNS0GMOB Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 agggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtg 279
           ||||| |||||||||||||| || |||||||| || ||||| ||  |||||||||||| |
Sbjct: 411 agggatttgtggatgtgtggaatgacacctcctccggcaattgttgccttgatgagggag 352

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           || | ||||||||| || |||||||||||||||| ||| ||||| |||||||||||||||
Sbjct: 351 tccaactcctcgtcaccgcggatggccagctgcaagtggcgaggagtgatacgcttcacc 292

               
Query: 340 ttca 343
           ||||
Sbjct: 291 ttca 288



to top

>emb|CR694893.1|CNS0FZ4P Tetraodon nigroviridis full-length cDNA
          Length = 582

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 agggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtg 279
           ||||| |||||||||||||| || |||||||| || ||||| ||  |||||||||||| |
Sbjct: 427 agggatttgtggatgtgtggaatgacacctcctccggcaattgttgccttgatgagggag 368

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           || | ||||||||| || |||||||||||||||| ||| ||||| |||||||||||||||
Sbjct: 367 tccaactcctcgtcaccgcggatggccagctgcaagtggcgaggagtgatacgcttcacc 308

               
Query: 340 ttca 343
           ||||
Sbjct: 307 ttca 304



to top

>emb|BX822865.1|CNS0A7LY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB69ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 670

 Score =  115 bits (58), Expect = 2e-22
 Identities = 184/226 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||| || |||||||||||||| ||||||||||| || |||||||| || ||||||
Sbjct: 470 ttgttgataagagacttgtggatgtgagggatcacaccacctccagcaatcgttcccttg 411

                                                                       
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgata 330
           ||||| ||||| |||||||| ||||| |  || |||| |||||| || |  || || || 
Sbjct: 410 atgagtgtgtccagctcctcatctcctctaatcgccaactgcagatgccttggcgttatc 351

                                                                       
Query: 331 cgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcagg 390
           | |||||| || ||| ||||||| || |||||||||| ||| |||||||| || || || 
Sbjct: 350 ctcttcactttgagaaccttgctcgcattcccagccaactcaagaacctctgctgttaga 291

                                                         
Query: 391 tactcgaggatagcagcagagtagaccgccgcagtagcaccaacac 436
           ||||| ||||| | ||| | |||||| || ||||| ||||||||||
Sbjct: 290 tactccaggattgaagctgtgtagacggctgcagtggcaccaacac 245



to top

>gb|BC049019.1| Danio rerio H2A histone family, member Z, mRNA (cDNA clone
           MGC:56421 IMAGE:5611777), complete cds
          Length = 843

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |||
Sbjct: 434 atcagagacttgtggatgtgtggaatcacacctcctccagcaatagtggccttgataagg 375

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| ||||| || ||||||||||| |  || ||||| ||||| ||||||
Sbjct: 374 gaatcgagctcctcatctcctcgaatggccagctgtaaatgtcgaggagtgatgcgcttc 315

                   
Query: 337 accttcag 344
           ||||||||
Sbjct: 314 accttcag 307



to top

>ref|NM_153644.1| Danio rerio H2A histone family, member Z (h2afz), mRNA
          Length = 833

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |||
Sbjct: 406 atcagagacttgtggatgtgtggaatcacacctcctccagcaatagtggccttgataagg 347

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| ||||| || ||||||||||| |  || ||||| ||||| ||||||
Sbjct: 346 gaatcgagctcctcatctcctcgaatggccagctgtaaatgtcgaggagtgatgcgcttc 287

                   
Query: 337 accttcag 344
           ||||||||
Sbjct: 286 accttcag 279



to top

>gb|AF414110.1|AF414110 Danio rerio histone variant H2A.F/Z mRNA, complete cds
          Length = 833

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |||
Sbjct: 406 atcagagacttgtggatgtgtggaatcacacctcctccagcaatagtggccttgataagg 347

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| ||||| || ||||||||||| |  || ||||| ||||| ||||||
Sbjct: 346 gaatcgagctcctcatctcctcgaatggccagctgtaaatgtcgaggagtgatgcgcttc 287

                   
Query: 337 accttcag 344
           ||||||||
Sbjct: 286 accttcag 279



to top

>ref|XM_702461.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           isoform 1, transcript variant 2 (LOC573415), mRNA
          Length = 824

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |||
Sbjct: 432 atcagagacttgtggatgtgtggaatcacacctcctccagcaatagtggccttgataagg 373

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| ||||| || ||||||||||| |  || ||||| ||||| ||||||
Sbjct: 372 gaatcgagctcctcatctcctcgaatggccagctgtaaatgtcgaggagtgatgcgcttc 313

                   
Query: 337 accttcag 344
           ||||||||
Sbjct: 312 accttcag 305



to top

>ref|XM_679474.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           isoform 1, transcript variant 1 (LOC573415), mRNA
          Length = 831

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |||
Sbjct: 439 atcagagacttgtggatgtgtggaatcacacctcctccagcaatagtggccttgataagg 380

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| ||||| || ||||||||||| |  || ||||| ||||| ||||||
Sbjct: 379 gaatcgagctcctcatctcctcgaatggccagctgtaaatgtcgaggagtgatgcgcttc 320

                   
Query: 337 accttcag 344
           ||||||||
Sbjct: 319 accttcag 312



to top

>emb|CR692524.2|CNS0FXAW Tetraodon nigroviridis full-length cDNA
          Length = 355

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||||||||| || |||||||||||||||||||| || |||||||| ||||||||||||
Sbjct: 354 agctcctcgtcgcctcggatggccagctgcaggtggcgcggggtgattcgcttcaccttc 295

                                                                      
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggat 401
           || ||||||   ||||| |||||||| ||||| ||||| || || |||||||| |||||
Sbjct: 294 aggtccttggacgcgtttccagccagttccagcacctccgcggtgaggtactccaggat 236



to top

>gb|AY190700.1| Pagrus major histone H2A.F/Z variant mRNA, partial cds
          Length = 399

 Score =  103 bits (52), Expect = 6e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 agggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtg 279
           ||||| ||||||||||| || || |||||||| |||||||| ||  |||||||||| | |
Sbjct: 369 agggatttgtggatgtggggaatgacacctcctccagcaattgttgccttgatgagagag 310

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           || | |||||| || |||||||||||||||||||  ||||| || |||||||||||||||
Sbjct: 309 tccaactcctcatcaccacggatggccagctgcaaatgacggggagtgatacgcttcacc 250

               
Query: 340 ttca 343
           ||||
Sbjct: 249 ttca 246



to top

>gb|BC078599.1| Xenopus laevis MGC85536 protein, mRNA (cDNA clone MGC:85536
           IMAGE:6875774), complete cds
          Length = 727

 Score =  101 bits (51), Expect = 3e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||| || || || |||||||| |||||||||||| | ||||| || 
Sbjct: 449 atcagagacttgtggatatgaggaatgacacctcctccagcaatggtggctttgataaga 390

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  ||||||||||| || ||||| ||||| ||||||| ||| ||||| |||||||| |||
Sbjct: 389 gaatcaagctcctcatccccacgaatggctagctgcaagtgccgaggagtgatacgtttc 330

                          
Query: 337 accttcagatccttg 351
           || ||||||||||||
Sbjct: 329 actttcagatccttg 315



to top

>emb|X05547.1|SPH2AFZ Sea urchin mRNA fragment for histone H2A.F/Z
          Length = 379

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 cttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaag 284
           |||||||||||| ||||| ||||| |||||||| |||||  ||||||| || | ||| | 
Sbjct: 340 cttgtggatgtgagggatgacaccaccaccagcgatggttgccttgataagcgagtccaa 281

                                                                       
Query: 285 ctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcag 344
            || |||||||| | |||||||||||||| |||||| || ||||||||||| ||||||||
Sbjct: 280 ttcttcgtctcccctgatggccagctgcaagtgacggggtgtgatacgctttaccttcag 221

                                                                       
Query: 345 atccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggatagc 404
           ||| || ||||| || || |||| ||| ||||| || || || ||||| || |  |||||
Sbjct: 220 atctttactagcattgcctgccaactcaagaacttcagctgtgaggtattccaaaatagc 161

                                                 
Query: 405 agcagagtagaccgccgcagtagcaccaacacggccat 442
            |||||||| || || || || ||||| || |||||||
Sbjct: 160 ggcagagtatacagcggctgtggcaccgacgcggccat 123



to top

>ref|XM_504921.1| Yarrowia lipolytica CLIB122, YALI0F02827g predicted mRNA
          Length = 423

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 120/141 (85%), Gaps = 2/141 (1%)
 Strand = Plus / Minus

                                                                       
Query: 256 gcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcagg 315
           ||||||||| ||| |||||||||||| |||||||||||||| || ||||| ||||||| |
Sbjct: 353 gcaatggtggcctggatgagggtgtccagctcctcgtctcctcgaatggcaagctgcaag 294

                                                                       
Query: 316 tgacgaggggtgatacgcttcaccttcagatc-cttgctagcgttcccagccagctccag 374
           || ||||| ||||| ||||| ||||| ||||| | ||| |||||| || |||| ||||||
Sbjct: 293 tgtcgaggagtgattcgcttgaccttgagatcacgtgc-agcgttacccgccaactccag 235

                                
Query: 375 aacctcggccgtcaggtactc 395
           |||||| || ||||| |||||
Sbjct: 234 aacctcagcagtcagatactc 214



to top

>ref|XM_786337.1| PREDICTED: Strongylocentrotus purpuratus histone H2 A.F/Z
           (H2A.F/Z), mRNA
          Length = 1599

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 127/153 (83%)
 Strand = Plus / Minus

                                                                       
Query: 225 cttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaag 284
           |||||||||||| ||||| ||||| |||||||| |||||  ||||||| || | ||| | 
Sbjct: 417 cttgtggatgtgagggatgacaccaccaccagcgatggttgccttgataagcgagtccaa 358

                                                                       
Query: 285 ctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcag 344
            || |||||||| | |||||||||||||| |||||| || ||||||||||| ||||||||
Sbjct: 357 ttcttcgtctcccctgatggccagctgcaagtgacggggtgtgatacgctttaccttcag 298

                                            
Query: 345 atccttgctagcgttcccagccagctccagaac 377
           ||| || ||||| || || |||| ||| |||||
Sbjct: 297 atctttactagcattgcctgccaactcaagaac 265



to top

>emb|X07485.1|DMH2AVD D. melanogaster H2AvD mRNA for histone 2A variant
          Length = 913

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 506 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 447

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 446 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 387

                                                                    
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggta 392
           ||| ||||  |||||    ||||| || |||| |||||| |||||||| ||||||||
Sbjct: 386 cactttcaagtccttcgatgcgttgcctgccaactccaggacctcggcggtcaggta 330



to top

>gb|AY118910.1| Drosophila melanogaster LD21568 full insert cDNA
          Length = 904

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 494 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 435

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 434 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 375

                                                                    
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggta 392
           ||| ||||  |||||    ||||| || |||| |||||| |||||||| ||||||||
Sbjct: 374 cactttcaagtccttcgatgcgttgcctgccaactccaggacctcggcggtcaggta 318



to top

>ref|NM_079795.2| Drosophila melanogaster Histone H2A variant CG5499-RA (His2Av),
           mRNA
          Length = 910

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 519 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 460

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 459 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 400

                                                                    
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggta 392
           ||| ||||  |||||    ||||| || |||| |||||| |||||||| ||||||||
Sbjct: 399 cactttcaagtccttcgatgcgttgcctgccaactccaggacctcggcggtcaggta 343



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 120/141 (85%), Gaps = 2/141 (1%)
 Strand = Plus / Minus

                                                                          
Query: 256    gcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagctgcagg 315
              ||||||||| ||| |||||||||||| |||||||||||||| || ||||| ||||||| |
Sbjct: 407692 gcaatggtggcctggatgagggtgtccagctcctcgtctcctcgaatggcaagctgcaag 407633

                                                                          
Query: 316    tgacgaggggtgatacgcttcaccttcagatc-cttgctagcgttcccagccagctccag 374
              || ||||| ||||| ||||| ||||| ||||| | ||| |||||| || |||| ||||||
Sbjct: 407632 tgtcgaggagtgattcgcttgaccttgagatcacgtgc-agcgttacccgccaactccag 407574

                                   
Query: 375    aacctcggccgtcaggtactc 395
              |||||| || ||||| |||||
Sbjct: 407573 aacctcagcagtcagatactc 407553



to top

>ref|XM_970375.1| PREDICTED: Tribolium castaneum similar to H2A histone family,
           member Z (LOC664368), mRNA
          Length = 743

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 129/156 (82%)
 Strand = Plus / Minus

                                                                       
Query: 225 cttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaag 284
           ||||||||||||||| || || ||||| || || || ||| ||||||| ||| |||| ||
Sbjct: 387 cttgtggatgtgtggaatgacgcctccgccggcgatagtggccttgatcaggctgtccag 328

                                                                       
Query: 285 ctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcag 344
           ||||||||| || | |||||||||||||| ||| |  |||||||| | ||||||||||| 
Sbjct: 327 ctcctcgtcccctctgatggccagctgcaagtgcctgggggtgatcctcttcaccttcaa 268

                                               
Query: 345 atccttgctagcgttcccagccagctccagaacctc 380
            ||||| || |||||||| |||| |||||| |||||
Sbjct: 267 gtccttactggcgttcccggccaactccaggacctc 232



to top

>emb|V00414.1|GGHI01 Gallus gallus mRNA coding for a variant histone H2A
          Length = 650

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 156/192 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| |||||||||||||| ||||| || ||||| || || |||||| | ||||||||
Sbjct: 427 gatcagagacttgtggatgtgggggatgacgcctccccccgctatggtggctttgatgag 368

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||  || | ||| ||||| || ||||| ||||||||||  || || || ||||| |||||
Sbjct: 367 ggaatccaactcttcgtcgccgcggatcgccagctgcaaatggcggggagtgatgcgctt 308

                                                                       
Query: 336 caccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||||||| ||||||   ||||| || |||| |||||| ||||| || || || |||||
Sbjct: 307 caccttcaggtccttggaggcgttgcctgccaactccaggacctcagcagtgagatactc 248

                       
Query: 396 gaggatagcagc 407
           |||||| |||||
Sbjct: 247 gaggatggcagc 236



to top

>ref|NM_179968.2| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.3 mRNA, complete cds
          Length = 720

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 545 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 486

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 485 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 443



to top

>ref|NM_129438.2| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.1 mRNA, complete cds
          Length = 688

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 513 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 454

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 453 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 411



to top

>ref|NM_179967.1| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.2 mRNA, complete cds
          Length = 591

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 416 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 357

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 356 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 314



to top

>gb|AC007133.7| Arabidopsis thaliana chromosome 2 clone F13I13 map CIC10A06, complete
            sequence
          Length = 21988

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 211  ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
            |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 7585 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 7644

                                                       
Query: 271  atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
            ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 7645 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 7687



to top

>dbj|AK220868.1| Arabidopsis thaliana mRNA for histone H2A, complete cds, clone:
           RAFL22-42-E22
          Length = 602

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 416 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 357

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 356 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 314



to top

>emb|BX821413.1|CNS0AA9R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL3ZE05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 489

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 400 ttgttgagaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 341

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 340 atgagagtgtcaagttcctcatctcctctgatcgcaagctgca 298



to top

>emb|BX821514.1|CNS0A96I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL47ZE12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 543

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 402 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 343

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 342 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 300



to top

>gb|AY088573.1| Arabidopsis thaliana clone 8 mRNA, complete sequence
          Length = 674

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||| |||||||||||||| || |||||||| || |||
Sbjct: 513 ttgttgacaagggacttgtggatgtgagggatcacacctcctcctgcaatggttcctttg 454

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| |||||||| ||||| ||||| | ||| || |||||||
Sbjct: 453 atgagagtgtcaagttcctcatctcctctgattgcaagctgca 411



to top

>gb|DQ215814.1| Taeniopygia guttata clone 0058P0009E02 histone H2A.Z-like mRNA,
           complete sequence
          Length = 799

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 464 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 405

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 404 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 345

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 344 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 285

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 284 gcagca 279



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 216 atggatgcggccaacagggaactg 193



to top

>gb|DQ215811.1| Taeniopygia guttata clone 0063P0013F11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 852

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 468 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 409

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 408 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 349

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 348 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 289

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 288 gcagca 283



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 220 atggatgcggccaacagggaactg 197



to top

>gb|DQ215810.1| Taeniopygia guttata clone 0061P0002G07 histone H2A.Z-like mRNA,
           complete sequence
          Length = 874

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 494 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 435

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 434 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 375

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 374 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 315

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 314 gcagca 309



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 246 atggatgcggccaacagggaactg 223



to top

>gb|DQ215809.1| Taeniopygia guttata clone 0058P0022F11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 843

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 447 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 388

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 387 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 328

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 327 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 268

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 267 gcagca 262



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 199 atggatgcggccaacagggaactg 176



to top

>gb|DQ215807.1| Taeniopygia guttata clone 0065P0002B11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 901

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 517 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 458

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 457 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 398

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 397 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 338

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 337 gcagca 332



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 269 atggatgcggccaacagggaactg 246



to top

>gb|DQ215806.1| Taeniopygia guttata clone 0058P0039A02 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 468 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 409

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 408 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 349

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 348 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 289

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 288 gcagca 283



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 220 atggatgcggccaacagggaactg 197



to top

>gb|DQ215804.1| Taeniopygia guttata clone 0058P0059H06 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 451 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 392

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 391 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 332

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 331 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 272

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 271 gcagca 266



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 203 atggatgcggccaacagggaactg 180



to top

>gb|DQ215803.1| Taeniopygia guttata clone 0058P0052E09 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 468 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 409

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 408 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccttc 349

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 348 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 289

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 288 gcagca 283



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 220 atggatgcggccaacagggaactg 197



to top

>emb|BX070691.1|CNS09QPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 143/176 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
           ||||||||||| || || || || || || ||||||||| ||||||| | | |||| |||
Sbjct: 394 ttgtggatgtggggaatgacgccaccgccggcaatggtggccttgatcaagctgtccagc 335

                                                                       
Query: 286 tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcaga 345
           |||||||| || || |||||||||||||| || |  || ||||| |||||||| || |||
Sbjct: 334 tcctcgtcaccgcgaatggccagctgcagatgcctgggcgtgattcgcttcactttgaga 275

                                                                   
Query: 346 tccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggat 401
           |||||    ||||| || |||| |||||| ||||| |||||||||||||| |||||
Sbjct: 274 tccttcgaggcgttgccggccaactccagcacctcagccgtcaggtactccaggat 219



to top

>emb|X15549.1|DMH2AVDG D.melanogaster H2AvD gene for histone H2A variant
          Length = 2255

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                        
Query: 216  gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
            |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 1816 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 1757

                                                                        
Query: 276  ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 1756 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 1697

                    
Query: 336  caccttca 343
            ||| ||||
Sbjct: 1696 cactttca 1689



to top

>gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, region 97C-97D, BAC clone
              BACR24O14, complete sequence
          Length = 170356

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                          
Query: 216    gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
              |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 127038 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 126979

                                                                          
Query: 276    ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
              | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 126978 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 126919

                      
Query: 336    caccttca 343
              ||| ||||
Sbjct: 126918 cactttca 126911



to top

>ref|XM_310818.2| Anopheles gambiae str. PEST ENSANGP00000015579
           (ENSANGG00000013090), partial mRNA
          Length = 363

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 143/176 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
           ||||||||||| || || || || || || ||||||||| ||||||| | | |||| |||
Sbjct: 344 ttgtggatgtggggaatgacgccaccgccggcaatggtggccttgatcaagctgtccagc 285

                                                                       
Query: 286 tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcaga 345
           |||||||| || || |||||||||||||| || |  || ||||| |||||||| || |||
Sbjct: 284 tcctcgtcaccgcgaatggccagctgcagatgcctgggcgtgattcgcttcactttgaga 225

                                                                   
Query: 346 tccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggat 401
           |||||    ||||| || |||| |||||| ||||| |||||||||||||| |||||
Sbjct: 224 tccttcgaggcgttgccggccaactccagcacctcagccgtcaggtactccaggat 169



to top

>gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96 of 118 of the
             complete sequence
          Length = 228635

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                         
Query: 216   gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
             |||||| |||||||| ||||| || || ||||| |||||||| |||||  ||||||| ||
Sbjct: 80554 gatcagcgacttgtgtatgtgcggaatgacaccgccaccagcgatggttgccttgatcag 80495

                                                                         
Query: 276   ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
             | |||| |||||||||||||| || ||||| ||||| | ||| ||||| |||||||| ||
Sbjct: 80494 gctgtccagctcctcgtctccgcgaatggcgagctgtaagtggcgaggagtgatacgttt 80435

                     
Query: 336   caccttca 343
             ||| ||||
Sbjct: 80434 cactttca 80427



to top

>gb|BC086348.1| Rattus norvegicus H2A histone family, member Z, mRNA (cDNA clone
           MGC:105426 IMAGE:7302603), complete cds
          Length = 880

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 445 atcagtgatttgtggatgtgtgggatgacaccaccaccagcaatcgtagccttgatcaga 386

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| | ||| || ||||| ||||| || || |||| |||||||||||| |||||||| 
Sbjct: 385 gagtccaactcttcatctccgcggatagcaagttgcaagtgacgaggggtaatacgcttt 326

                  
Query: 337 accttca 343
           |||||||
Sbjct: 325 accttca 319



to top

>gb|BC074203.1| Xenopus laevis MGC82121 protein, mRNA (cDNA clone MGC:82121
           IMAGE:7012019), complete cds
          Length = 788

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||| || || || |||||||| |||||||||||| | ||||| || 
Sbjct: 455 atcagagacttgtggatatgaggaatgacacctcctccagcaatggtggctttgatcaga 396

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || ||||| || || ||||| ||||| ||||||| ||| ||||| |||||||| |||
Sbjct: 395 gaatcgagctcttcatccccacgaatggctagctgcaagtgccgaggagtgatacgtttc 336

                          
Query: 337 accttcagatccttg 351
           || ||||||||||||
Sbjct: 335 actttcagatccttg 321



to top

>gb|BC060564.1| Rattus norvegicus H2A histone family, member Z, mRNA (cDNA clone
           MGC:72814 IMAGE:6922321), complete cds
          Length = 897

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 465 atcagtgatttgtggatgtgtgggatgacaccaccaccagcaatcgtagccttgatcaga 406

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| | ||| || ||||| ||||| || || |||| |||||||||||| |||||||| 
Sbjct: 405 gagtccaactcttcatctccgcggatagcaagttgcaagtgacgaggggtaatacgcttt 346

                  
Query: 337 accttca 343
           |||||||
Sbjct: 345 accttca 339



to top

>ref|NM_068168.2| Caenorhabditis elegans R08C7.3 (R08C7.3) mRNA, complete cds
          Length = 762

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagctcc 288
           |||||||||||||| || ||||| || || |||||| |||||||||| ||||| ||||| 
Sbjct: 427 tggatgtgtgggatgactcctcctccggcgatggtggccttgatgagagtgtcgagctct 368

                                                                       
Query: 289 tcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatcc 348
           |||||||| | ||| || || || || || |  |||||||||||||||||||| ||||||
Sbjct: 367 tcgtctcctctgatagcaagatgaagatgtcttggggtgatacgcttcaccttaagatcc 308

              
Query: 349 ttg 351
           |||
Sbjct: 307 ttg 305



to top

>ref|NM_001016178.2| Xenopus tropicalis hypothetical protein LOC548932 (LOC548932), mRNA
          Length = 943

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||| || || || |||||||| |||||||||||  | ||||| || 
Sbjct: 571 atcagagacttgtggatatgaggaatgacacctcctccagcaatggtcgctttgatcaga 512

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| || ||||| ||||| ||||||| ||| ||||| |||||||| |||
Sbjct: 511 gaatccagctcctcatccccacgaatggctagctgcaagtgccgaggagtgatacgtttc 452

                          
Query: 337 accttcagatccttg 351
           || ||||||||||||
Sbjct: 451 actttcagatccttg 437



to top

>gb|BC091605.1| Xenopus tropicalis hypothetical protein LOC548932, mRNA (cDNA clone
           MGC:97691 IMAGE:6983532), complete cds
          Length = 943

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||| || || || |||||||| |||||||||||  | ||||| || 
Sbjct: 571 atcagagacttgtggatatgaggaatgacacctcctccagcaatggtcgctttgatcaga 512

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| || ||||| ||||| ||||||| ||| ||||| |||||||| |||
Sbjct: 511 gaatccagctcctcatccccacgaatggctagctgcaagtgccgaggagtgatacgtttc 452

                          
Query: 337 accttcagatccttg 351
           || ||||||||||||
Sbjct: 451 actttcagatccttg 437



to top

>ref|NM_022674.1| Rattus norvegicus H2A histone family, member Z (H2afz), mRNA
          Length = 811

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 400 atcagtgatttgtggatgtgtgggatgacaccaccaccagcaatcgtagccttgatcaga 341

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| | ||| || ||||| ||||| || || |||| |||||||||||| |||||||| 
Sbjct: 340 gagtccaactcttcatctccgcggatagcaagttgcaagtgacgaggggtaatacgcttt 281

                  
Query: 337 accttca 343
           |||||||
Sbjct: 280 accttca 274



to top

>gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence
          Length = 39012

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Minus

                                                                         
Query: 229   tggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagctcc 288
             |||||||||||||| || ||||| || || |||||| |||||||||| ||||| ||||| 
Sbjct: 25573 tggatgtgtgggatgactcctcctccggcgatggtggccttgatgagagtgtcgagctct 25514

                                                                         
Query: 289   tcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatcc 348
             |||||||| | ||| || || || || || |  |||||||||||||||||||| ||||||
Sbjct: 25513 tcgtctcctctgatagcaagatgaagatgtcttggggtgatacgcttcaccttaagatcc 25454

                
Query: 349   ttg 351
             |||
Sbjct: 25453 ttg 25451



to top

>emb|X52316.1|RSH2AZ Rat mRNA for histone H2A.Z
          Length = 778

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 371 atcagtgatttgtggatgtgtgggatgacaccaccaccagcaatcgtagccttgatcaga 312

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| | ||| || ||||| ||||| || || |||| |||||||||||| |||||||| 
Sbjct: 311 gagtccaactcttcatctccgcggatagcaagttgcaagtgacgaggggtaatacgcttt 252

                  
Query: 337 accttca 343
           |||||||
Sbjct: 251 accttca 245



to top

>emb|CR761860.2| Xenopus tropicalis finished cDNA, clone TGas096d24
          Length = 751

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| ||||||||||| || || || |||||||| |||||||||||  | ||||| || 
Sbjct: 414 atcagagacttgtggatatgaggaatgacacctcctccagcaatggtcgctttgatcaga 355

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |||||||| || ||||| ||||| ||||||| ||| ||||| |||||||| |||
Sbjct: 354 gaatccagctcctcatccccacgaatggctagctgcaagtgccgaggagtgatacgtttc 295

                          
Query: 337 accttcagatccttg 351
           || ||||||||||||
Sbjct: 294 actttcagatccttg 280



to top

>gb|M37584.1|RATHIS2AZ Rat histone (H2A.Z) mRNA, complete cds
          Length = 811

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 400 atcagtgatttgtggatgtgtgggatgacaccaccaccagcaatcgtagccttgatcaga 341

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| | ||| || ||||| ||||| || || |||| |||||||||||| |||||||| 
Sbjct: 340 gagtccaactcttcatctccgcggatagcaagttgcaagtgacgaggggtaatacgcttt 281

                  
Query: 337 accttca 343
           |||||||
Sbjct: 280 accttca 274



to top

>gb|DQ215813.1| Taeniopygia guttata clone 0058P0052D09 histone H2A.Z-like mRNA,
           complete sequence
          Length = 839

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 447 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 388

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||| ||||| || |||||||| |||||||||
Sbjct: 387 agctcttcatctcctctaatggcaagctgcagatgacggggagtgatacgtttcaccttc 328

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 327 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 268

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 267 gcagca 262



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 199 atggatgcggccaacagggaactg 176



to top

>gb|DQ215808.1| Taeniopygia guttata clone 0058P0029H07 histone H2A.Z-like mRNA,
           complete sequence
          Length = 836

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 457 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 398

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| |||||||| ||||| || |||||||| |||||||||
Sbjct: 397 agctcttcatctcctctaatggcaagctgcagatgacggggagtgatacgtttcaccttc 338

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   || || || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 337 aagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggatt 278

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 277 gcagca 272



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 209 atggatgcggccaacagggaactg 186



to top

>gb|DQ215805.1| Taeniopygia guttata clone 0061P0010E11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 844

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 464 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 405

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||| || ||||| |  ||||| ||||| || ||||| || |||||||| |||||||||
Sbjct: 404 agctcttcatctcctctaatggcaagctgaagatgacggggagtgatacgtttcaccttc 345

                                                                       
Query: 343 agatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggata 402
           |  || |||   ||||| || |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 344 aagtctttggaggcgtttcccgccagctcaaggacctcagctgtcaggtactccaggatt 285

                 
Query: 403 gcagca 408
           ||||||
Sbjct: 284 gcagca 279



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 216 atggatgcggccaacagggaactg 193



to top

>gb|BC079903.1| Mus musculus H2A histone family, member Z, mRNA (cDNA clone
           MGC:96771 IMAGE:30622912), complete cds
          Length = 912

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 486 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 427

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 426 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 367

                 
Query: 336 cacctt 341
            |||||
Sbjct: 366 tacctt 361



to top

>ref|NM_016750.1| Mus musculus H2A histone family, member Z (H2afz), mRNA
          Length = 989

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 452 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 393

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 392 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 333

                 
Query: 336 cacctt 341
            |||||
Sbjct: 332 tacctt 327



to top

>ref|XM_978064.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 2 (LOC669445), mRNA
          Length = 912

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 472 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 413

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 412 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 353

                 
Query: 336 cacctt 341
            |||||
Sbjct: 352 tacctt 347



to top

>ref|XM_001000476.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
            transcript variant 2 (LOC666634), mRNA
          Length = 2916

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                        
Query: 216  gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
            |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 2477 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 2418

                                                                        
Query: 276  ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
             |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 2417 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 2358

                  
Query: 336  cacctt 341
             |||||
Sbjct: 2357 tacctt 2352



to top

>ref|XM_001003000.1| PREDICTED: Mus musculus H2A histone family, member Z, transcript
            variant 2 (H2afz), mRNA
          Length = 2916

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                        
Query: 216  gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
            |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 2477 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 2418

                                                                        
Query: 276  ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
             |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 2417 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 2358

                  
Query: 336  cacctt 341
             |||||
Sbjct: 2357 tacctt 2352



to top

>ref|XM_760084.1| Theileria parva strain Muguga histone H2A (TP02_0611) partial mRNA
          Length = 631

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagctcc 288
           |||||||||||||| || || || || ||||||||  |||||| ||| ||||| || |||
Sbjct: 482 tggatgtgtgggatgactccaccgccggcaatggtagccttgacgagtgtgtcgagttcc 423

                                                                       
Query: 289 tcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatcc 348
           |||||||| | ||||||||| |||| |||||| || ||||||||||| ||||| || |||
Sbjct: 422 tcgtctcctctgatggccagttgcaagtgacgtggcgtgatacgcttgaccttgaggtcc 363

             
Query: 349 tt 350
           ||
Sbjct: 362 tt 361



to top

>ref|XM_381803.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01627.1) partial mRNA
          Length = 435

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           ||||| |||||||| || ||||| ||||| ||||| ||||| || || ||||||||||| 
Sbjct: 329 gtgtcgagctcctcatcaccacgaatggcaagctgaaggtggcggggtgtgatacgcttg 270

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           ||||| || ||||||  |||||| || |||| ||||||||| || || ||||||||||||
Sbjct: 269 accttgaggtccttggcagcgttgcctgccaactccagaacttcagcagtcaggtactcg 210

             
Query: 397 ag 398
           ||
Sbjct: 209 ag 208



to top

>ref|XM_947008.1| Theileria annulata strain Ankara histone H2A variant (TA14155)
           partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 229 tggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagctcc 288
           ||||| ||||| || ||||| ||||| ||||||||  ||||||  || ||||| || || 
Sbjct: 398 tggatatgtggtatgacaccaccacctgcaatggttgccttgacaagtgtgtcgagttct 339

                                                                       
Query: 289 tcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatcc 348
           |||||||| | ||||||||| |||| |||||| || ||||||||||||||||| ||||||
Sbjct: 338 tcgtctcctctgatggccagttgcaagtgacgtggagtgatacgcttcaccttgagatcc 279

             
Query: 349 tt 350
           ||
Sbjct: 278 tt 277



to top

>dbj|AB225651.1| Aspergillus oryzae cDNA, contig sequence: AoEST2506
          Length = 683

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 270 gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
           |||||| ||||| | ||| ||||||||||||||||| ||||||| |||||| ||||||||
Sbjct: 443 gatgagagtgtccaactcttcgtctccacggatggcaagctgcaagtgacggggggtgat 384

                                 
Query: 330 acgcttcaccttcagatccttg 351
           |||||| ||||| || ||||||
Sbjct: 383 acgcttgaccttgaggtccttg 362



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                           
Query: 270     gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
               |||||| ||||| | ||| ||||||||||||||||| ||||||| |||||| ||||||||
Sbjct: 3588140 gatgagagtgtccaactcttcgtctccacggatggcaagctgcaagtgacggggggtgat 3588081

                                     
Query: 330     acgcttcaccttcagatccttg 351
               |||||| ||||| || ||||||
Sbjct: 3588080 acgcttgaccttgaggtccttg 3588059



to top

>dbj|AK151052.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830022D13 product:H2A histone
           family, member Z, full insert sequence
          Length = 966

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK146181.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730030H15 product:H2A histone family, member Z,
           full insert sequence
          Length = 997

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 496 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 437

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 436 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 377

                 
Query: 336 cacctt 341
            |||||
Sbjct: 376 tacctt 371



to top

>gb|AY074806.1| Mus musculus histone H2A.Z mRNA, complete cds
          Length = 863

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 461 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 402

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 401 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 342

                 
Query: 336 cacctt 341
            |||||
Sbjct: 341 tacctt 336



to top

>dbj|AK151868.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830041F09 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK143572.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
           library, clone:F420005H14 product:H2A histone family,
           member Z, full insert sequence
          Length = 964

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK152848.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830087J03 product:H2A histone
           family, member Z, full insert sequence
          Length = 964

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 462 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 403

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 402 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 343

                 
Query: 336 cacctt 341
            |||||
Sbjct: 342 tacctt 337



to top

>dbj|AK151509.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830031C05 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK152398.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067P16 product:H2A histone
           family, member Z, full insert sequence
          Length = 862

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 461 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 402

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 401 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 342

                 
Query: 336 cacctt 341
            |||||
Sbjct: 341 tacctt 336



to top

>dbj|AK150454.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830007N24 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK168178.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730064A04 product:H2A histone family,
           member Z, full insert sequence
          Length = 865

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 463 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 404

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 403 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 344

                 
Query: 336 cacctt 341
            |||||
Sbjct: 343 tacctt 338



to top

>dbj|AK169003.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920073D12 product:H2A histone family,
           member Z, full insert sequence
          Length = 850

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 349 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 290

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 289 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 230

                 
Query: 336 cacctt 341
            |||||
Sbjct: 229 tacctt 224



to top

>dbj|AK088704.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430024B19
           product:H2A histone family, member Z, full insert
           sequence
          Length = 1012

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 511 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 452

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 451 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 392

                 
Query: 336 cacctt 341
            |||||
Sbjct: 391 tacctt 386



to top

>dbj|AK044932.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130014G07 product:H2A histone
           family, member Z, full insert sequence
          Length = 2697

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 221 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 280

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 281 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 340

                 
Query: 336 cacctt 341
            |||||
Sbjct: 341 tacctt 346



to top

>dbj|AK028176.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2600014O08 product:H2A histone
           family, member Z, full insert sequence
          Length = 863

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 461 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 402

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 401 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 342

                 
Query: 336 cacctt 341
            |||||
Sbjct: 341 tacctt 336



to top

>gb|AC147612.5| Mus musculus BAC clone RP23-374K9 from 6, complete sequence
          Length = 190156

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                          
Query: 216    gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
              |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 145709 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 145768

                                                                          
Query: 276    ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
               |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 145769 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 145828

                    
Query: 336    cacctt 341
               |||||
Sbjct: 145829 tacctt 145834



to top

>gb|U70494.1|MMU70494 Mus musculus histone H2A.Z (H2A.Z) mRNA, complete cds
          Length = 989

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           |||||| || ||||||||||||||||| ||||| ||||||||||||||  | ||||| ||
Sbjct: 452 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcag 393

                                                                       
Query: 276 ggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
            |  || |  || || |||||||| || || ||||||| |||||||||||||||||||||
Sbjct: 392 agaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgctt 333

                 
Query: 336 cacctt 341
            |||||
Sbjct: 332 tacctt 327



to top

>gb|AF502246.1| Toxoplasma gondii histone H2A.F/Z mRNA, complete cds
          Length = 996

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 167/209 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| ||||| ||||| ||||| ||||| ||| ||||||| || 
Sbjct: 605 atcagcgacttgtggatgtgcgggatgacaccaccaccggcaatagtggccttgatcaga 546

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           || || | ||| ||||| || |  ||||| || |||| |||||| || || || |  |||
Sbjct: 545 gtatccaactcttcgtcacctctaatggcaagttgcaagtgacggggagtaattcttttc 486

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||||| ||||| || |||| ||| ||||| ||||| || |||||||||
Sbjct: 485 actttgagatccttgctggcgtttcccgccaactcgagaacttcggcggtgaggtactcg 426

                                        
Query: 397 aggatagcagcagagtagaccgccgcagt 425
           || ||||| |  | |||||| ||||||||
Sbjct: 425 agaatagccgatgcgtagacagccgcagt 397



to top

>gb|BC004274.1| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone IMAGE:3615320)
          Length = 678

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 363 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 304

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 303 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 244

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 243 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 184

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 183 agaatcgcagca 172



to top

>gb|BC014885.2| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone MGC:10170 IMAGE:3907411), complete cds
          Length = 644

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 407 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 348

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 347 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 288

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 287 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 228

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 227 agaatcgcagca 216



to top

>gb|BC000098.2| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone MGC:1947 IMAGE:3505930), complete cds
          Length = 758

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 438 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 379

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 378 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 319

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 318 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 259

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 258 agaatcgcagca 247



to top

>ref|NM_201436.1| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 3, mRNA
          Length = 1075

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 417 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 358

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 357 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 298

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 297 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 238

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 237 agaatcgcagca 226



to top

>ref|NM_012412.3| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 1, mRNA
          Length = 1153

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 495 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 436

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 435 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 376

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 375 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 316

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 315 agaatcgcagca 304



to top

>emb|CR602318.1| full-length cDNA clone CS0DC004YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 752

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 448 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 389

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 388 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 329

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 328 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 269

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 268 agaatcgcagca 257



to top

>dbj|AK129989.1| Homo sapiens cDNA FLJ26479 fis, clone KDN05022, highly similar to
           Histone H2A
          Length = 727

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 431 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 372

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 371 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 312

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 311 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 252

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 251 agaatcgcagca 240



to top

>gb|AF030235.1|AF030235 Oryctolagus cuniculus histone H2A.F/Z variant (H2A.F/Z) mRNA,
           complete cds
          Length = 689

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| |||||| |||| || ||||| |||||  ||||||| || 
Sbjct: 380 atcagagatttgtggatgtgagggatcgcaccacccccagctatggtagccttgataaga 321

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 320 gaatccaattcttcatcaccacggattgcaagctgcaagtgacgtggagtgatacgcttt 261

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || |||||||||  |||||| || ||||||||||| ||||| || || |||||||| 
Sbjct: 260 actttgagatccttggaagcgttacctgccagctccagtacctcagcagtgaggtactcc 201

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 200 agaattgcagca 189



to top

>gb|AF081192.1|AF081192 Homo sapiens histone H2A.F/Z variant (H2AV) mRNA, complete cds
          Length = 576

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 376 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 317

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 316 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 257

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 256 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 197

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 196 agaatcgcagca 185



to top

>gb|BC070169.1| Homo sapiens H2A histone family, member V, mRNA (cDNA clone
           MGC:88149 IMAGE:6458566), complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 438 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 379

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 378 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 319

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 318 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 259

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 258 agaatcgcagca 247



to top

>dbj|AB209001.1| Homo sapiens mRNA for H2A histone family, member V isoform 1
           variant protein
          Length = 1018

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 154/192 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 422 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 363

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 362 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 303

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || ||||||||   ||| || || ||||||||||| ||||| || || |||||||| 
Sbjct: 302 actttgagatccttagaagcattacctgccagctccagcacctctgcagtgaggtactcc 243

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 242 agaatcgcagca 231



to top

>gb|DQ215812.1| Taeniopygia guttata clone 0064P0008A04 histone H2A.Z-like mRNA,
           complete sequence
          Length = 852

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 151/187 (80%), Gaps = 1/187 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
           ||||||||||||||||| || ||||| ||||||||||| ||  ||||||| || |  || 
Sbjct: 469 gacttgtggatgtgtggtattacaccaccaccagcaattgttgccttgatcagagaatcc 410

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc-tt 341
           ||||| || ||||| |  ||||| |||||||||||||| || |||||||| |||||| ||
Sbjct: 409 agctcttcatctcctctaatggcaagctgcaggtgacggggagtgatacgtttcaccntt 350

                                                                       
Query: 342 cagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggat 401
           ||  || |||   || || || |||||||| || ||||| || ||||||||||| |||||
Sbjct: 349 caagtctttggaggcatttcccgccagctcaaggacctcagctgtcaggtactccaggat 290

                  
Query: 402 agcagca 408
            ||||||
Sbjct: 289 tgcagca 283



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 471 atggatacggccaacagggaactg 494
           |||||| |||||||||||||||||
Sbjct: 220 atggatgcggccaacagggaactg 197



to top

>ref|XM_532724.2| PREDICTED: Canis familiaris similar to H2A histone family, member V
           isoform 5, transcript variant 1 (LOC475501), mRNA
          Length = 2125

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 144/179 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| ||||||||||| || ||||| |||||  |||||||||| 
Sbjct: 420 atcagagacttgtggatgtgcgggatcacaccacccccagcgatggtagccttgatgaga 361

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || || || ||||| || ||||||| ||| || || ||||| ||||| 
Sbjct: 360 gaatccaattcttcatcaccgcggattgcaagctgcaagtggcgcggagtgatccgcttt 301

                                                                      
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| || ||||||  |||||| || ||||||||||| ||||| || || ||||||||
Sbjct: 300 accttgaggtccttggaagcgttacctgccagctccagcacctctgcagtgaggtactc 242



to top

>ref|XM_857381.1| PREDICTED: Canis familiaris histone H2AF, transcript variant 3
           (LOC478493), mRNA
          Length = 1124

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||||
Sbjct: 693 atcagagatttgtggatgtgtggaataacaccaccaccagcaattgtagccttgatgagg 634

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 633 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 574

                  
Query: 337 accttca 343
           |||||||
Sbjct: 573 accttca 567



to top

>ref|XM_857355.1| PREDICTED: Canis familiaris histone H2AF, transcript variant 2
           (LOC478493), mRNA
          Length = 1106

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||||
Sbjct: 693 atcagagatttgtggatgtgtggaataacaccaccaccagcaattgtagccttgatgagg 634

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 633 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 574

                  
Query: 337 accttca 343
           |||||||
Sbjct: 573 accttca 567



to top

>ref|XM_535671.2| PREDICTED: Canis familiaris histone H2AF, transcript variant 1
           (LOC478493), mRNA
          Length = 1106

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||||
Sbjct: 693 atcagagatttgtggatgtgtggaataacaccaccaccagcaattgtagccttgatgagg 634

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 633 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 574

                  
Query: 337 accttca 343
           |||||||
Sbjct: 573 accttca 567



to top

>emb|BX284748.1|NCB15B24 Neurospora crassa DNA linkage group II BAC clone B15B24
          Length = 54958

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 270   gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
             ||||||||| ||||||||||| |||||||||||||| ||||| || || || || || ||
Sbjct: 41275 gatgagggtatcaagctcctcatctccacggatggcaagctgaagatggcggggagtaat 41334

                                            
Query: 330   acgcttcaccttcagatccttgctagcgttc 360
             |||||| |||||||| ||||||  |||||||
Sbjct: 41335 acgcttgaccttcaggtccttggcagcgttc 41365



to top

>gb|BC109743.1| Bos taurus H2A histone family, member Z, mRNA (cDNA clone
           MGC:133929 IMAGE:8065476), complete cds
          Length = 884

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 466 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 407

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 406 gagtccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 347

                  
Query: 337 accttca 343
           |||||||
Sbjct: 346 accttca 340



to top

>ref|NM_174809.2| Bos taurus H2A histone family, member Z (H2AFZ), mRNA
          Length = 948

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 400 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 341

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 340 gagtccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 281

                  
Query: 337 accttca 343
           |||||||
Sbjct: 280 accttca 274



to top

>emb|X52318.1|BTH2AZ Bovine mRNA for histone H2A.Z
          Length = 906

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 356 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 297

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 296 gagtccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 237

                  
Query: 337 accttca 343
           |||||||
Sbjct: 236 accttca 230



to top

>gb|M37585.1|BOVHIS2AZ Cow histone (H2A.Z) mRNA, complete cds
          Length = 948

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 400 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 341

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 340 gagtccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 281

                  
Query: 337 accttca 343
           |||||||
Sbjct: 280 accttca 274



to top

>gb|AF069441.1| Arabidopsis thaliana BAC T19B17 from chromosome IV, near 19.3 cM,
            complete sequence
          Length = 105830

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                        
Query: 223  gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
            |||| ||||||||| |||||||||||||| ||| |||| || || |||||||| ||||||
Sbjct: 4015 gactagtggatgtgagggatcacacctcctccaacaattgttcctttgatgagtgtgtca 3956

                          
Query: 283  agctcctcgtctcc 296
            |||||||| |||||
Sbjct: 3955 agctcctcatctcc 3942



to top

>ref|XM_369251.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG06213.4) partial mRNA
          Length = 429

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
           |||||| ||||| ||||||||||| ||||| ||||| ||||| |||||||| || |||||
Sbjct: 330 gatgagcgtgtccagctcctcgtcgccacgaatggcaagctgtaggtgacggggagtgat 271

                                                                       
Query: 330 acgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcag 389
            ||||| ||||| ||||||||    ||||| || || ||||||| |||||| || |||| 
Sbjct: 270 tcgcttgaccttgagatcctttgcggcgttacccgcgagctccaaaacctctgcagtcaa 211

                 
Query: 390 gtactc 395
           ||||||
Sbjct: 210 gtactc 205



to top

>ref|XM_958245.1| Neurospora crassa OR74A hypothetical protein (NCU05347.1) partial
           mRNA
          Length = 432

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
           ||||||||| ||||||||||| |||||||||||||| ||||| || || || || || ||
Sbjct: 333 gatgagggtatcaagctcctcatctccacggatggcaagctgaagatggcggggagtaat 274

                                 
Query: 330 acgcttcaccttcagatccttg 351
           |||||| |||||||| ||||||
Sbjct: 273 acgcttgaccttcaggtccttg 252



to top

>ref|XM_325201.1| Neurospora crassa OR74A hypothetical protein (NCU05347.1) partial
           mRNA
          Length = 432

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 gatgagggtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgat 329
           ||||||||| ||||||||||| |||||||||||||| ||||| || || || || || ||
Sbjct: 333 gatgagggtatcaagctcctcatctccacggatggcaagctgaagatggcggggagtaat 274

                                 
Query: 330 acgcttcaccttcagatccttg 351
           |||||| |||||||| ||||||
Sbjct: 273 acgcttgaccttcaggtccttg 252



to top

>emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 12
          Length = 199759

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                          
Query: 223    gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
              |||| ||||||||| |||||||||||||| ||| |||| || || |||||||| ||||||
Sbjct: 105846 gactagtggatgtgagggatcacacctcctccaacaattgttcctttgatgagtgtgtca 105905

                            
Query: 283    agctcctcgtctcc 296
              |||||||| |||||
Sbjct: 105906 agctcctcatctcc 105919



to top

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                          
Query: 298    cggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcg 357
              ||||||||||||||||| || || || |||||||| || ||||||||||||||    |||
Sbjct: 330667 cggatggccagctgcagatggcgcggcgtgatacgtttgaccttcagatcctttgcggcg 330726

                                                    
Query: 358    ttcccagccagctccagaacctcggccgtcaggtactc 395
              || || ||||||||||| |||||||| ||||| |||||
Sbjct: 330727 tttcccgccagctccagcacctcggctgtcagatactc 330764



to top

>ref|NM_208740.1| Eremothecium gossypii ACL017Cp (ACL017C), mRNA
          Length = 402

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 298 cggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcg 357
           ||||||||||||||||| || || || |||||||| || ||||||||||||||    |||
Sbjct: 290 cggatggccagctgcagatggcgcggcgtgatacgtttgaccttcagatcctttgcggcg 231

                                                 
Query: 358 ttcccagccagctccagaacctcggccgtcaggtactc 395
           || || ||||||||||| |||||||| ||||| |||||
Sbjct: 230 tttcccgccagctccagcacctcggctgtcagatactc 193



to top

>gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chromosome IV at 19.3 cM,
            complete sequence
          Length = 99384

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                        
Query: 223  gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
            |||| ||||||||| |||||||||||||| ||| |||| || || |||||||| ||||||
Sbjct: 5500 gactagtggatgtgagggatcacacctcctccaacaattgttcctttgatgagtgtgtca 5559

                          
Query: 283  agctcctcgtctcc 296
            |||||||| |||||
Sbjct: 5560 agctcctcatctcc 5573



to top

>ref|XM_743054.1| Aspergillus fumigatus Af293 histone H2A (Afu5g01950) partial mRNA
          Length = 417

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 283 agctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttc 342
           ||||||||||| ||||| ||||| ||||||||||| || || ||||||||||| || |||
Sbjct: 308 agctcctcgtcaccacgaatggcgagctgcaggtggcggggcgtgatacgcttgactttc 249

                    
Query: 343 agatccttg 351
           |||||||||
Sbjct: 248 agatccttg 240



to top

>emb|AL672076.10| Mouse DNA sequence from clone RP23-161N17 on chromosome 4, complete
              sequence
          Length = 208396

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                          
Query: 226    ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
              ||||||||||||||||| ||||| ||||||||||||||  | ||||| || |  || |  
Sbjct: 176958 ttgtggatgtgtgggatgacaccaccaccagcaatggtagctttgatcagagaatccaat 176899

                                                              
Query: 286    tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgc 333
              || || |||||||| || || ||||||| |||||||||||||||||||
Sbjct: 176898 tcttcatctccacgtatagcaagctgcaagtgacgaggggtgatacgc 176851



to top

>ref|XM_676216.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8039.2), mRNA
          Length = 411

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgctt 335
           ||||| ||||| ||||||||||||||||| ||||| |||||||| || |||||||||||
Sbjct: 314 gtgtcgagctcttcgtctccacggatggcaagctgtaggtgacgcggcgtgatacgctt 256



to top

>ref|NM_201517.1| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 5, mRNA
          Length = 1039

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 131/163 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||| ||||||||||| || ||||| |||||  ||||||| || 
Sbjct: 381 atcagagatttgtggatgtgagggatcacaccacccccagctatggtagccttgataaga 322

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| |||||| || ||||||||||| 
Sbjct: 321 gaatccaactcttcatcaccacggattgcaagctgcaagtgacgcggagtgatacgcttt 262

                                                      
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacct 379
           || || ||||||||   ||| || || ||||||||||| ||||
Sbjct: 261 actttgagatccttagaagcattacctgccagctccagcacct 219



to top

>ref|XM_850699.1| PREDICTED: Canis familiaris similar to H2A histone family, member V
           isoform 5, transcript variant 3 (LOC475501), mRNA
          Length = 620

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 131/163 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| ||||||||||| || ||||| |||||  |||||||||| 
Sbjct: 294 atcagagacttgtggatgtgcgggatcacaccacccccagcgatggtagccttgatgaga 235

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || || || ||||| || ||||||| ||| || || ||||| ||||| 
Sbjct: 234 gaatccaattcttcatcaccgcggattgcaagctgcaagtggcgcggagtgatccgcttt 175

                                                      
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacct 379
           ||||| || ||||||  |||||| || ||||||||||| ||||
Sbjct: 174 accttgaggtccttggaagcgttacctgccagctccagcacct 132



to top

>gb|AY074805.1| Ovis aries histone H2A.Z mRNA, complete cds
          Length = 862

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 460 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 401

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || ||||  ||||||||||| |||||||| 
Sbjct: 400 gagtccaattcttcatctccacgaatagcaagttgcaaatgacgaggggtaatacgcttt 341

                  
Query: 337 accttca 343
           |||||||
Sbjct: 340 accttca 334



to top

>gb|AF414111.1|AF414111 Danio rerio histone variant H2A.F/Z gene, complete cds
          Length = 5754

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 246  acctccaccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggc 305
            |||||| |||||||| ||| ||||||| ||||  || |||||||| ||||| || |||||
Sbjct: 4123 acctcctccagcaatagtggccttgataagggaatcgagctcctcatctcctcgaatggc 4064

                                                   
Query: 306  cagctgcaggtgacgaggggtgatacgcttcaccttcag 344
            |||||| |  || ||||| ||||| ||||||||||||||
Sbjct: 4063 cagctgtaaatgtcgaggagtgatgcgcttcaccttcag 4025



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 217  atcagggacttgtggatgtgtgggatcacacct 249
            ||||| ||||||||||||||||| |||||||||
Sbjct: 5702 atcagagacttgtggatgtgtggaatcacacct 5670



to top

>emb|BX322550.7| Zebrafish DNA sequence from clone DKEY-202N14 in linkage group 5,
             complete sequence
          Length = 184426

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                         
Query: 246   acctccaccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggc 305
             |||||| |||||||| ||| ||||||| ||||  || |||||||| ||||| || |||||
Sbjct: 18799 acctcctccagcaatagtggccttgataagggaatcgagctcctcatctcctcgaatggc 18740

                                                    
Query: 306   cagctgcaggtgacgaggggtgatacgcttcaccttcag 344
             |||||| |  || ||||| ||||| ||||||||||||||
Sbjct: 18739 cagctgtaaatgtcgaggagtgatgcgcttcaccttcag 18701



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 217   atcagggacttgtggatgtgtgggatcacacct 249
             ||||| ||||||||||||||||| |||||||||
Sbjct: 20375 atcagagacttgtggatgtgtggaatcacacct 20343



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                   
Query: 498      cccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctc 548
                |||||||||||| |||||||| | |||||||||||||||||| ||||||||
Sbjct: 13947327 cccggcgcgggatgagcgggatacgggggccttcttccccttttccttctc 13947377



to top

>emb|BX821662.1|CNS0A98O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL62ZC09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 694

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 211 ttgttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttg 270
           |||||||  ||||||||||||||||  |||||||||||||| || |||||||| || |||
Sbjct: 520 ttgttgacaagggacttgtggatgttagggatcacacctcctcctgcaatggttcctttg 461

                                                      
Query: 271 atgagggtgtcaagctcctcgtctccacggatggccagctgca 313
           ||||| || | ||| ||||| ||||| | ||| || |||||||
Sbjct: 460 atgagagttttaagttcctcatctcctctgattgcaagctgca 418



to top

>ref|NM_001009270.1| Ovis aries histone H2A.Z (LOC443235), mRNA
          Length = 862

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 460 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 401

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           | ||| |  || || |||||||| || || || ||||  ||||||||||| |||||||| 
Sbjct: 400 gagtccaattcttcatctccacgaatagcaagttgcaaatgacgaggggtaatacgcttt 341

                  
Query: 337 accttca 343
           |||||||
Sbjct: 340 accttca 334



to top

>dbj|AP005770.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0065F08
          Length = 144091

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                 
Query: 498    cccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctc 548
              |||||||||||| |||||||| | |||||||||||||||||| ||||||||
Sbjct: 119225 cccggcgcgggatgagcgggatacgggggccttcttccccttttccttctc 119275



to top

>dbj|AP004180.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1126_B05
          Length = 117057

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                                
Query: 498   cccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctc 548
             |||||||||||| |||||||| | |||||||||||||||||| ||||||||
Sbjct: 16965 cccggcgcgggatgagcgggatacgggggccttcttccccttttccttctc 17015



to top

>dbj|AK102414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093B11, full
           insert sequence
          Length = 1760

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 498 cccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctc 548
           |||||||||||| |||||||| | |||||||||||||||||| ||||||||
Sbjct: 562 cccggcgcgggatgagcgggatacgggggccttcttccccttttccttctc 512



to top

>dbj|AK060832.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C06, full
           insert sequence
          Length = 1526

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 498 cccggcgcgggacgagcgggagatgggggccttcttccccttgtccttctc 548
           |||||||||||| |||||||| | |||||||||||||||||| ||||||||
Sbjct: 400 cccggcgcgggatgagcgggatacgggggccttcttccccttttccttctc 350



to top

>emb|AL954191.5| Zebrafish DNA sequence from clone CH211-230G14, complete sequence
          Length = 151595

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                         
Query: 246   acctccaccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggc 305
             |||||| |||||||| ||| ||||||| ||||  || |||||||| ||||| || |||||
Sbjct: 10157 acctcctccagcaatagtggccttgataagggaatcgagctcctcatctcctcgaatggc 10216

                                                    
Query: 306   cagctgcaggtgacgaggggtgatacgcttcaccttcag 344
             |||||| |  || ||||| ||||| ||||||||||||||
Sbjct: 10217 cagctgtaaatgtcgaggagtgatgcgcttcaccttcag 10255



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 217  atcagggacttgtggatgtgtgggatcacacct 249
            ||||| ||||||||||||||||| |||||||||
Sbjct: 8607 atcagagacttgtggatgtgtggaatcacacct 8639



to top

>ref|XM_517363.1| PREDICTED: Pan troglodytes similar to H2A histone family, member Z
           (LOC461400), mRNA
          Length = 633

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 453 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 394

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 393 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 334

                
Query: 337 acctt 341
           |||||
Sbjct: 333 acctt 329



to top

>ref|NM_002106.3| Homo sapiens H2A histone family, member Z (H2AFZ), mRNA
          Length = 951

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 541 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 482

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 481 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 422

                
Query: 337 acctt 341
           |||||
Sbjct: 421 acctt 417



to top

>gb|BC103743.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:117173 IMAGE:6175124), complete cds
          Length = 1024

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 576 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 517

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 516 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 457

                
Query: 337 acctt 341
           |||||
Sbjct: 456 acctt 452



to top

>gb|AY597416.1| Homo sapiens chromosome 13 carcinoma associated antigen CRC-L-9
           mRNA sequence
          Length = 726

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 478 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 419

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 418 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 359

                
Query: 337 acctt 341
           |||||
Sbjct: 358 acctt 354



to top

>ref|XM_567962.1| Cryptococcus neoformans var. neoformans JEC21 histone h2a variant
           (CNL04080) partial mRNA
          Length = 544

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 280 tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcacc 339
           |||||||| ||||||||||||||||| || |||||||| ||||| || ||||| ||||| 
Sbjct: 308 tcaagctcttcgtctccacggatggcaagttgcaggtgtcgaggagtaatacgtttcacg 249

                                                                
Query: 340 ttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggta 392
              || || |||  |||||| || || ||||| ||||||||||| ||||||||
Sbjct: 248 cggaggtctttggcagcgttaccggcgagctcaagaacctcggcagtcaggta 196



to top

>emb|CR858439.1| Pongo pygmaeus mRNA; cDNA DKFZp468O2423 (from clone DKFZp468O2423)
          Length = 881

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 462 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 403

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 402 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 343

                
Query: 337 acctt 341
           |||||
Sbjct: 342 acctt 338



to top

>emb|CR616797.1| full-length cDNA clone CS0DI067YA11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 847

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 439 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 380

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 379 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 320

                
Query: 337 acctt 341
           |||||
Sbjct: 319 acctt 315



to top

>emb|CR611014.1| full-length cDNA clone CS0DJ002YA13 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1254

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 881 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 822

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 821 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 762

                
Query: 337 acctt 341
           |||||
Sbjct: 761 acctt 757



to top

>emb|CR599577.1| full-length cDNA clone CS0DI079YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 843

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 438 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 379

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 378 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 319

                
Query: 337 acctt 341
           |||||
Sbjct: 318 acctt 314



to top

>emb|CR457415.1| Homo sapiens full open reading frame cDNA clone RZPDo834H1010D for
           gene H2AFZ, H2A histone family, member Z; complete cds,
           incl. stopcodon
          Length = 387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 356 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 297

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 296 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 237

                
Query: 337 acctt 341
           |||||
Sbjct: 236 acctt 232



to top

>gb|BC020936.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:24740 IMAGE:4281642), complete cds
          Length = 896

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 461 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 402

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 401 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 342

                
Query: 337 acctt 341
           |||||
Sbjct: 341 acctt 337



to top

>gb|BC018002.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:24682 IMAGE:4271353), complete cds
          Length = 892

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 461 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 402

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 401 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 342

                
Query: 337 acctt 341
           |||||
Sbjct: 341 acctt 337



to top

>emb|X52317.1|HSH2AZ Human mRNA for histone H2A.Z
          Length = 869

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 462 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 403

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 402 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 343

                
Query: 337 acctt 341
           |||||
Sbjct: 342 acctt 338



to top

>gb|M37583.1|HUMHIS2AZ Human histone (H2A.Z) mRNA, complete cds
          Length = 873

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  |||||||||| 
Sbjct: 462 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgaga 403

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || || |||| |||||||||||| |||||||| 
Sbjct: 402 gaatccaattcttcatctccacgaatagcaagttgcaagtgacgaggggtaatacgcttt 343

                
Query: 337 acctt 341
           |||||
Sbjct: 342 acctt 338



to top

>ref|XM_978028.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 1 (LOC669445), mRNA
          Length = 839

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||| || ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 399 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggt 352



to top

>ref|XM_001000460.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 1 (LOC666634), mRNA
          Length = 838

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||| || ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 399 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggt 352



to top

>ref|XM_001002995.1| PREDICTED: Mus musculus H2A histone family, member Z, transcript
           variant 3 (H2afz), mRNA
          Length = 838

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||| || ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 399 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggt 352



to top

>ref|XM_985882.1| PREDICTED: Mus musculus similar to H2A histone family, member Z
           (LOC675899), mRNA
          Length = 1282

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||| || ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 777 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggt 730



to top

>gb|AF483074.1| Boltenia villosa histone 2A Z variant (h2az) mRNA, complete cds
          Length = 750

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
           ||||||||||||||||| |||||||| ||||| || ||  |||||||||| |  || |||
Sbjct: 416 ttgtggatgtgtgggatgacacctcctccagctattgtagccttgatgagagaatccagc 357

                                                                       
Query: 286 tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcaga 345
           ||||| ||||| | ||| || || ||||  || || |||||||| | ||| || |||| |
Sbjct: 356 tcctcatctcctctgattgcaagttgcaaatgccggggggtgattctctttactttcaaa 297

                               
Query: 346 tccttgctagcgttcccagc 365
           ||||||||||| || |||||
Sbjct: 296 tccttgctagcattgccagc 277



to top

>emb|BX008098.1|CNS08EEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                       
Query: 278 tgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttca 337
           |||| ||||||||||| || || |||||||||||||| || |  || ||||| || ||||
Sbjct: 342 tgtccagctcctcgtcaccgcgaatggccagctgcagatgcctgggcgtgattcgtttca 283

                                                                       
Query: 338 ccttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcga 397
           | || ||||||||    ||||| || |||| |||||| ||||| |||||||||||||| |
Sbjct: 282 ctttgagatccttcgaggcgttgccggccaactccagcacctcagccgtcaggtactcca 223

               
Query: 398 ggat 401
           ||||
Sbjct: 222 ggat 219



to top

>dbj|AK151462.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030H04 product:H2A histone
           family, member Z, full insert sequence
          Length = 793

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 216 gatcagggacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||| || ||||||||||||||||| ||||| ||||||||||||||
Sbjct: 392 gatcagcgatttgtggatgtgtgggatgacaccaccaccagcaatggt 345



to top

>ref|NM_001031374.1| Gallus gallus H2A histone family, member V (H2AFV), mRNA
          Length = 920

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Minus

                                                                       
Query: 226 ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
           |||||||| ||||| || ||||| ||||||||||| ||  |||| ||||| | ||| |  
Sbjct: 507 ttgtggatatgtggtattacaccaccaccagcaattgttgccttaatgagcgagtccaat 448

                                                                       
Query: 286 tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcaga 345
           || || ||||| |  || || ||||||| |||||| || |||||||||||||||||||  
Sbjct: 447 tcttcatctcctctaattgcaagctgcaagtgacggggagtgatacgcttcaccttcaag 388

                                                                       
Query: 346 tccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggatagca 405
           || |||   || || || |||||||| |||||||| || |||| |||||| ||||| |||
Sbjct: 387 tctttggatgcatttcctgccagctcaagaacctcagctgtcaagtactccaggatggca 328

              
Query: 406 gca 408
           |||
Sbjct: 327 gca 325



to top

>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete
              sequence
          Length = 906719

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                         
Query: 280    tcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcac 338
              |||||||| ||||||||||||||||| || |||||||| ||||| || ||||| |||||
Sbjct: 112885 tcaagctcttcgtctccacggatggcaagttgcaggtgtcgaggagtaatacgtttcac 112827



to top

>gb|AC130809.25| Medicago truncatula clone mth2-15i12, complete sequence
          Length = 114664

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 214   ttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatg 273
             ||||||| ||||||||| ||||  || || ||||| ||||||||||| || |||||||| 
Sbjct: 47570 ttgatcaaggacttgtgaatgttaggaatgacaccaccaccagcaatcgttcccttgata 47629

                                    
Query: 274   agggtgtcaagctcctcgtctcc 296
             ||||| ||||| ||||| |||||
Sbjct: 47630 agggtatcaagttcctcatctcc 47652



to top

>gb|AC151823.11| Medicago truncatula clone mth2-45h2, complete sequence
          Length = 125855

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 214   ttgatcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatg 273
             ||||||| ||||||||| ||||  || || ||||| ||||||||||| || |||||||| 
Sbjct: 94509 ttgatcaaggacttgtgaatgttaggaatgacaccaccaccagcaatcgttcccttgata 94450

                                    
Query: 274   agggtgtcaagctcctcgtctcc 296
             ||||| ||||| ||||| |||||
Sbjct: 94449 agggtatcaagttcctcatctcc 94427



to top

>emb|AJ719448.1| Gallus gallus mRNA for hypothetical protein, clone 2h11
          Length = 920

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Minus

                                                                       
Query: 226 ttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtcaagc 285
           |||||||| ||||| || ||||| ||||||||||| ||  |||| ||||| | ||| |  
Sbjct: 507 ttgtggatatgtggtattacaccaccaccagcaattgttgccttaatgagcgagtccaat 448

                                                                       
Query: 286 tcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcaga 345
           || || ||||| |  || || ||||||| |||||| || |||||||||||||||||||  
Sbjct: 447 tcttcatctcctctaattgcaagctgcaagtgacggggagtgatacgcttcaccttcaag 388

                                                                       
Query: 346 tccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcgaggatagca 405
           || |||   || || || |||||||| |||||||| || |||| |||||| ||||| |||
Sbjct: 387 tctttggatgcatttcctgccagctcaagaacctcagctgtcaagtactccaggatggca 328

              
Query: 406 gca 408
           |||
Sbjct: 327 gca 325



to top

>ref|NM_138635.2| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 2, mRNA
          Length = 825

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Minus

                                                                       
Query: 295 ccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgcta 354
           |||||||| || ||||||| |||||| || ||||||||||| || || ||||||||   |
Sbjct: 417 ccacggattgcaagctgcaagtgacgcggagtgatacgctttactttgagatccttagaa 358

                                                                 
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactcgaggatagcagca 408
           || || || ||||||||||| ||||| || || |||||||| || || ||||||
Sbjct: 357 gcattacctgccagctccagcacctctgcagtgaggtactccagaatcgcagca 304



to top

>gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosome 3, complete sequence
          Length = 173758

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 292    tctccacggatggccagctgcaggtgacgaggggtgatacgcttcacctt 341
              |||||||| || || ||||||| ||||||||||||||||||||| |||||
Sbjct: 150331 tctccacgtatagcaagctgcaagtgacgaggggtgatacgctttacctt 150380



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 216    gatcagggacttgtggatgtgtgggatcacacct 249
              |||||| || ||||||||||||||||| ||||||
Sbjct: 150010 gatcagcgatttgtggatgtgtgggatgacacct 150043



to top

>gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome 3, complete sequence
          Length = 186277

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 292    tctccacggatggccagctgcaggtgacgaggggtgatacgcttcacctt 341
              |||||||| || || ||||||| ||||||||||||||||||||| |||||
Sbjct: 181432 tctccacgtatagcaagctgcaagtgacgaggggtgatacgctttacctt 181383



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 216    gatcagggacttgtggatgtgtgggatcacacct 249
              |||||| || ||||||||||||||||| ||||||
Sbjct: 181753 gatcagcgatttgtggatgtgtgggatgacacct 181720



to top

>dbj|AK023973.1| Homo sapiens cDNA FLJ13911 fis, clone Y79AA1000214, weakly similar
           to Homo sapiens histone H2A.F/Z variant (H2AV) mRNA
          Length = 3383

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Minus

                                                                       
Query: 295 ccacggatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgcta 354
           |||||||| || ||||||| |||||| || ||||||||||| || || ||||||||   |
Sbjct: 384 ccacggattgcaagctgcaagtgacgcggagtgatacgctttactttgagatccttagaa 325

                                                                 
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactcgaggatagcagca 408
           || || || ||||||||||| ||||| || || |||||||| || || ||||||
Sbjct: 324 gcattacctgccagctccagcacctctgcagtgaggtactccagaatcgcagca 271



to top

>gb|BC077029.1| Xenopus tropicalis MGC89861 protein, mRNA (cDNA clone MGC:89861
           IMAGE:7029021), complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgtt 359
           |||||| ||||||| |||||| ||| |||||||||||||||| ||||| |||  ||| ||
Sbjct: 343 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatctttggaagcatt 284

                                
Query: 360 cccagccagctccagaacctc 380
            |||||||  || ||||||||
Sbjct: 283 tccagccaattcaagaacctc 263



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||||| |||||||| || || || ||||||||||||||
Sbjct: 420 gacttgtgtatgtgtggaatgactccaccaccagcaatggt 380



to top

>gb|AY814205.1| Schistosoma japonicum SJCHGC05820 protein mRNA, complete cds
          Length = 610

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 146/185 (78%)
 Strand = Plus / Minus

                                                                       
Query: 250 ccaccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagc 309
           ||||| ||||||||  ||||||| || || ||||| || || || ||||| || || |||
Sbjct: 326 ccacccgcaatggttgccttgattagtgtatcaagttcttcatccccacgaatagctagc 267

                                                                       
Query: 310 tgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgttcccagccagc 369
           || || || ||||| || ||||| || || ||||  || || || ||||||||||| |  
Sbjct: 266 tgaagatgtcgaggtgttatacgtttgactttcaagtctttactggcgttcccagctaat 207

                                                                       
Query: 370 tccagaacctcggccgtcaggtactcgaggatagcagcagagtagaccgccgcagtagca 429
           |||||||| ||||| ||||| || || ||||| || || |||||||| || |||||||||
Sbjct: 206 tccagaacttcggcagtcagatattccaggattgccgccgagtagactgcggcagtagca 147

                
Query: 430 ccaac 434
           |||||
Sbjct: 146 ccaac 142



to top

>ref|XR_003857.1| PREDICTED: Mus musculus hypothetical LOC631864 (LOC631864), mRNA
          Length = 988

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| || ||||||||||||||||| ||||  ||||||||||||||  | ||||| || 
Sbjct: 465 atcagcgatttgtggatgtgtgggatgacacaaccaccagcaatggtagctttgatcaga 406

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || |  || || |||||||| || || ||||||| |||||||||||| |||| ||| 
Sbjct: 405 gaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtaatacacttt 346

                
Query: 337 acctt 341
           |||||
Sbjct: 345 acctt 341



to top

>gb|AY147422.1| Drosophila rufa isolate YY001328 histone H2A gene, partial cds;
           H2A/H2B intergenic spacer region, complete sequence; and
           histone H2B gene, partial cds
          Length = 486

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 467 gacgatggatacggccaacagggaactggagcccggc 503
           |||||||||||||||| |||||||||||||| |||||
Sbjct: 36  gacgatggatacggccgacagggaactggagtccggc 72



to top

>emb|CT025399.2| Xenopus tropicalis finished cDNA, clone TGas068j09
          Length = 4117

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgtt 359
            |||||| ||||||| |||||| ||| |||||||||||||||| ||||| |||  ||| ||
Sbjct: 3708 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatctttggaagcatt 3649

                                 
Query: 360  cccagccagctccagaacctc 380
             |||||||  || ||||||||
Sbjct: 3648 tccagccaattcaagaacctc 3628



to top

>gb|AC055772.16| Mus musculus chromosome 12, clone RP23-291K4, complete sequence
          Length = 168350

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                          
Query: 217    atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
              ||||| || ||||||||||||||||| ||||  ||||||||||||||  | ||||| || 
Sbjct: 111472 atcagcgatttgtggatgtgtgggatgacacaaccaccagcaatggtagctttgatcaga 111413

                                                                          
Query: 277    gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
              |  || |  || || |||||||| || || ||||||| |||||||||||| |||| ||| 
Sbjct: 111412 gaatccaattcttcatctccacgtatagcaagctgcaagtgacgaggggtaatacacttt 111353

                   
Query: 337    acctt 341
              |||||
Sbjct: 111352 acctt 111348



to top

>ref|NM_001005097.1| Xenopus tropicalis MGC89861 protein (MGC89861), mRNA
          Length = 881

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgtt 359
           |||||| ||||||| |||||| ||| |||||||||||||||| ||||| |||  ||| ||
Sbjct: 343 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatctttggaagcatt 284

                                
Query: 360 cccagccagctccagaacctc 380
            |||||||  || ||||||||
Sbjct: 283 tccagccaattcaagaacctc 263



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||||| |||||||| || || || ||||||||||||||
Sbjct: 420 gacttgtgtatgtgtggaatgactccaccaccagcaatggt 380



to top

>emb|CR761793.2| Xenopus tropicalis finished cDNA, clone TGas044m04
          Length = 841

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgtt 359
           |||||| ||||||| |||||| ||| |||||||||||||||| ||||| |||  ||| ||
Sbjct: 319 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatctttggaagcatt 260

                                
Query: 360 cccagccagctccagaacctc 380
            |||||||  || ||||||||
Sbjct: 259 tccagccaattcaagaacctc 239



to top

>emb|CR761734.2| Xenopus tropicalis finished cDNA, clone TGas104o01
          Length = 864

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatccttgctagcgtt 359
           |||||| ||||||| |||||| ||| |||||||||||||||| ||||| |||  ||| ||
Sbjct: 321 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatctttggaagcatt 262

                                
Query: 360 cccagccagctccagaacctc 380
            |||||||  || ||||||||
Sbjct: 261 tccagccaattcaagaacctc 241



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 223 gacttgtggatgtgtgggatcacacctccaccagcaatggt 263
           |||||||| |||||||| || || || ||||||||||||||
Sbjct: 398 gacttgtgtatgtgtggaatgactccaccaccagcaatggt 358



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| |||||||||||||||||||| || |||||||||||
Sbjct: 622 gcgttgccagccagctccagaacctcagcagtcaggtactc 662



to top

>ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC619178), mRNA
          Length = 487

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 289 cggatggccagctgcaggtgacgagggatgat 258



to top

>ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC541108), mRNA
          Length = 508

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 310 cggatggccagctgcaggtgacgagggatgat 279



to top

>ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616875), mRNA
          Length = 449

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 267 cggatggccagctgcaggtgacgagggatgat 236



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| || ||||||||||| | ||||||||||||||||||
Sbjct: 210 gcgttgcccgccagctccaggatctcggccgtcaggtactc 170



to top

>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC615056), mRNA
          Length = 1029

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 113 cggatggccagctgcaggtgacgagggatgat 82



to top

>ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC513666), mRNA
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 313 cggatggccagctgcaggtgacgagggatgat 282



to top

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 283 cggatggccagctgcaggtgacgagggatgat 252



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| || ||||||||||| | ||||||||||||||||||
Sbjct: 226 gcgttgcccgccagctccaggatctcggccgtcaggtactc 186



to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 298    cggatggccagctgcaggtgacgaggggtgat 329
              ||||||||||||||||||||||||||| ||||
Sbjct: 108678 cggatggccagctgcaggtgacgagggatgat 108709



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 355    gcgttcccagccagctccagaacctcggccgtcaggtactc 395
              ||||| || ||||||||||| | ||||||||||||||||||
Sbjct: 108735 gcgttgcccgccagctccaggatctcggccgtcaggtactc 108775



to top

>ref|NM_001038197.1| Bos taurus H2A histone family, member V (H2AFV), mRNA
          Length = 742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 151/192 (78%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || ||||| |||||  | ||||| || 
Sbjct: 420 atcagagacttgtggatgtgagggatcactccacccccagctatggtagctttgataaga 361

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| ||| || || ||||| ||||| 
Sbjct: 360 gaatccaactcttcatcaccacggattgcaagctgcaagtggcgtggagtgatccgctta 301

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || |||||||||   || || || ||||||||||| ||||| || || |||||||| 
Sbjct: 300 actttgagatccttggatgcattacctgccagctccagcacctcagcagtgaggtactcc 241

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 240 agaattgcagca 229



to top

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactcgag 398
           ||||| || ||||||||||| | |||||||||||||||||||||
Sbjct: 506 gcgttgcccgccagctccaggatctcggccgtcaggtactcgag 463



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 478 cggccaacagggaactggagcccggcgcgggacgagcg 515
           ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 386 cggcccacggggaactggaggccggcgcgcgacgagcg 349



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cggatggccagctgcaggtg 317
           ||||||||||||||||||||
Sbjct: 563 cggatggccagctgcaggtg 544



to top

>emb|AJ306721.1|PPI306721 Pinus pinaster mRNA for putative histone H2A
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 321 aggggtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaacctc 380
           ||||||||||||||| ||||||||||| ||||| || || || |||| ||||| ||||||
Sbjct: 372 aggggtgatacgcttgaccttcagatctttgcttgcatttcctgccaactccaaaacctc 313



to top

>gb|BC109673.1| Bos taurus cDNA clone MGC:133654 IMAGE:8054570, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 151/192 (78%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || ||||| |||||  | ||||| || 
Sbjct: 459 atcagagacttgtggatgtgagggatcactccacccccagctatggtagctttgataaga 400

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || |||||||| || ||||||| ||| || || ||||| ||||| 
Sbjct: 399 gaatccaactcttcatcaccacggattgcaagctgcaagtggcgtggagtgatccgctta 340

                                                                       
Query: 337 accttcagatccttgctagcgttcccagccagctccagaacctcggccgtcaggtactcg 396
           || || |||||||||   || || || ||||||||||| ||||| || || |||||||| 
Sbjct: 339 actttgagatccttggatgcattacctgccagctccagcacctcagcagtgaggtactcc 280

                       
Query: 397 aggatagcagca 408
           || || ||||||
Sbjct: 279 agaattgcagca 268



to top

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 283 cggatggccagctgcaggtgacgagggatgat 252



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| || ||||||||||| | ||||||||||||||||||
Sbjct: 226 gcgttgcccgccagctccaggatctcggccgtcaggtactc 186



to top

>gb|L17501.1|MIRHIS2AF3 Mirounga leonina histone H2AF gene, exon 4 (3' end)
          Length = 338

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 250 ccaccagcaatggtgcccttgatgagggtgtcaagctcctcgtctccacggatggccagc 309
           ||||||||||||||  |||||||||| | ||| |  || || |||||||| || || || 
Sbjct: 92  ccaccagcaatggtagccttgatgagagagtccaattcttcatctccacgaatagcaagt 33

                                           
Query: 310 tgcaggtgacgaggggtgatacgcttcacctt 341
           |||| |||||||||||| |||||||| |||||
Sbjct: 32  tgcaagtgacgaggggtaatacgctttacctt 1



to top

>gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete sequence
          Length = 115925

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 300   gatggccagctgcaggtgacgaggggtgatacgcttcaccttcagatc 347
             |||||| ||||||| |||||| ||| |||||||||||||||| |||||
Sbjct: 38852 gatggcaagctgcaagtgacgtgggctgatacgcttcaccttaagatc 38899



to top

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 298 cggatggccagctgcaggtgacgaggggtgat 329
           ||||||||||||||||||||||||||| ||||
Sbjct: 340 cggatggccagctgcaggtgacgagggatgat 309



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 355 gcgttcccagccagctccagaacctcggccgtcaggtactc 395
           ||||| || ||||||||||| | ||||||||||||||||||
Sbjct: 283 gcgttgcccgccagctccaggatctcggccgtcaggtactc 243



to top

>ref|XM_509711.1| PREDICTED: Pan troglodytes similar to H2A histone family, member Z
           (LOC452636), mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
           ||||| || |||||||||||||| || ||||| ||||||||||| ||  ||||||||||
Sbjct: 356 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgag 298



to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 354 agcgttcccagccagctccagaacctcggccgtcaggtactcgagga 400
           |||||| || ||||||||||| |||||||| | ||||||||||||||
Sbjct: 342 agcgttgccggccagctccagcacctcggcggccaggtactcgagga 296



to top

>ref|XM_430420.1| PREDICTED: Gallus gallus hypothetical gene supported by V00414
           (LOC426617), partial mRNA
          Length = 515

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 325 gtgatacgcttcaccttcagatccttgctagcgttcccagccagctccagaacctcggcc 384
           ||||| |||||||||||||| ||||||   ||||| || |||| |||||| ||||| || 
Sbjct: 501 gtgatgcgcttcaccttcaggtccttggaggcgttgcctgccaactccaggacctcagca 442

                                  
Query: 385 gtcaggtactcgaggatagcagc 407
           || || ||||||||||| |||||
Sbjct: 441 gtgagatactcgaggatggcagc 419



to top

>ref|XM_989419.1| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 964

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 581 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 522

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 521 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 462

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 461 actttgagatc 451



to top

>ref|XM_907680.2| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 1633

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 456 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 397

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 396 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 337

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 336 actttgagatc 326



to top

>ref|XM_126043.7| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 839

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 456 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 397

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 396 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 337

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 336 actttgagatc 326



to top

>emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on chromosome 13 Contains
             part of a novel gene (FLJ30001), a H2A histone family,
             pseudogene, the GPR18 gene for G protein-coupled receptor
             18, the EBI2 gene for Epstein-Barr virus induced gene 2
             (lymphocyte-specific G protein-coupled receptor), two
             novel genes and a CpG island, complete sequence
          Length = 149478

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 217   atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgag 275
             ||||| || |||||||||||||| || ||||| ||||||||||| ||  ||||||||||
Sbjct: 12745 atcagagatttgtggatgtgtggaatgacaccaccaccagcaattgtagccttgatgag 12803



to top

>emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 36
          Length = 199634

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                          
Query: 223    gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
              |||| ||||||||| |||||||||| ||| |||  ||| || || |||||||| ||||||
Sbjct: 172408 gactagtggatgtgagggatcacacttcctccaataattgttcctttgatgagtgtgtca 172349

                                             
Query: 283    agctcctcgtctccacggatggccagctgca 313
              ||||| || ||||| | ||| |||| |||||
Sbjct: 172348 agctcttcatctcctctgatcgccaactgca 172318



to top

>emb|AL049656.1|ATT6G15 Arabidopsis thaliana DNA chromosome 4, BAC clone  T6G15 (ESSA project)
          Length = 113970

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                         
Query: 223   gacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagggtgtca 282
             |||| ||||||||| |||||||||| ||| |||  ||| || || |||||||| ||||||
Sbjct: 70200 gactagtggatgtgagggatcacacttcctccaataattgttcctttgatgagtgtgtca 70141

                                            
Query: 283   agctcctcgtctccacggatggccagctgca 313
             ||||| || ||||| | ||| |||| |||||
Sbjct: 70140 agctcttcatctcctctgatcgccaactgca 70110



to top

>dbj|AK155105.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630201N14
           product:H2A histone family, member V, full insert
           sequence
          Length = 721

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 463 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 404

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 403 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 344

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 343 actttgagatc 333



to top

>dbj|AK168110.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730057M16 product:H2A histone family,
           member V, full insert sequence
          Length = 690

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 432 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 373

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 372 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 313

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 312 actttgagatc 302



to top

>dbj|AK021267.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530002L11 product:HISTONE H2A.F
           homolog [Homo sapiens], full insert sequence
          Length = 641

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 383 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 324

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 323 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 264

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 263 actttgagatc 253



to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 354 agcgttcccagccagctccagaacctcggccgtcaggtactcgagga 400
           |||||| || ||||||||||| |||||||| | ||||||||||||||
Sbjct: 342 agcgttgccggccagctccagcacctcggcggccaggtactcgagga 296



to top

>gb|BC028539.1| Mus musculus H2A histone family, member V, mRNA (cDNA clone
           IMAGE:3369668), complete cds
          Length = 535

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 105/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 atcagggacttgtggatgtgtgggatcacacctccaccagcaatggtgcccttgatgagg 276
           ||||| |||||||||||||| |||||||| || || || || |||||| ||||||| || 
Sbjct: 255 atcagagacttgtggatgtgcgggatcacgccgcccccggctatggtggccttgataaga 196

                                                                       
Query: 277 gtgtcaagctcctcgtctccacggatggccagctgcaggtgacgaggggtgatacgcttc 336
           |  || | ||| || || || ||||| || ||||| | |||||| |||||||| ||||||
Sbjct: 195 gaatccaactcttcatcaccgcggattgcaagctgtaagtgacgtggggtgatgcgcttc 136

                      
Query: 337 accttcagatc 347
           || || |||||
Sbjct: 135 actttgagatc 125


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,280,889
Number of Sequences: 3902068
Number of extensions: 4280889
Number of successful extensions: 83876
Number of sequences better than 10.0: 784
Number of HSP's better than 10.0 without gapping: 788
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81808
Number of HSP's gapped (non-prelim): 2003
length of query: 594
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 571
effective length of database: 17,143,297,704
effective search space: 9788822988984
effective search space used: 9788822988984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top