ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd20p06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY483155.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA6) mRNA, complete cds Length = 3745 Score = 918 bits (463), Expect = 0.0 Identities = 466/467 (99%) Strand = Plus / Minus Query: 43 tcacaatgtacactgcaggtttcgtagacagtggttctcagcggcatggggcgactaaca 102 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3606 tcacaatgtacgctgcaggtttcgtagacagtggttctcagcggcatggggcgactaaca 3547 Query: 103 aaggggcaataatttagataaaaatccttccgtcttcatctacaaccaaaaaatcccgtc 162 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3546 aaggggcaataatttagataaaaatccttccgtcttcatctacaaccaaaaaatcccgtc 3487 Query: 163 taaccccctccggtatttacactaggggggcagatactcccgagcgccgatgatccgatc 222 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3486 taaccccctccggtatttacactaggggggcagatactcccgagcgccgatgatccgatc 3427 Query: 223 agcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagggt 282 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3426 agcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagggt 3367 Query: 283 cgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacga 342 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3366 cgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacga 3307 Query: 343 tggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagga 402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3306 tggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagga 3247 Query: 403 tcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgt 462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3246 tcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgt 3187 Query: 463 tgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacg 509 ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3186 tgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacg 3140
>gb|DQ020207.1| Bambusa oldhamii cellulose synthase BoCesA1a mRNA, complete cds Length = 3547 Score = 371 bits (187), Expect = 2e-99 Identities = 259/283 (91%) Strand = Plus / Minus Query: 220 atcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaag 279 |||||||||| || ||||||||||||| ||| ||||| ||||||||| ||| ||||||| Sbjct: 3254 atcagcagttcacaccgcactgccccaaggcgacggctttctgggtaggggatatgaaag 3195 Query: 280 ggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatga 339 ||||||||||||||||||||||||||||||| || || |||||||| ||||||||||||| Sbjct: 3194 ggtcgatcttcacccagaggagggagaagattgacgcaaggaggatggaccaaacgatga 3135 Query: 340 cgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgga 399 | ||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||| Sbjct: 3134 caatggttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtagagatgga 3075 Query: 400 ggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgc 459 |||| |||||||||||||||||||||||||||||||| || ||||| ||||||||||| | Sbjct: 3074 ggataacccagattgagaagaagagctttccaaagagtggaccccaagattggtaaccac 3015 Query: 460 tgttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 |||| ||||| |||||||| ||||||||||||||||||||||| Sbjct: 3014 tgttaatggcatatgatattcctgccaccatgcccaccaggtt 2972 Score = 60.0 bits (30), Expect = 7e-06 Identities = 46/50 (92%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 135 tcttcatctacaaccaaaaaatcccgtctaaccccctccggtatttacac 184 |||||||||||||| |||||||||| || ||||||||| ||||||||||| Sbjct: 3351 tcttcatctacaac-aaaaaatcccatccaaccccctcaggtatttacac 3303
>gb|AC135426.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0617A08, complete sequence Length = 144781 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Plus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 128287 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 128346 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 128347 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 128406 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 128407 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 128466 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 128467 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 128526 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 128527 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 128575
>gb|AC144738.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0029B02, complete sequence Length = 156649 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Plus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 17130 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 17189 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 17190 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 17249 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 17250 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 17309 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 17310 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 17369 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 17370 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 17418
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Plus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 4506663 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 4506722 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 4506723 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 4506782 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 4506783 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 4506842 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 4506843 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 4506902 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 4506903 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 4506951
>dbj|AK102140.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033085K01, full insert sequence Length = 3768 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK100188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034D20, full insert sequence Length = 3897 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK099281.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023125F05, full insert sequence Length = 3801 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK099228.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091P03, full insert sequence Length = 3732 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK098978.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092B06, full insert sequence Length = 3764 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK067967.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013125H24, full insert sequence Length = 3802 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 3182 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3181 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 3133
>dbj|AK060079.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-C08, full insert sequence Length = 1097 Score = 351 bits (177), Expect = 1e-93 Identities = 261/289 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 672 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 613 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 612 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 553 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 552 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 493 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 492 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 433 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 432 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 384
>gb|DQ020208.1| Bambusa oldhamii cellulose synthase BoCesA1b mRNA, complete cds Length = 3453 Score = 345 bits (174), Expect = 9e-92 Identities = 258/286 (90%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||| ||||||| || ||||||||||||| ||||||||| ||||| ||| ||| |||| Sbjct: 3414 ccgattagcagttcacaccgcactgccccaaggcaacggctttctgagtaggggatatga 3355 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 ||||||||||||||||||| || ||||||||||| || ||||||||||| |||||||| | Sbjct: 3354 aagggtcgatcttcacccacagcagggagaagattgacgcgaggaggatggaccaaacaa 3295 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 |||| ||||| ||||||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3294 tgacaatggttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3235 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||||||||||||||||||||| || || || ||||| |||||||||| Sbjct: 3234 ggaggatcacccagattgagaagaagagctttccgaaaagtggaccccaagattggtaac 3175 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 | ||||| ||||| |||||||| ||||||||||||||||||||||| Sbjct: 3174 cactgttaatggcatatgatattcctgccaccatgcccaccaggtt 3129
>dbj|AK060838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-D02, full insert sequence Length = 1426 Score = 343 bits (173), Expect = 3e-91 Identities = 260/289 (89%) Strand = Plus / Minus Query: 217 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 276 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 1098 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 1039 Query: 277 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 336 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 1038 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 979 Query: 337 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 396 ||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 978 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagac 919 Query: 397 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 456 |||||||||||||||| ||||||||||||||||||||||| || ||||| |||||||||| Sbjct: 918 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaac 859 Query: 457 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 ||||||| ||||| |||||||| || ||||||||||||||||||||||| Sbjct: 858 cgctgttaatggcatatgatatacccgccaccatgcccaccaggttgat 810
>gb|AF200526.1|AF200526 Zea mays cellulose synthase-2 (CesA-2) mRNA, complete cds Length = 3725 Score = 274 bits (138), Expect = 3e-70 Identities = 207/230 (90%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 |||||||| |||||||||||||| || | ||||||||| || || |||||||| |||||| Sbjct: 3351 atgaaaggatcgatcttcacccacagcaaggagaagatagacgcaaggaggatggaccaa 3292 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 ||||||||||| || ||||||||||||||| | ||||||||||||||||||||||||||| Sbjct: 3291 acgatgacgattgttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtag 3232 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 |||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||| Sbjct: 3231 agatggaggatcacccagatcgagaagaacagctttccaaagagcggaccccaggattgg 3172 Query: 453 taaccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 || |||||||| ||||| || || || ||||||||||| || |||||||| Sbjct: 3171 tagccgctgttaatggcatacgaaattcctgccaccattccgaccaggtt 3122 Score = 60.0 bits (30), Expect = 7e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 138 tcatctacaaccaaaaaatcccgtctaaccccctccggtatttacactaggggg 191 ||||||||||| ||||| |||| |||| ||||||| ||||||||||| |||||| Sbjct: 3501 tcatctacaacaaaaaattcccatctagccccctcaggtatttacacgaggggg 3448
>gb|AF200525.1|AF200525 Zea mays cellulose synthase-1 (CesA-1) mRNA, complete cds Length = 3752 Score = 256 bits (129), Expect = 6e-65 Identities = 246/285 (86%) Strand = Plus / Minus Query: 218 cgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaa 277 |||||||||||||||||| || ||||||| |||| | || ||||| || ||| ||||| Sbjct: 3413 cgatcagcagttgacgccacattgccccaaggcagcagctttctgtgtcggggagatgaa 3354 Query: 278 agggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgat 337 ||| |||||||||||||| || | ||||||||| || || || ||||| ||||| || || Sbjct: 3353 aggatcgatcttcacccacagcaaggagaagatagatgcaagaaggatggaccagacaat 3294 Query: 338 gacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatg 397 |||||| || || |||||||||||| | |||||||||||||||||||||||||||||||| Sbjct: 3293 gacgattgttggtgtgcggttctgccttcccatgagacccttgaggaaggggtagagatg 3234 Query: 398 gaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacc 457 ||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||| || Sbjct: 3233 gaggatcacccagatcgagaagaacagctttccaaagagcggaccccaggattggtagcc 3174 Query: 458 gctgttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 ||||| ||||| || || || ||||||||||| || |||||||| Sbjct: 3173 actgttaatggcataagaaattcctgccaccattccgaccaggtt 3129
>gb|DQ020210.1| Bambusa oldhamii cellulose synthase BoCesA3a mRNA, complete cds Length = 3571 Score = 250 bits (126), Expect = 4e-63 Identities = 243/282 (86%) Strand = Plus / Minus Query: 221 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 280 ||||||||| || ||||||||||||| || ||||| ||||||||| || |||||||| Sbjct: 3304 tcagcagtttacaccgcactgccccagggtgacggctttctgggtaggagatatgaaagg 3245 Query: 281 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 340 |||||||||||||| || || ||||||||||| || |||||||| |||||||| ||||| Sbjct: 3244 atcgatcttcacccacagcagtgagaagatggaagcaaggaggatggaccaaacaatgac 3185 Query: 341 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 400 ||||| || ||||||||||| |||||||||||||||| ||||| ||||| |||||||| Sbjct: 3184 aatggttggagtgcggttctgtctccccatgagaccctttaggaaagggtaaagatggag 3125 Query: 401 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgct 460 ||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||| || Sbjct: 3124 gatcacccagattgagaagaaaagcttaccgaaaagcggaccccaggattggtaaccact 3065 Query: 461 gttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 ||| || ||||| |||| |||||||| || ||||||||||| Sbjct: 3064 gttaatagcgtacgatactcctgccactatacccaccaggtt 3023
>gb|DQ020209.1| Bambusa oldhamii cellulose synthase BoCesA2 mRNA, complete cds Length = 3648 Score = 242 bits (122), Expect = 9e-61 Identities = 242/282 (85%) Strand = Plus / Minus Query: 221 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 280 ||||||||| || ||||||||||||| |||||| || ||||||||| || |||||||| Sbjct: 3325 tcagcagtttacaccgcactgccccaaggcaacagctttctgggtaggagatatgaaagg 3266 Query: 281 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 340 |||||||||||||| || | ||||||||||| || |||||||| |||||||| ||||| Sbjct: 3265 atcgatcttcacccacagcaacgagaagatggaagcaaggaggatggaccaaacaatgac 3206 Query: 341 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 400 || ||||| ||||||||||| ||||||||||||||||| ||||| ||||| |||||||| Sbjct: 3205 aattgtcggtgtgcggttctgtttccccatgagaccctttaggaaagggtaaagatggag 3146 Query: 401 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgct 460 ||||||||||||||||||||| ||||| ||||| || || ||||| |||||||| ||||| Sbjct: 3145 gatcacccagattgagaagaaaagcttcccaaaaagtggaccccaagattggtagccgct 3086 Query: 461 gttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 ||| || || || |||| ||||||||| || ||||| ||||| Sbjct: 3085 gttaatagcataagatacgcctgccactatacccactaggtt 3044 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Minus Query: 152 aaaatcccgtctaaccccctccggtatttacactagggggg 192 |||||| | ||||||| |||| ||||||||||| ||||||| Sbjct: 3417 aaaatcacatctaaccacctctggtatttacacgagggggg 3377
>gb|DQ020216.1| Bambusa oldhamii cellulose synthase BoCesA3b mRNA, complete cds Length = 3707 Score = 226 bits (114), Expect = 6e-56 Identities = 240/282 (85%) Strand = Plus / Minus Query: 221 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 280 ||||||||| || ||||||||||||| || || || ||||||||| || |||||||| Sbjct: 3310 tcagcagtttacaccgcactgccccagggtgacagctttctgggtaggagatatgaaagg 3251 Query: 281 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 340 |||||||||||||| || || ||||||||||| || ||||||| |||||||| ||||| Sbjct: 3250 atcgatcttcacccacagcagtgagaagatggaagcaaggaggacggaccaaacaatgac 3191 Query: 341 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 400 ||||| || ||||| ||||| |||||||||||||||| ||||| ||||| |||||||| Sbjct: 3190 aatggttggagtgcgattctgtctccccatgagaccctttaggaaagggtaaagatggag 3131 Query: 401 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgct 460 ||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||| || Sbjct: 3130 gatcacccagattgagaagaaaagcttaccgaaaagcggaccccaggattggtaaccact 3071 Query: 461 gttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 ||| || ||||| |||| |||||||| || ||||||||||| Sbjct: 3070 gttaatagcgtacgatactcctgccactatacccaccaggtt 3029
>gb|AY110415.1| Zea mays CL1166_1 mRNA sequence Length = 3898 Score = 226 bits (114), Expect = 6e-56 Identities = 242/285 (84%) Strand = Plus / Minus Query: 218 cgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaa 277 |||||||||||||||||| || ||||||| |||| | || ||||| || ||| ||||| Sbjct: 3419 cgatcagcagttgacgccacattgccccaaggcagcagctttctgtgtcggggagatgaa 3360 Query: 278 agggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgat 337 ||| |||||||||||||| || | ||||||||| || || || ||||| ||||| || || Sbjct: 3359 aggatcgatcttcacccacagcaaggagaagatagatgcaagaaggatggaccagacaat 3300 Query: 338 gacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatg 397 |||||| || || |||||||||||| | |||||||||||||||||||| | ||| ||||| Sbjct: 3299 gacgattgttggtgtgcggttctgccttcccatgagacccttgaggaacgtgtacagatg 3240 Query: 398 gaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacc 457 ||||| ||||||||| |||||||| ||||||||||||||||| |||||||||||||| || Sbjct: 3239 gaggancacccagatcgagaagaacagctttccaaagagcggaccccaggattggtagcc 3180 Query: 458 gctgttgatggcgtatgatatgcctgccaccatgcccaccaggtt 502 ||||| ||||| || || || ||||||||||| || |||||||| Sbjct: 3179 actgttaatggcatacgaaattcctgccaccattccgaccaggtt 3135
>gb|AF200527.1|AF200527 Zea mays cellulose synthase-3 (CesA-3) mRNA, partial cds Length = 2828 Score = 198 bits (100), Expect = 1e-47 Identities = 184/212 (86%) Strand = Plus / Minus Query: 255 gccttctgggtatcggaaatgaaagggtcgatcttcacccagaggagggagaagatggag 314 |||||||||||| ||| ||||| ||||||||||||||||| || || ||||| ||||| Sbjct: 2432 gccttctgggtaggggatatgaaggggtcgatcttcacccacagcagcgagaatatggaa 2373 Query: 315 gcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgaga 374 || || |||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 2372 gcaagaaggacggaccaaacgatgacgatggtcggtgtgcggttctgcttccccatgaga 2313 Query: 375 cccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaag 434 ||||| ||||| |||||||| ||||||||||||||||||| ||||| ||||| || || Sbjct: 2312 cccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaat 2253 Query: 435 agcgggccccaggattggtaaccgctgttgat 466 || || ||||| |||||||| || |||||||| Sbjct: 2252 agtggaccccatgattggtagccactgttgat 2221
>gb|AY104236.1| Zea mays PCO121439 mRNA sequence Length = 2872 Score = 190 bits (96), Expect = 3e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 255 gccttctgggtatcggaaatgaaagggtcgatcttcacccagaggagggagaagatggag 314 |||||||||||| ||| ||||| ||||||||||||||||| || || ||||| ||||| Sbjct: 2454 gccttctgggtaggggatatgaaggggtcgatcttcacccacagcagcgagaatatggaa 2395 Query: 315 gcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgaga 374 || || |||| |||||||| |||||||||||||| |||||||||||||||||||||||| Sbjct: 2394 gcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatgaga 2335 Query: 375 cccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaag 434 ||||| ||||| |||||||| ||||||||||||||||||| ||||| ||||| || || Sbjct: 2334 cccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaat 2275 Query: 435 agcgggccccaggattggtaaccgctgttgat 466 || || ||||| |||||||| || |||||||| Sbjct: 2274 agtggaccccatgattggtagccactgttgat 2243
>gb|BT019010.1| Zea mays clone Contig501.F mRNA sequence Length = 1532 Score = 186 bits (94), Expect = 5e-44 Identities = 160/182 (87%) Strand = Plus / Minus Query: 321 aggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttg 380 ||||| |||| ||| ||||| || || || |||||||||||| | ||||||| ||||||| Sbjct: 986 aggatggacccaacaatgaccattgttggggtgcggttctgccttcccatgaaacccttg 927 Query: 381 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 440 |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| Sbjct: 926 aggaaggggtagagatggaggatcacccagatcgagaagaacagctttccaaagagcgga 867 Query: 441 ccccaggattggtaaccgctgttgatggcgtatgatatgcctgccaccatgcccaccagg 500 |||||||||||||| || ||||| ||||| || || || ||||||||||| || |||||| Sbjct: 866 ccccaggattggtagccactgttaatggcatacgaaattcctgccaccattccgaccagg 807 Query: 501 tt 502 || Sbjct: 806 tt 805
>gb|AY372244.1| Zea mays cellulose synthase catalytic subunit 10 (CesA10) mRNA, complete cds Length = 3470 Score = 180 bits (91), Expect = 3e-42 Identities = 193/227 (85%) Strand = Plus / Minus Query: 279 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 338 ||||||||| | ||||||| ||| ||||||||||||||||||||||| ||||| | | | Sbjct: 3210 gggtcgatcctgacccagacgagcgagaagatggaggcgaggaggatggaccagagcacg 3151 Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||| ||||||||| |||||||||| ||||||||||| |||||||| ||| Sbjct: 3150 acgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggtagaggtgg 3091 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||| ||||||| |||||||||||||| || ||||||||||||||||| ||| ||| Sbjct: 3090 acgatgacccagaaggagaagaagagcttgccgaagagcgggccccaggagccgtagccg 3031 Query: 459 ctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 |||||| ||||| || | ||| ||||| |||||||||| |||||| Sbjct: 3030 ttgttgacggcgtcggacacgccggccacgatgcccaccatgttgat 2984
>gb|AY107656.1| Zea mays PCO126464 mRNA sequence Length = 1189 Score = 180 bits (91), Expect = 3e-42 Identities = 193/227 (85%) Strand = Plus / Minus Query: 279 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 338 ||||||||| | ||||||| ||| ||||||||||||||||||||||| ||||| | | | Sbjct: 909 gggtcgatcctgacccagacgagcgagaagatggaggcgaggaggatggaccagagcacg 850 Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||| ||||||||| |||||||||| ||||||||||| |||||||| ||| Sbjct: 849 acgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggtagaggtgg 790 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||| ||||||| |||||||||||||| || ||||||||||||||||| ||| ||| Sbjct: 789 acgatgacccagaaggagaagaagagcttgccgaagagcgggccccaggagccgtagccg 730 Query: 459 ctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgat 505 |||||| ||||| || | ||| ||||| |||||||||| |||||| Sbjct: 729 ttgttgacggcgtcggacacgccggccacgatgcccaccatgttgat 683
>ref|NM_196933.1| Oryza sativa (japonica cultivar-group) putative cellulose synthase (OSJNBa0006L06.10), mRNA Length = 3408 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 3143 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 3084 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 3083 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 3024 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 3023 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 2971
>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete sequence Length = 162339 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 95863 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 95804 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 95803 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 95744 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 95743 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 95691
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 16751346 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 16751287 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 16751286 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 16751227 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 16751226 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 16751174 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 |||||||| |||||| ||||||||||||||| Sbjct: 22545405 cccatgaggcccttggcgaaggggtagagatg 22545374
>dbj|AK120265.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047D23, full insert sequence Length = 612 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 402 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 343 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 342 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 283 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 282 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 230
>dbj|AK072259.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009D02, full insert sequence Length = 3426 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 3176 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 3117 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 3116 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 3057 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 3056 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 3004
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 176 bits (89), Expect = 5e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 16760386 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 16760327 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 16760326 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 16760267 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 445 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 16760266 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 16760214 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 |||||||| |||||| ||||||||||||||| Sbjct: 22557873 cccatgaggcccttggcgaaggggtagagatg 22557842
>gb|AF200528.1|AF200528 Zea mays cellulose synthase-4 (CesA-4) mRNA, complete cds Length = 3745 Score = 159 bits (80), Expect = 1e-35 Identities = 173/204 (84%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 |||||||||||| || || ||||| | ||| |||| |||||||||||| ||||||||||| Sbjct: 3475 ggagaagatggacgccagcaggatggcccagacgacgacgatggtcggggtgcggttctg 3416 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | |||||||| ||||||||||| ||||| || |||| ||| ||||||| | |||||| Sbjct: 3415 cctgcccatgaggcccttgaggaacgggtacaggtggacgatgacccagaaggcgaagaa 3356 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcc 481 |||||| || |||||||||||||| || ||||| ||||||||||||||||| || ||||| Sbjct: 3355 gagcttgccgaagagcgggccccacgactggtatccgctgttgatggcgtaggagatgcc 3296 Query: 482 tgccaccatgcccaccaggttgat 505 || || | ||| ||||||||||| Sbjct: 3295 ggcgacgacgccgaccaggttgat 3272
>gb|AY108113.1| Zea mays PCO126465 mRNA sequence Length = 3763 Score = 159 bits (80), Expect = 1e-35 Identities = 173/204 (84%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 |||||||||||| || || ||||| | ||| |||| |||||||||||| ||||||||||| Sbjct: 3493 ggagaagatggacgccagcaggatggcccagacgacgacgatggtcggggtgcggttctg 3434 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | |||||||| ||||||||||| ||||| || |||| ||| ||||||| | |||||| Sbjct: 3433 cctgcccatgaggcccttgaggaacgggtacaggtggacgatgacccagaaggcgaagaa 3374 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcc 481 |||||| || |||||||||||||| || ||||| ||||||||||||||||| || ||||| Sbjct: 3373 gagcttgccgaagagcgggccccacgactggtatccgctgttgatggcgtaggagatgcc 3314 Query: 482 tgccaccatgcccaccaggttgat 505 || || | ||| ||||||||||| Sbjct: 3313 ggcgacgacgccgaccaggttgat 3290
>gb|AY372245.1| Zea mays cellulose synthase catalytic subunit 11 (CesA11) mRNA, complete cds Length = 3231 Score = 141 bits (71), Expect = 3e-30 Identities = 158/187 (84%) Strand = Plus / Minus Query: 279 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 338 ||||||||||| ||||| ||||||||||||| |||||||||||||| ||||| | | Sbjct: 2914 gggtcgatcttgacccacaggagggagaagacggaggcgaggaggacggaccagagcacc 2855 Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||||||||||||||| |||||||||||||||||||| ||||| || || Sbjct: 2854 acgatggtcggcgtgcggttctggcggcccatgagacccttgaggaacgggtacaggtgc 2795 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||||||||| || | |||||| | ||| || ||||||||||||||||| | ||| ||| Sbjct: 2794 atgatcacccacatggcgaagaacaccttaccgaagagcgggccccaggactcgtagccg 2735 Query: 459 ctgttga 465 ||||||| Sbjct: 2734 ctgttga 2728
>gb|AY106476.1| Zea mays PCO143801 mRNA sequence Length = 833 Score = 141 bits (71), Expect = 3e-30 Identities = 158/187 (84%) Strand = Plus / Minus Query: 279 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 338 ||||||||||| ||||| ||||||||||||| |||||||||||||| ||||| | | Sbjct: 517 gggtcgatcttgacccacaggagggagaagacggaggcgaggaggacggaccagagcacc 458 Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||||||||||||||| |||||||||||||||||||| ||||| || || Sbjct: 457 acgatggtcggcgtgcggttctggcggcccatgagacccttgaggaacgggtacaggtgc 398 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||||||||| || | |||||| | ||| || ||||||||||||||||| | ||| ||| Sbjct: 397 atgatcacccacatggcgaagaacaccttaccgaagagcgggccccaggactcgtagccg 338 Query: 459 ctgttga 465 ||||||| Sbjct: 337 ctgttga 331
>gb|BT019277.1| Zea mays clone Contig950.F mRNA sequence Length = 789 Score = 139 bits (70), Expect = 1e-29 Identities = 172/206 (83%) Strand = Plus / Plus Query: 300 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 359 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 270 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 329 Query: 360 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 419 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 330 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 389 Query: 420 aagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatg 479 |||||||| || || || || ||||| || ||||||||||| ||||| ||||| || ||| Sbjct: 390 aagagcttcccgaaaagaggtccccatgactggtaaccgctattgattgcgtaggaaatg 449 Query: 480 cctgccaccatgcccaccaggttgat 505 || || |||| ||| ||||||||||| Sbjct: 450 ccagcgaccacgccgaccaggttgat 475
>gb|AF200529.1|AF200529 Zea mays cellulose synthase-5 (CesA-5) mRNA, complete cds Length = 3676 Score = 139 bits (70), Expect = 1e-29 Identities = 172/206 (83%) Strand = Plus / Minus Query: 300 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 359 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 3408 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 3349 Query: 360 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 419 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 3348 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 3289 Query: 420 aagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatg 479 |||||||| || || || || ||||| || ||||||||||| ||||| ||||| || ||| Sbjct: 3288 aagagcttcccgaaaagaggtccccatgactggtaaccgctattgattgcgtaggaaatg 3229 Query: 480 cctgccaccatgcccaccaggttgat 505 || || |||| ||| ||||||||||| Sbjct: 3228 ccagcgaccacgccgaccaggttgat 3203
>gb|AY110079.1| Zea mays CL1164_1 mRNA sequence Length = 3696 Score = 139 bits (70), Expect = 1e-29 Identities = 172/206 (83%) Strand = Plus / Minus Query: 300 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 359 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 3408 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 3349 Query: 360 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 419 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 3348 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 3289 Query: 420 aagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatg 479 |||||||| || || || || ||||| || ||||||||||| ||||| ||||| || ||| Sbjct: 3288 aagagcttcccgaaaagaggtccccatgactggtaaccgctattgattgcgtaggaaatg 3229 Query: 480 cctgccaccatgcccaccaggttgat 505 || || |||| ||| ||||||||||| Sbjct: 3228 ccagcgaccacgccgaccaggttgat 3203
>ref|NM_191233.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2820 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 2768 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 2709 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 2708 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 2649 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 2648 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 2589 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 2588 tagccgctgttga 2576
>gb|AY483154.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA4) mRNA, partial cds Length = 1819 Score = 137 bits (69), Expect = 4e-29 Identities = 150/177 (84%) Strand = Plus / Minus Query: 272 aatgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgacca 331 |||||| ||||||||| | ||||| | |||||||||||||||||||| |||| ||||| Sbjct: 1575 aatgaaggggtcgatcctgacccacacaagggagaagatggaggcgagcaggacagacca 1516 Query: 332 aacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggta 391 | | |||||||| ||||| ||||||||| |||||||||| ||||||||||| ||||| Sbjct: 1515 gagcacaacgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggta 1456 Query: 392 gagatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 448 ||| || | ||| ||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 1455 gaggtgaacgatgacccagaaggagaagaagagcttcccgaagagcgggccccagga 1399
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 31421516 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 31421457 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 31421456 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 31421397 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 31421396 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 31421337 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 31421336 tagccgctgttga 31421324
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 15580 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 15521 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 15520 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 15461 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 15460 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 15401 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 15400 tagccgctgttga 15388
>dbj|AK105078.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G07, full insert sequence Length = 1504 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 1162 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 1103 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 1102 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 1043 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 1042 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 983 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 982 tagccgctgttga 970
>dbj|AK100475.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093O20, full insert sequence Length = 3462 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 3050 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 2991 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 2990 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 2931 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 2930 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 2871 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 2870 tagccgctgttga 2858
>dbj|AK100374.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084J22, full insert sequence Length = 2024 Score = 137 bits (69), Expect = 4e-29 Identities = 162/193 (83%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 1616 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 1557 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 1556 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 1497 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| | | Sbjct: 1496 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccaggactcg 1437 Query: 453 taaccgctgttga 465 || |||||||||| Sbjct: 1436 tagccgctgttga 1424
>gb|AY483156.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA8) mRNA, partial cds Length = 1255 Score = 135 bits (68), Expect = 2e-28 Identities = 179/216 (82%) Strand = Plus / Minus Query: 274 tgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaa 333 |||| ||||||||| | ||||| || |||||||| |||||||| || || | ||||| | Sbjct: 1040 tgaaggggtcgatcctgacccaaagcagggagaacatggaggctagcagcacggaccata 981 Query: 334 cgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtaga 393 |||||| ||||| ||||| | ||||||| ||||||||| |||||||||||| ||||||| Sbjct: 980 tgatgacaatggtgggcgtcctgttctgcctccccatgaaacccttgaggaacgggtaga 921 Query: 394 gatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggt 453 |||| | ||||||||||| | |||||||||||| || || ||||| ||||| || |||| Sbjct: 920 gatgcacgatcacccagaaggcgaagaagagcttaccgaatagcggcccccacgactggt 861 Query: 454 aaccgctgttgatggcgtatgatatgcctgccacca 489 | ||| |||||||||||| || ||||| ||||||| Sbjct: 860 acccgttgttgatggcgtcagaaatgcccgccacca 825 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 218 cgatcagcagttgacgccgcactgc 242 |||||||||||||| |||||||||| Sbjct: 1093 cgatcagcagttgatgccgcactgc 1069
>gb|AF200533.1|AF200533 Zea mays cellulose synthase-9 (CesA-9) mRNA, complete cds Length = 3795 Score = 135 bits (68), Expect = 2e-28 Identities = 170/204 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || || ||||||| ||| || | ||||||||||| ||||||||||| Sbjct: 3399 ggagaagatcgacgccagcaggatcgcccagacaaccacgatggtcggggtgcggttctg 3340 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||||||||| ||||| || || | ||||||||||| | |||||| Sbjct: 3339 ccgacccatgagacccttgaggaacgggtacaggtgaacgatcacccagaaggcgaagaa 3280 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcc 481 |||||| || |||||||| ||||| || ||||| ||||||||||||||||| || ||||| Sbjct: 3279 gagcttgccgaagagcggaccccacgactggtacccgctgttgatggcgtaggagatgcc 3220 Query: 482 tgccaccatgcccaccaggttgat 505 || || | ||| ||||||||||| Sbjct: 3219 ggcaacaacgccgaccaggttgat 3196
>gb|AY112236.1| Zea mays CL1160_1 mRNA sequence Length = 3728 Score = 135 bits (68), Expect = 2e-28 Identities = 170/204 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || || ||||||| ||| || | ||||||||||| ||||||||||| Sbjct: 3399 ggagaagatcgacgccagcaggatcgcccagacaaccacgatggtcggggtgcggttctg 3340 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||||||||| ||||| || || | ||||||||||| | |||||| Sbjct: 3339 ccgacccatgagacccttgaggaacgggtacaggtgaacgatcacccagaaggcgaagaa 3280 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcc 481 |||||| || |||||||| ||||| || ||||| ||||||||||||||||| || ||||| Sbjct: 3279 gagcttgccgaagagcggaccccacgactggtacccgctgttgatggcgtaggagatgcc 3220 Query: 482 tgccaccatgcccaccaggttgat 505 || || | ||| ||||||||||| Sbjct: 3219 ggcaacaacgccgaccaggttgat 3196
>gb|AY389728.1| Hyacinthus orientalis cellulose synthase protein mRNA, partial cds Length = 782 Score = 131 bits (66), Expect = 2e-27 Identities = 168/202 (83%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||| || |||||||||||||| || | || |||||||| |||||||||||| Sbjct: 639 gagaagatggaagccaggaggatcgaccagacaaccacaatggtcggagtgcggttctgc 580 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 ||||||| | ||||||||||||||||||| |||| |||||||||| | ||||||| Sbjct: 579 ctccccatcgggaccttgaggaaggggtagaggtggacaatcacccagaaggcgaagaag 520 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcct 482 ||||| || || ||||| ||||| || ||||| |||||||||| ||||| || ||||| Sbjct: 519 agcttcccgaaaagcggaccccacgactggtacccgctgttgacagcgtaagagatgcca 460 Query: 483 gccaccatgcccaccaggttga 504 || |||| ||||||||||||| Sbjct: 459 gcgaccacacccaccaggttga 438
>gb|AY372246.1| Zea mays cellulose synthase catalytic subunit 12 (CesA12) mRNA, complete cds Length = 3443 Score = 125 bits (63), Expect = 2e-25 Identities = 165/199 (82%) Strand = Plus / Minus Query: 273 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 332 ||||||||||||||| | |||||||| ||||||||||||||||| || || || ||||| Sbjct: 3201 atgaaagggtcgatcctgacccagagcagggagaagatggaggccagcagaatggaccag 3142 Query: 333 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 392 | || || | ||| ||||| | |||||| ||||||||| ||||||||||| |||||| Sbjct: 3141 atgacaacaacggtgggcgtcctgttctggcgccccatgagccccttgaggaacgggtag 3082 Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 || |||| ||| ||||||| | |||||||||||| || ||||| || |||||||| ||| Sbjct: 3081 aggtggacgatgacccagaaggcgaagaagagcttgccgaagaggggcccccaggactgg 3022 Query: 453 taaccgctgttgatggcgt 471 || ||| |||||||||||| Sbjct: 3021 tacccgttgttgatggcgt 3003
>gb|DQ020213.1| Bambusa oldhamii cellulose synthase BoCesA5 mRNA, complete cds Length = 3613 Score = 125 bits (63), Expect = 2e-25 Identities = 144/171 (84%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | ||| |||| || |||||||| ||||||||||| Sbjct: 3373 ggagaagatagatgcaaggaggatggcccagacgacaacaatggtcggtgtgcggttctg 3314 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| | |||| |||||||||| | |||||| Sbjct: 3313 ccgacccatgagacccttaaggaaggggtacaagtggacaatcacccagaaggcgaagaa 3254 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||||||||||||||| ||||| Sbjct: 3253 gagcttcccaaagagcggtccccatgactggtaaccgctgttgatcgcgta 3203
>gb|BT019129.1| Zea mays clone Contig756.F mRNA sequence Length = 754 Score = 121 bits (61), Expect = 2e-24 Identities = 151/181 (83%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 485 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 426 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 425 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 366 Query: 411 attgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcg 470 | | |||||||||||| || || || |||||||| || | ||| ||| ||||||| ||| Sbjct: 365 aaggcgaagaagagcttcccgaacagggggccccacgactcgtacccgttgttgatcgcg 306 Query: 471 t 471 | Sbjct: 305 t 305
>gb|AF200532.1|AF200532 Zea mays cellulose synthase-8 (CesA-8) mRNA, complete cds Length = 3812 Score = 121 bits (61), Expect = 2e-24 Identities = 151/181 (83%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 3428 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 3369 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 3368 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 3309 Query: 411 attgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcg 470 | | |||||||||||| || || || |||||||| || | ||| ||| ||||||| ||| Sbjct: 3308 aaggcgaagaagagcttcccgaacagggggccccacgactcgtacccgttgttgatcgcg 3249 Query: 471 t 471 | Sbjct: 3248 t 3248
>gb|AY103701.1| Zea mays PCO120363 mRNA sequence Length = 3788 Score = 121 bits (61), Expect = 2e-24 Identities = 151/181 (83%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 3413 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 3354 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 3353 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 3294 Query: 411 attgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgttgatggcg 470 | | |||||||||||| || || || |||||||| || | ||| ||| ||||||| ||| Sbjct: 3293 aacgcgaagaagagcttcccgaacagggggccccacgactcgtacccgttgttgatcgcg 3234 Query: 471 t 471 | Sbjct: 3233 t 3233
>gb|BT009583.1| Triticum aestivum clone wre1n.pk0043.h8:fis, full insert mRNA sequence Length = 993 Score = 117 bits (59), Expect = 4e-23 Identities = 143/171 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 703 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 644 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 643 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 584 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| ||||||||||| |||||||||||||| Sbjct: 583 gagcttcccaaagagcggcccccatgattggtaaccactgttgatggcgta 533
>gb|BT009438.1| Triticum aestivum clone wlmk4.pk0015.a11:fis, full insert mRNA sequence Length = 3626 Score = 117 bits (59), Expect = 4e-23 Identities = 143/171 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3224 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3165 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 3164 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 3105 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| ||||||||||| |||||||||||||| Sbjct: 3104 gagcttcccaaagagcggcccccatgattggtaaccactgttgatggcgta 3054
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 15230807 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 15230748 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 15230747 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 15230688 Query: 411 attgagaagaagagctttccaaagagcgggcccca 445 | | |||||||||||| || |||||||||||||| Sbjct: 15230687 aaggcgaagaagagcttcccgaagagcgggcccca 15230653
>dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1740_D06 Length = 187410 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 124783 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 124724 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 124723 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 124664 Query: 411 attgagaagaagagctttccaaagagcgggcccca 445 | | |||||||||||| || |||||||||||||| Sbjct: 124663 aaggcgaagaagagcttcccgaagagcgggcccca 124629
>dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0418B08 Length = 165909 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 9996 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 9937 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 9936 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 9877 Query: 411 attgagaagaagagctttccaaagagcgggcccca 445 | | |||||||||||| || |||||||||||||| Sbjct: 9876 aaggcgaagaagagcttcccgaagagcgggcccca 9842
>dbj|AB158407.1| Triticum aestivum CesA mRNA for putative cellulose synthase, complete cds Length = 3681 Score = 117 bits (59), Expect = 4e-23 Identities = 143/171 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3250 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3191 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 3190 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 3131 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| ||||||||||| |||||||||||||| Sbjct: 3130 gagcttcccaaagagcggcccccatgattggtaaccactgttgatggcgta 3080
>dbj|AK121170.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081B08, full insert sequence Length = 3631 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 3196 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 3137 Query: 351 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 410 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 3136 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 3077 Query: 411 attgagaagaagagctttccaaagagcgggcccca 445 | | |||||||||||| || |||||||||||||| Sbjct: 3076 aaggcgaagaagagcttcccgaagagcgggcccca 3042
>ref|XM_477093.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3954 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 3567 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 3508 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 3507 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 3448 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 3447 ctgttgatcgcgtatga 3431
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Plus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 5885322 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 5885381 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 5885382 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 5885441 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 5885442 ctgttgatcgcgtatga 5885458 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Plus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 13688719 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 13688778 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 13688779 ggtccccatgatt 13688791 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 374 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 427 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 8533242 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 8533189
>dbj|AP003748.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1136_A05 Length = 120823 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Plus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 27770 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 27829 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 27830 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 27889 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 27890 ctgttgatcgcgtatga 27906
>dbj|AP003837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1559_F09 Length = 87792 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Plus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 59996 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 60055 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 60056 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 60115 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 60116 ctgttgatcgcgtatga 60132
>dbj|AK072356.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023059I02, full insert sequence Length = 3954 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 3567 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 3508 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 3507 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 3448 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 3447 ctgttgatcgcgtatga 3431
>dbj|AK062007.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-E01, full insert sequence Length = 1241 Score = 113 bits (57), Expect = 6e-22 Identities = 117/137 (85%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 854 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 795 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||||| | ||||||||||| ||||||||||| ||||| |||||||| ||| Sbjct: 794 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggtagccg 735 Query: 459 ctgttgatggcgtatga 475 |||||||| |||||||| Sbjct: 734 ctgttgatcgcgtatga 718
>gb|BT018125.1| Zea mays clone EL01N0554C08.c mRNA sequence Length = 1450 Score = 111 bits (56), Expect = 2e-21 Identities = 167/204 (81%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || || ||||||| |||||| | ||||||||||| ||||||||||| Sbjct: 1184 ggagaagatcgacgccagcaggatcgcccaaacaaccacgatggtcggggtgcggttctg 1125 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||||||||| ||||| || | | ||||||||||| | ||| || Sbjct: 1124 ccgacccatgagacccttgaggaacgggtacaggggaacgatcacccagaaggcgaaaaa 1065 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcc 481 ||||| || || ||||| ||||| || ||||| ||||||||||||||||| || ||||| Sbjct: 1064 aagcttgccgaaaagcggaccccacgactggtacccgctgttgatggcgtaggagatgcc 1005 Query: 482 tgccaccatgcccaccaggttgat 505 || || | ||| ||||||||||| Sbjct: 1004 ggcaacaacgccgaccaggttgat 981
>gb|AY483153.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA5) mRNA, partial cds Length = 2814 Score = 109 bits (55), Expect = 9e-21 Identities = 154/187 (82%) Strand = Plus / Minus Query: 279 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 338 ||||||||||| ||||||||||||||||||| ||||| || |||| ||||| | ||| Sbjct: 2579 gggtcgatcttgacccagaggagggagaagaccgaggccagcaggacggaccagagtatg 2520 Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| || || ||||||||| |||||||||||||||||||| ||||| || || Sbjct: 2519 acgatggtgggagtccggttctgccggcccatgagacccttgaggaacgggtacaggtgc 2460 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | |||||||| || |||||||| | ||| || |||||||| ||||| || | ||| ||| Sbjct: 2459 ataatcacccacatggagaagaacaccttgccgaagagcggcccccatgactcgtagccg 2400 Query: 459 ctgttga 465 ||||||| Sbjct: 2399 ctgttga 2393
>gb|AY483150.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3605 Score = 109 bits (55), Expect = 9e-21 Identities = 142/171 (83%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || ||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3225 ggagaagattgaagccaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3166 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | ||||| |||||||||||||||||||| | || | |||||||||| | ||||| Sbjct: 3165 cctgcccataagacccttgaggaaggggtataagtgaacaatcacccagaaggcaaagaa 3106 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| || |||||||| ||||| ||||||||||| |||||||||||||| Sbjct: 3105 gagcttcccgaagagcggcccccaagattggtaaccactgttgatggcgta 3055
>ref|XM_470040.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3607 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 3529 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 3470 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 3469 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 3410 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 3409 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 3359
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Plus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 33476953 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 33477012 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 33477013 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 33477072 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 33477073 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 33477123
>gb|AC145384.2| Oryza sativa chromosome 3 BAC OSJNBa0060M17 genomic sequence, complete sequence Length = 41693 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Plus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 6180 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 6239 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 6240 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 6299 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 6300 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 6350
>gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete sequence Length = 154555 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 21158 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 21099 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 21098 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 21039 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 21038 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 20988
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Plus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 33567463 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 33567522 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 33567523 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 33567582 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 33567583 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 33567633
>dbj|AK069196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003G18, full insert sequence Length = 4282 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 3418 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 3359 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 3358 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 3299 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 3298 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 3248
>dbj|AK061688.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B05, full insert sequence Length = 1582 Score = 101 bits (51), Expect = 2e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 1083 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 1024 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 1023 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 964 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| ||||||||||| ||||| || ||||| || |||||||| ||||| Sbjct: 963 gagcttcccaaagagcggaccccatgactggtagccactgttgatagcgta 913
>gb|DQ020212.1| Bambusa oldhamii cellulose synthase BoCesA4b mRNA, partial cds Length = 3409 Score = 97.6 bits (49), Expect = 3e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 342 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 401 ||||||||||||||||| ||| | |||||||||||||||||||| ||||| | || | Sbjct: 3086 atggtcggcgtgcggttttgcctacccatgagacccttgaggaatgggtacaagtgaaca 3027 Query: 402 atcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccgctg 461 |||||||||| | ||||||||||| |||||||| || ||||| |||||||| |||||| Sbjct: 3026 atcacccagaaagcaaagaagagcttcccaaagagtggcccccatgattggtagccgctg 2967 Query: 462 ttgat 466 ||||| Sbjct: 2966 ttgat 2962
>gb|DQ020211.1| Bambusa oldhamii cellulose synthase BoCesA4a mRNA, complete cds Length = 3756 Score = 93.7 bits (47), Expect = 5e-16 Identities = 140/171 (81%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 ||||||||||||||| ||||| || | ||| |||| || ||||| || |||||||| || Sbjct: 3404 ggagaagatggaggcaaggagaattgcccagacgacaacaatggttggtgtgcggttttg 3345 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | | |||||||||||||| ||||| ||||| | || | |||||||||| | ||||| Sbjct: 3344 cctacccatgagacccttcaggaatgggtacaagtgaacaatcacccagaaggcaaagaa 3285 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| |||||||| || ||||| |||||||| ||||||||||| ||||| Sbjct: 3284 gagcttcccaaagagtggcccccatgattggtagccgctgttgatcgcgta 3234
>dbj|AP004509.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT16K17, TM0037a, complete sequence Length = 84322 Score = 89.7 bits (45), Expect = 8e-15 Identities = 96/113 (84%) Strand = Plus / Plus Query: 342 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 401 ||||||||||||||||||||| ||||| | ||| |||||||| || |||||||||| Sbjct: 44306 atggtcggcgtgcggttctgccgacccatcaaacctttgaggaatggatagagatggaca 44365 Query: 402 atcacccagattgagaagaagagctttccaaagagcgggccccaggattggta 454 |||||||||| || ||||||||||| ||||| || || |||||||||||||| Sbjct: 44366 atcacccagaaggaaaagaagagcttcccaaatagtggtccccaggattggta 44418
>gb|AY483151.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA3) mRNA, partial cds Length = 3362 Score = 85.7 bits (43), Expect = 1e-13 Identities = 139/171 (81%) Strand = Plus / Minus Query: 302 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 361 |||||||||||| || || ||||| | ||| |||| ||||||||||||||||||||||| Sbjct: 3078 ggagaagatggatgcaagaaggatggcccagacgacaacgatggtcggcgtgcggttctg 3019 Query: 362 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 421 | ||||| || ||||||||||| ||||| | |||| |||||||||| | ||||| Sbjct: 3018 ccgtcccattagccccttgaggaatgggtacaagtggataatcacccagaaggcaaagaa 2959 Query: 422 gagctttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 |||||| || || ||||| ||||| || || || ||||||||||| ||||| Sbjct: 2958 gagcttcccgaaaagcggtccccatgactgatagccgctgttgatcgcgta 2908
>gb|DQ124221.1| Fagus sylvatica putative cellulose synthase mRNA, partial cds Length = 825 Score = 83.8 bits (42), Expect = 5e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 367 ccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagct 426 |||| ||||| || |||||||| || ||||||| |||||||| | | ||||||||||| Sbjct: 824 ccatcagacctttaaggaagggataaagatggacaatcacccaaaaggcgaagaagagct 765 Query: 427 ttccaaagagcgggccccaggattggtaaccgctgttgatggcgta 472 | |||||||| || ||||| ||||||||||||||||| |||||||| Sbjct: 764 tcccaaagagaggaccccatgattggtaaccgctgtttatggcgta 719
>gb|AY221087.1| Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds Length = 3997 Score = 83.8 bits (42), Expect = 5e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 425 ||||||||||| |||||||||||||| || || | ||||||||||| | ||||| | Sbjct: 3441 cccatgagacctttgaggaaggggtaaaggtgaacgatcacccagaaagcaaagaataat 3382 Query: 426 tttccaaagagcgggccccaggattggtaaccgctgttgatggcgtatgatatgcctgcc 485 || |||||||| || ||||| ||||||||||| ||||||||||| ||||| ||||| ||| Sbjct: 3381 ttaccaaagaggggaccccatgattggtaaccactgttgatggcatatgagatgccggcc 3322 Query: 486 ac 487 || Sbjct: 3321 ac 3320
>gb|AF200530.1|AF200530 Zea mays cellulose synthase-6 (CesA-6) mRNA, complete cds Length = 3538 Score = 79.8 bits (40), Expect = 8e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 |||||||| || || |||||||| ||||| || ||||| || || ||||| | ||||||| Sbjct: 3140 gagaagatcgaagccaggaggatggaccagacaatgacaatcgttggcgtcctgttctgc 3081 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 |||| | |||||||||||||| ||||| ||||||| ||||||||| | || |||||| Sbjct: 3080 ctcccaaccagacccttgaggaacgggtaaagatggacgatcacccaaaatgcaaagaag 3021 Query: 423 agctttccaaagagcgggccccaggatt 450 ||||| || || || |||||||| |||| Sbjct: 3020 agcttcccgaacagggggccccatgatt 2993
>gb|AY104730.1| Zea mays PCO100501 mRNA sequence Length = 3783 Score = 79.8 bits (40), Expect = 8e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 |||||||| || || |||||||| ||||| || ||||| || || ||||| | ||||||| Sbjct: 3373 gagaagatcgaagccaggaggatggaccagacaatgacaatcgttggcgtcctgttctgc 3314 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 |||| | |||||||||||||| ||||| ||||||| ||||||||| | || |||||| Sbjct: 3313 ctcccaaccagacccttgaggaacgggtaaagatggacgatcacccaaaatgcaaagaag 3254 Query: 423 agctttccaaagagcgggccccaggatt 450 ||||| || || || |||||||| |||| Sbjct: 3253 agcttcccgaacagggggccccatgatt 3226
>emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-76H16 on chromosome 3, complete sequence Length = 133910 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||| |||||||| ||||| ||||| || |||||||||||||||||| Sbjct: 129712 acgatggttggcgttcggttctggcgtcccataagacctttaaggaaggggtagagatgg 129653 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||||||||| | || ||||| || || |||||||| || ||||| |||||||| || Sbjct: 129652 atgatcacccaaaatgcaaagaaaagtttaccaaagagtggtccccatgattggtagcca 129593 Query: 459 ctgtt 463 ||||| Sbjct: 129592 ctgtt 129588
>gb|AC149572.14| Medicago truncatula clone mth2-116e22, complete sequence Length = 120017 Score = 73.8 bits (37), Expect = 5e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||| |||||||| ||||| ||||| || |||||||||||||||||| Sbjct: 93734 acgatggttggcgttcggttctggcgtcccataagacctttaaggaaggggtagagatgg 93675 Query: 399 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccg 458 | ||||||||| | || ||||| || || |||||||| || ||||| |||||||| || Sbjct: 93674 atgatcacccaaaatgcaaagaaaagtttaccaaagagtggtccccatgattggtagcca 93615 Query: 459 ctgtt 463 ||||| Sbjct: 93614 ctgtt 93610
>gb|AY483152.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2) mRNA, complete cds Length = 3907 Score = 69.9 bits (35), Expect = 8e-09 Identities = 122/151 (80%) Strand = Plus / Minus Query: 321 aggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttg 380 ||||| ||||| ||||| ||||| ||||| || | ||||||| | |||| ||||||||| Sbjct: 3250 aggatggaccagacgatcacgatcgtcggggtcctgttctgccttcccaacagacccttg 3191 Query: 381 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 440 ||||| ||||| ||||| | |||||||||| | |||||||||||| || ||||| || Sbjct: 3190 aggaacgggtacagatgaacaatcacccagaacgcgaagaagagcttcccgaagagaggc 3131 Query: 441 ccccaggattggtaaccgctgttgatggcgt 471 ||||| |||| || ||| ||||||| |||| Sbjct: 3130 ccccatgattcatatccgttgttgattgcgt 3100
>gb|DQ014506.1| Eucalyptus grandis cellulose synthase 2 (CesA2) mRNA, complete cds Length = 3471 Score = 67.9 bits (34), Expect = 3e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 356 gttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattga 415 |||||| || ||||| ||||| |||||||| ||||||||||||| ||||||||| | | Sbjct: 3099 gttctgttttcccatcagacctttgaggaaagggtagagatggacgatcacccaaaaggc 3040 Query: 416 gaagaagagctttccaaagagcgggcccca 445 |||||||||||| || || || |||||||| Sbjct: 3039 gaagaagagcttcccgaacagagggcccca 3010
>gb|AF150630.2|AF150630 Gossypium hirsutum cellulose synthase catalytic subunit (celA3) mRNA, complete cds Length = 3723 Score = 67.9 bits (34), Expect = 3e-08 Identities = 85/102 (83%) Strand = Plus / Minus Query: 383 gaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcgggcc 442 ||||||||||||||||| ||||||||||| | ||||| ||||| |||||||| || || Sbjct: 3313 gaaggggtagagatggatgatcacccagaaggcaaagaatagcttaccaaagaggggacc 3254 Query: 443 ccaggattggtaaccgctgttgatggcgtatgatatgcctgc 484 ||| |||||||| || || |||||| | || ||||| ||||| Sbjct: 3253 ccatgattggtagccactattgatgacatacgatattcctgc 3212
>gb|DQ160225.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA7) mRNA, complete cds Length = 4016 Score = 65.9 bits (33), Expect = 1e-07 Identities = 141/177 (79%) Strand = Plus / Minus Query: 290 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 349 |||||| || || ||||||||||| || || ||||||||||| ||||| ||||| ||||| Sbjct: 3358 cacccacagaagcgagaagatggacgccagcaggatcgaccacacgatcacgatcgtcgg 3299 Query: 350 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 409 || |||||||| ||||| |||||||| ||||| || || | || | ||||||||| Sbjct: 3298 tgtccggttctgtcgtcccatcagacccttcaggaacggatacaagtgaacgatcaccca 3239 Query: 410 gattgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgttgat 466 || | ||| || ||||| || || ||||||||||| || ||||| ||| ||||||| Sbjct: 3238 gaacgcgaaaaacagcttcccgaacagcgggccccacgactggtatccgttgttgat 3182
>gb|DQ160224.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA6) mRNA, complete cds Length = 4070 Score = 65.9 bits (33), Expect = 1e-07 Identities = 141/177 (79%) Strand = Plus / Minus Query: 290 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 349 |||||| || || ||||||||||| || || ||||||||||| ||||| ||||| ||||| Sbjct: 3385 cacccacagaagcgagaagatggacgccagcaggatcgaccacacgatcacgatcgtcgg 3326 Query: 350 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 409 || |||||||| ||||| |||||||| ||||| || || | || | ||||||||| Sbjct: 3325 tgtccggttctgtcgtcccatcagacccttcaggaacggatacaagtgaacgatcaccca 3266 Query: 410 gattgagaagaagagctttccaaagagcgggccccaggattggtaaccgctgttgat 466 || | ||| || ||||| || || ||||||||||| || ||||| ||| ||||||| Sbjct: 3265 gaacgcgaaaaacagcttcccgaacagcgggccccacgactggtatccgttgttgat 3209
>gb|AY643520.1| Acacia mangium CesA2 mRNA, complete cds Length = 3643 Score = 63.9 bits (32), Expect = 5e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 425 ||||||||||| ||||||| || |||||||||| |||||||| | || |||||| ||| Sbjct: 3349 cccatgagacctctgaggaaaggatagagatggataatcacccaaaatgcgaagaaaagc 3290 Query: 426 tttccaaagagcgggccccaggattggtaaccgctgttgatggc 469 || ||||| ||||| ||||| || ||||| || || |||||||| Sbjct: 3289 ttgccaaatagcggaccccatgactggtagccactattgatggc 3246
>gb|AY633545.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA5) gene, partial cds Length = 2345 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 350 ||||| ||||| ||||||||||||||||| || || ||||| ||||| || ||||| ||| Sbjct: 2341 acccacaggagagagaagatggaggcgagcagaatggaccacacgatcacaatggtaggc 2282 Query: 351 gtgcggttctgc 362 || ||||||||| Sbjct: 2281 gttcggttctgc 2270
>gb|AY262815.1| Pinus radiata cellulose synthase (CesA3) mRNA, partial cds Length = 1333 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||||||||| ||| ||||||||||| ||||||||||| || | |||| Sbjct: 878 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 819 Query: 399 aggatcacccagattgagaa 418 || |||||||| | |||||| Sbjct: 818 agaatcacccatactgagaa 799
>gb|AY789650.1| Pinus taeda cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3127 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 398 |||||||| ||||||||||| ||| ||||||||||| ||||||||||| || | |||| Sbjct: 2861 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 2802 Query: 399 aggatcacccagattgagaa 418 || |||||||| | |||||| Sbjct: 2801 agaatcacccatactgagaa 2782
>gb|AY055724.2| Populus tremuloides cellulose synthase (CesA5) mRNA, complete cds Length = 3532 Score = 60.0 bits (30), Expect = 7e-06 Identities = 72/86 (83%) Strand = Plus / Minus Query: 381 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 440 ||||| || |||||||||| ||||||||||| | |||||| ||||| |||||||| || Sbjct: 3315 aggaaaggatagagatggacgatcacccagaaagcgaagaaaagcttgccaaagagtgga 3256 Query: 441 ccccaggattggtaaccgctgttgat 466 ||||| || || ||||| |||||||| Sbjct: 3255 ccccatgactgataaccactgttgat 3230
>gb|AC150787.15| Medicago truncatula clone mth2-171n13, complete sequence Length = 82665 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 417 aagaagagctttccaaagagcgggccccaggattggtaaccgctgttgatggc 469 ||||||||||||||||| || || ||||| ||||||||||| ||||| ||||| Sbjct: 48754 aagaagagctttccaaatagtggaccccaagattggtaaccactgtttatggc 48806
>gb|AY095297.1| Populus tremuloides cellulose synthase (CesA2) mRNA, complete cds Length = 3277 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 364 tccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaaga 423 ||||||| ||||| |||||||| ||||||||||||| |||||||||| | ||||||| Sbjct: 2979 tccccattagacctttgaggaatgggtagagatggacaatcacccagaaggcaaagaaga 2920 Query: 424 gctt 427 |||| Sbjct: 2919 gctt 2916
>gb|DQ014508.1| Eucalyptus grandis cellulose synthase 4 (CesA4) mRNA, complete cds Length = 3782 Score = 56.0 bits (28), Expect = 1e-04 Identities = 97/120 (80%) Strand = Plus / Minus Query: 290 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 349 |||||| || || ||||| ||||| || ||||||||||||||||| | || ||||| || Sbjct: 3355 cacccacagaagtgagaaaatggatgctaggaggatcgaccaaacaactacaatggttgg 3296 Query: 350 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 409 ||||| ||||| ||||| ||||| |||||||||||||| || || | ||||||||| Sbjct: 3295 tgtgcgtttctggcgtcccatcagacctttgaggaaggggtacaggtgaacgatcaccca 3236
>gb|DQ014505.1| Eucalyptus grandis cellulose synthase 1 (CesA1) mRNA, complete cds Length = 3341 Score = 56.0 bits (28), Expect = 1e-04 Identities = 130/164 (79%) Strand = Plus / Minus Query: 282 tcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacg 341 |||||||||||||||| ||| ||||||| || || || || | |||||| | | || Sbjct: 2988 tcgatcttcacccagacgagagagaagacagaagccagaagcaccgaccagagaaccaca 2929 Query: 342 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 401 |||||||| || | ||||||| | ||||||||||| || ||||| || |||||||| || Sbjct: 2928 atggtcggagtcctgttctgcctacccatgagacctttcaggaatggatagagatgaaga 2869 Query: 402 atcacccagattgagaagaagagctttccaaagagcgggcccca 445 |||||||||| || ||||||| ||| || ||||| || ||||| Sbjct: 2868 atcacccagaatgcaaagaagaccttgccgaagaggggtcccca 2825
>gb|AF525360.1| Mesotaenium caldariorum cellulose synthase catalytic subunit (CesA1) gene, complete cds Length = 6176 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 425 ||||||||||||||||||||||| || || || | | |||||||| | ||||||||| Sbjct: 5771 cccatgagacccttgaggaagggatacaggtgcacaaccacccagaaggcaaagaagagc 5712 Query: 426 tttccaaagagcgggcccca 445 ||||| ||||| |||||||| Sbjct: 5711 tttccgaagagggggcccca 5692
>gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY639654.1| Pinus radiata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3911 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 3308 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 3262
>gb|AC140546.12| Medicago truncatula clone mth2-35l19, complete sequence Length = 106962 Score = 54.0 bits (27), Expect = 5e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 ||||||| |||||||||| || |||||||| |||||||| || || ||||| |||||| Sbjct: 31271 agatggacaatcacccagaaggaaaagaagagttttccaaatagaggtccccatgattgg 31212 Query: 453 taaccgctgttgatggcgt 471 ||||| |||| ||||||| Sbjct: 31211 taaccattgtttatggcgt 31193
>gb|AC150446.8| Medicago truncatula clone mth2-101n14, complete sequence Length = 109162 Score = 54.0 bits (27), Expect = 5e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 393 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 452 ||||||| |||||||||| || |||||||| |||||||| || || ||||| |||||| Sbjct: 107059 agatggacaatcacccagaaggaaaagaagagttttccaaatagaggtccccatgattgg 107000 Query: 453 taaccgctgttgatggcgt 471 ||||| |||| ||||||| Sbjct: 106999 taaccattgtttatggcgt 106981
>gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRNA, partial cds Length = 2287 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1823 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1764 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 1763 aaaagcggtccccatgactggta 1741
>gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRNA, partial cds Length = 2588 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 2156 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 2097 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 2096 aaaagcggtccccatgactggta 2074
>gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRNA, partial cds Length = 2489 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1935 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1876 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 1875 aaaagcggtccccatgactggta 1853
>gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRNA, partial cds Length = 1989 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1377 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1318 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 1317 aaaagcggtccccatgactggta 1295
>gb|AY262814.1| Pinus radiata cellulose synthase (CesA11) mRNA, partial cds Length = 1258 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 818 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 759 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 758 aaaagcggtccccatgactggta 736
>gb|AY789652.1| Pinus taeda cellulose synthase catalytic subunit (CesA3) mRNA, complete cds Length = 3959 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 3298 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 3252
>gb|AY789651.1| Pinus taeda cellulose synthase catalytic subunit (CesA2) mRNA, complete cds Length = 3478 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 372 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 431 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 3083 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 3024 Query: 432 aagagcgggccccaggattggta 454 || ||||| ||||| || ||||| Sbjct: 3023 aaaagcggtccccatgactggta 3001
>gb|DQ014507.1| Eucalyptus grandis cellulose synthase 3 (CesA3) mRNA, complete cds Length = 3452 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 354 cggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccaga 411 |||||||| ||||||| || || || |||||||| ||||||||||| |||||||||| Sbjct: 3026 cggttctgtctccccatcagccctttcaggaagggatagagatggagaatcacccaga 2969
>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0084P08 Length = 158656 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Plus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 156338 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 156397 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 156398 ggtccccatgatt 156410
>dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0409D09 Length = 150485 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Plus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 39711 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 39770 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 39771 ggtccccatgatt 39783
>dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086F23, full insert sequence Length = 4127 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 3380 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 3321 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 3320 ggtccccatgatt 3308
>dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013085H01, full insert sequence Length = 1867 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 1185 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 1126 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 1125 ggtccccatgatt 1113
>dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099F14, full insert sequence Length = 3221 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 2474 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 2415 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 2414 ggtccccatgatt 2402
>dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H11, full insert sequence Length = 1827 Score = 50.1 bits (25), Expect = 0.007 Identities = 61/73 (83%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 1080 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 1021 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 1020 ggtccccatgatt 1008
>gb|AY573575.1| Populus tremula x Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds Length = 3778 Score = 48.1 bits (24), Expect = 0.028 Identities = 30/32 (93%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcaccca 409 ||||||||||||||||| |||||||| ||||| Sbjct: 3335 ttgaggaaggggtagaggtggaggatgaccca 3304
>gb|AY162180.1| Populus tremuloides cellulose synthase (CesA7) mRNA, complete cds Length = 3809 Score = 48.1 bits (24), Expect = 0.028 Identities = 30/32 (93%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcaccca 409 ||||||||||||||||| |||||||| ||||| Sbjct: 3301 ttgaggaaggggtagaggtggaggatgaccca 3270
>gb|DQ020215.1| Bambusa oldhamii cellulose synthase BoCesA7 mRNA, partial cds Length = 2997 Score = 48.1 bits (24), Expect = 0.028 Identities = 57/68 (83%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| || || ||||||| |||||||||| || ||||||||||| |||||||| Sbjct: 2223 ttgaggaatggatatagatggacaatcacccagaatgcaaagaagagcttcccaaagaga 2164 Query: 438 gggcccca 445 || ||||| Sbjct: 2163 ggccccca 2156
>gb|AY764732.1|AY764731S2 Pinus taeda isolate 27 cellulose synthase gene, partial cds Length = 452 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 339 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 385 |||||||| || || ||||||||| | ||||||||||| |||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacctttgaggaa 223
>gb|DQ077190.3| Boehmeria nivea cellulose synthase CesA1 mRNA, partial cds Length = 3276 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 441 ccccaggattggtaaccgctgttgatggcgtatga 475 ||||| || |||||||||||||| ||||||||||| Sbjct: 2597 ccccaagactggtaaccgctgtttatggcgtatga 2563
>ref|XM_477282.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3746 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 374 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 427 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 3191 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 3138
>gb|AY632360.1| Gossypium hirsutum BAC 106I22, complete sequence Length = 135862 Score = 44.1 bits (22), Expect = 0.44 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 411 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 62232 cccataagacctttgaggaatggataaagatggaggatgacccaga 62187
>gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence Length = 103930 Score = 44.1 bits (22), Expect = 0.44 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 411 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 61247 cccataagacctttgaggaatggataaagatggaggatgacccaga 61202
>ref|XM_540001.2| PREDICTED: Canis familiaris similar to ring finger protein 127 (LOC482886), mRNA Length = 3897 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 129 cttccgtcttcatctacaacca 150 |||||||||||||||||||||| Sbjct: 1739 cttccgtcttcatctacaacca 1718
>ref|XM_499743.1| Yarrowia lipolytica CLIB122, YALI0A03949g predicted mRNA Length = 2712 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 377 cttgaggaaggggtagagatgg 398 |||||||||||||||||||||| Sbjct: 2229 cttgaggaaggggtagagatgg 2208
>gb|AF413210.1|AF413210 Gossypium hirsutum cellulose synthase A4 (CesA4) gene, complete cds Length = 6886 Score = 44.1 bits (22), Expect = 0.44 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 411 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 6618 cccataagacctttgaggaatggataaagatggaggatgacccaga 6573
>dbj|AP005824.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0669H03 Length = 167878 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 374 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 427 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 65710 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 65657
>dbj|AK100914.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133D04, full insert sequence Length = 3746 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 374 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 427 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 3191 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 3138
>dbj|AK059649.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C05, full insert sequence Length = 1335 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 374 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 427 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 528 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 475
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 377 cttgaggaaggggtagagatgg 398 |||||||||||||||||||||| Sbjct: 441477 cttgaggaaggggtagagatgg 441456
>gb|U58283.1|GHU58283 Gossypium hirsutum cellulose synthase (celA1) mRNA, complete cds Length = 3186 Score = 44.1 bits (22), Expect = 0.44 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 411 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 2853 cccataagacctttgaggaatggataaagatggaggatgacccaga 2808
>ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNTHASE 1); transferase, transferring glycosyl groups AT4G32410 (CESA1) mRNA, complete cds Length = 3912 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 3441 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 3382 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 3381 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 3322 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 3321 agcttcccgaaaagcggaccccacgactggtagccactgtt 3281
>ref|XM_529209.1| PREDICTED: Pan troglodytes plexin A3 (PLXNA3), mRNA Length = 5649 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 412 gaggaggaagaagagggaggcgaggagga 440
>gb|BC000028.2| Homo sapiens family with sequence similarity 50, member A, mRNA (cDNA clone MGC:1514 IMAGE:3505365), complete cds Length = 1358 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>gb|AC146111.3| Pan troglodytes BAC clone RP43-38O16 from 7, complete sequence Length = 158242 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacca 498 ||||||||||||||||||||| Sbjct: 102612 tgcctgccaccatgcccacca 102632
>ref|NM_004699.1| Homo sapiens family with sequence similarity 50, member A (FAM50A), mRNA Length = 1311 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 448 gaggaggaagaagagggaggcgaggagga 476
>gb|AF394543.1| Oryza sativa alpha-expansin OsEXPA1 (EXPA1) gene, complete cds Length = 2637 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 108 gcaataatttagataaaaatc 128 ||||||||||||||||||||| Sbjct: 740 gcaataatttagataaaaatc 760
>gb|AY162181.1| Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds Length = 3640 Score = 42.1 bits (21), Expect = 1.7 Identities = 45/53 (84%) Strand = Plus / Minus Query: 417 aagaagagctttccaaagagcgggccccaggattggtaaccgctgttgatggc 469 ||||||||||| |||||||| || ||||| || ||||| || ||||| ||||| Sbjct: 3089 aagaagagcttgccaaagagaggaccccatgactggtatccactgtttatggc 3037
>emb|BX936365.3| Human DNA sequence from clone WI2-81657B9 on chromosome X Contains the 3' end of the GDI1 gene for GDP dissociation inhibitor 1, the FAM50A gene for family with sequence similarity 50, member A, a novel gene (DXS9879E) gene , the PLXNA3 gene for plexin A3 and a CpG island, complete sequence Length = 39835 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 4488 gaggaggaagaagagggaggcgaggagga 4516
>emb|AL513218.27| Human DNA sequence from clone RP11-155O18 on chromosome 1 Contains the 3' end of the MADHIP gene for MAD (mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor), gene KIAA1836, a phospholipase A2 group XII (PLA2G12) pseudogene, the ORC1L gene for origin recognition complex subunit 1-like (yeast) and the 5' end of gene FLJ34719, complete sequence Length = 107627 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 473 tgatatgcctgccaccatgcccacc 497 |||| |||||||||||||||||||| Sbjct: 93614 tgatttgcctgccaccatgcccacc 93590
>emb|AL034346.31|HS668J24 Human DNA sequence from clone RP4-668J24 on chromosome 6p25.1-25.3 Contians the FOXF2 gene for forkhead box F2, complete sequence Length = 120429 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 agacccttgaggaaggggtag 392 ||||||||||||||||||||| Sbjct: 113401 agacccttgaggaaggggtag 113421
>emb|Z46376.1|HSCHK2 H.sapiens HK2 mRNA for hexokinase II Length = 5292 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 864 gaggaggaagaagagggaggcgaggagga 836
>gb|DQ124074.1| Coffea arabica clone MN-SSH3-C06 mRNA sequence Length = 241 Score = 42.1 bits (21), Expect = 1.7 Identities = 48/57 (84%) Strand = Plus / Plus Query: 290 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggt 346 ||||||||| | |||||||||||| || ||||| || ||||| || ||||| ||||| Sbjct: 177 cacccagagcaaggagaagatggatgcaaggagtatggaccagacaatgacaatggt 233
>emb|BX927148.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 1/10 Length = 348071 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 479 gcctgccaccatgcccaccag 499 ||||||||||||||||||||| Sbjct: 47800 gcctgccaccatgcccaccag 47820
>emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 77 Length = 197252 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Plus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 55100 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 55159 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 55160 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 55219 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 55220 agcttcccgaaaagcggaccccacgactggtagccactgtt 55260
>emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4, BAC clone F8B4 (ESSA project) Length = 93257 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Plus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 41383 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 41442 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 41443 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 41502 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 41503 agcttcccgaaaagcggaccccacgactggtagccactgtt 41543
>gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R19778) putative cellulose synthase catalytic subunit (RSW1) (At4g32410) mRNA, complete cds Length = 3763 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 3308 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 3249 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 3248 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 3189 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 3188 agcttcccgaaaagcggaccccacgactggtagccactgtt 3148
>emb|CR625912.1| full-length cDNA clone CS0DN002YB06 of Adult brain of Homo sapiens (human) Length = 1243 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 449 gaggaggaagaagagggaggcgaggagga 477
>emb|CR623814.1| full-length cDNA clone CS0DI060YH13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1295 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 458 gaggaggaagaagagggaggcgaggagga 486
>emb|CR619686.1| full-length cDNA clone CS0DI061YG13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1286 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 458 gaggaggaagaagagggaggcgaggagga 486
>emb|CR614465.1| full-length cDNA clone CS0DM009YL24 of Fetal liver of Homo sapiens (human) Length = 1294 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>emb|CR612868.1| full-length cDNA clone CS0DF027YP23 of Fetal brain of Homo sapiens (human) Length = 1628 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>gb|AC123593.1| Genomic sequence for Medicago truncatula, clone MTABa0052G10, complete sequence Length = 100769 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Minus Query: 417 aagaagagctttccaaagagcgggccccaggattggtaacc 457 ||||||||||||||||| || || |||| ||||||||||| Sbjct: 5209 aagaagagctttccaaatagtggaccccgagattggtaacc 5169
>emb|CR597867.1| full-length cDNA clone CS0DI006YF07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1430 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 443 gaggaggaagaagagggaggcgaggagga 471
>gb|AD001530.1|HUMXAP5 Homo sapiens XAP-5 mRNA, complete cds Length = 1311 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 448 gaggaggaagaagagggaggcgaggagga 476
>dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit, complete cds, clone: RAFL22-92-A12 Length = 1456 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 1037 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 978 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 977 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 918 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 917 agcttcccgaaaagcggaccccacgactggtagccactgtt 877
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 108 gcaataatttagataaaaatc 128 ||||||||||||||||||||| Sbjct: 8556250 gcaataatttagataaaaatc 8556270
>emb|BX827280.1|CNS0A2E6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS32ZA11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 832 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 420 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 361 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 360 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 301 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 300 agcttcccgaaaagcggaccccacgactggtagccactgtt 260
>dbj|D83389.2| Homo sapiens HXC-26 gene, complete cds Length = 4733 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 1883 gaggaggaagaagagggaggcgaggagga 1911
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 479 gcctgccaccatgcccaccag 499 ||||||||||||||||||||| Sbjct: 47800 gcctgccaccatgcccaccag 47820
>gb|DQ014510.1| Eucalyptus grandis cellulose synthase 6 (CesA6) mRNA, complete cds Length = 3782 Score = 42.1 bits (21), Expect = 1.7 Identities = 42/49 (85%) Strand = Plus / Minus Query: 291 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatga 339 ||||| || |||||||||||||| ||||| | ||| ||||| ||||||| Sbjct: 3271 acccacagaagggagaagatggaagcgagcaagattgaccacacgatga 3223
>dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042D15, full insert sequence Length = 4208 Score = 42.1 bits (21), Expect = 1.7 Identities = 60/73 (82%) Strand = Plus / Minus Query: 378 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 437 |||||||| |||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 3462 ttgaggaattggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 3403 Query: 438 gggccccaggatt 450 || ||||| |||| Sbjct: 3402 ggtccccatgatt 3390
>gb|L44140.1|HUMFLNG6PD Homo sapiens chromosome X region from filamin (FLN) gene to glucose-6-phosphate dehydrogenase (G6PD) gene, complete cds's Length = 219447 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 116920 gaggaggaagaagagggaggcgaggagga 116948
>gb|AF027172.1|AF027172 Arabidopsis thaliana cellulose synthase catalytic subunit (RSW1) gene, complete cds Length = 8401 Score = 42.1 bits (21), Expect = 1.7 Identities = 126/161 (78%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 362 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 7583 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 7524 Query: 363 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 422 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 7523 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 7464 Query: 423 agctttccaaagagcgggccccaggattggtaaccgctgtt 463 ||||| || || ||||| ||||| || ||||| || ||||| Sbjct: 7463 agcttcccgaaaagcggaccccacgactggtagccactgtt 7423
>emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065B15, complete sequence Length = 150007 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 108 gcaataatttagataaaaatc 128 ||||||||||||||||||||| Sbjct: 16693 gcaataatttagataaaaatc 16713
>dbj|D83260.1| Human HXC-26 mRNA, complete cds Length = 1216 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 gaggagggagaagatggaggcgaggagga 324 ||||||| |||||| |||||||||||||| Sbjct: 353 gaggaggaagaagagggaggcgaggagga 381
>emb|AL670680.6| Mouse DNA sequence from clone RP23-314D24 on chromosome 4, complete sequence Length = 150897 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacca 498 ||||||||||||||||||||| Sbjct: 50371 tgcctgccaccatgcccacca 50351
>ref|NM_121748.2| Arabidopsis thaliana IRX3 (IRREGULAR XYLEM 3); cellulose synthase AT5G17420 (IRX3) mRNA, complete cds Length = 3693 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 2984 cccatcagacctttgaggaatgggtagagatg 2953
>ref|NM_121747.2| Arabidopsis thaliana unknown protein AT5G17410 transcript variant AT5G17410.1 mRNA, complete cds Length = 3027 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 2664 cccatcagacctttgaggaatgggtagagatg 2695
>ref|NM_180507.1| Arabidopsis thaliana unknown protein AT5G17410 transcript variant AT5G17410.2 mRNA, complete cds Length = 3030 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 2667 cccatcagacctttgaggaatgggtagagatg 2698
>ref|NM_123746.2| Arabidopsis thaliana unknown protein AT5G43790 mRNA, complete cds Length = 1475 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 aatccttccgtcttcatctacaac 148 ||||||||||||||| |||||||| Sbjct: 202 aatccttccgtcttcctctacaac 225
>ref|NM_197900.1| Oryza sativa (japonica cultivar-group) putative cellulose synthase (OSJNBa0035H01.10), mRNA Length = 3384 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 |||||||| |||||| ||||||||||||||| Sbjct: 3245 cccatgaggcccttggcgaaggggtagagatg 3214
>gb|BT017973.1| Zea mays clone EL01N0524D09.c mRNA sequence Length = 1387 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 acgatgacgatggtcggcgtgcgg 356 |||| ||||||||||||||||||| Sbjct: 996 acgaagacgatggtcggcgtgcgg 973
>gb|AC186368.1| Pan troglodytes chromosome 7 clone CH251-329G12, complete sequence Length = 146205 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 7398 tgcctgccaccatgcccacc 7379
>gb|AC132332.2| Mus musculus BAC clone RP24-222H7 from chromosome 10, complete sequence Length = 155268 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 295 agaggagggagaagatggag 314 |||||||||||||||||||| Sbjct: 88976 agaggagggagaagatggag 88957
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold Length = 1996640 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 108 gcaataatttagataaaaat 127 |||||||||||||||||||| Sbjct: 836324 gcaataatttagataaaaat 836305
>ref|XM_535932.2| PREDICTED: Canis familiaris similar to solute carrier family 4, sodium bicarbonate transporter-like, member 10 (LOC478766), mRNA Length = 4639 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 350 cgtgcggttctgcttccccatgag 373 |||| ||||||||||||||||||| Sbjct: 2215 cgtggggttctgcttccccatgag 2192
>gb|AC112676.8| Mus musculus chromosome 9, clone RP23-174F7, complete sequence Length = 230293 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 tatgcctgccaccatgccca 495 |||||||||||||||||||| Sbjct: 115879 tatgcctgccaccatgccca 115860
>gb|AC122388.5| Mus musculus BAC clone RP24-80J12 from chromosome 16, complete sequence Length = 214268 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 aatttagataaaaatccttc 132 |||||||||||||||||||| Sbjct: 145940 aatttagataaaaatccttc 145959
>gb|AC107214.5| Homo sapiens BAC clone RP11-367N14 from 4, complete sequence Length = 183317 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 8731 tgcctgccaccatgcccacc 8750
>gb|AC098883.3| Mus musculus BAC clone RP23-122F3 from 16, complete sequence Length = 211348 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 aatttagataaaaatccttc 132 |||||||||||||||||||| Sbjct: 182268 aatttagataaaaatccttc 182249
>gb|AC110302.4| Mus musculus BAC clone RP24-194G21 from 12, complete sequence Length = 168601 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 295 agaggagggagaagatggag 314 |||||||||||||||||||| Sbjct: 146375 agaggagggagaagatggag 146394
>gb|AC073136.6| Homo sapiens BAC clone RP11-700P18 from 7, complete sequence Length = 80796 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 33430 tgcctgccaccatgcccacc 33449
>emb|AL645758.9| Human DNA sequence from clone RP4-739J5 on chromosome 1, complete sequence Length = 40662 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 1747 tgcctgccaccatgcccacc 1766
>emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chromosome 1 Contains the 5' end of one variant of the ZSWIM5 gene for zinc finger SWIM domain containing 5 and four CpG islands, complete sequence Length = 177710 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 177457 tgcctgccaccatgcccacc 177476
>emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on chromosome 10 Contains the gene for a novel protein similar to ARF GTPase-activating protein (MRIP2), a ribosomal protein L35a (RPL35A) pseudogene and a CpG island, complete sequence Length = 86155 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 56663 tgcctgccaccatgcccacc 56682
>emb|AL357149.13| Human DNA sequence from clone RP11-352E13 on chromosome 6 Contains the 3' end of the UTRN gene for utrophin (homologous to dystrophin), complete sequence Length = 201399 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 379 tgaggaaggggtagagatggagga 402 ||||| |||||||||||||||||| Sbjct: 141738 tgaggtaggggtagagatggagga 141761
>emb|AL158062.22| Human DNA sequence from clone RP11-144H23 on chromosome 13 Contains the 5' end of the gene for a novel protein similar to ubiquitin specific protease 12 (LOC219333), a novel gene, the 5' end of a novel gene and a CpG island, complete sequence Length = 105880 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 52380 tgcctgccaccatgcccacc 52361
>emb|AL139398.20| Human DNA sequence from clone RP11-528B10 on chromosome Xp11.21-11.23, complete sequence Length = 125999 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 19358 tgcctgccaccatgcccacc 19339
>emb|AL136123.19| Human DNA sequence from clone RP11-236M15 on chromosome 13 Contains a meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene, the C13orf1 gene for chromosome 13 open reading frame 1 and a CpG island, complete sequence Length = 178151 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 175713 tgcctgccaccatgcccacc 175694
>emb|AL132773.14|HSDJ741H3 Human DNA sequence from clone RP4-741H3 on chromosome 20 Contains the 3' end of the ATRN gene for attractin (with dipeptidylpeptidase IV activity) (KIAA0548), ESTs, STSs and GSSs, complete sequence Length = 104907 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 1146 tgcctgccaccatgcccacc 1127
>gb|AC027037.6| Oryza sativa chromosome 10 BAC OSJNBa0035H01 genomic sequence, complete sequence Length = 64582 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 |||||||| |||||| ||||||||||||||| Sbjct: 61123 cccatgaggcccttggcgaaggggtagagatg 61092
>gb|BC094061.1| Mus musculus basic helix-loop-helix domain containing, class B, 8, mRNA (cDNA clone MGC:102506 IMAGE:4165423), complete cds Length = 3487 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatc 326 ||||||||||||| |||||||||| Sbjct: 889 gagaagatggaggtgaggaggatc 866
>emb|AL391142.1|ATT10B6 Arabidopsis thaliana DNA chromosome 5, BAC clone T10B6 (ESSA project) Length = 33563 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 20805 cccatcagacctttgaggaatgggtagagatg 20836
>gb|BC011486.1| Mus musculus basic helix-loop-helix domain containing, class B, 8, mRNA (cDNA clone MGC:19046 IMAGE:4189225), complete cds Length = 3472 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatc 326 ||||||||||||| |||||||||| Sbjct: 863 gagaagatggaggtgaggaggatc 840
>emb|AL592065.7| Mouse DNA sequence from clone RP23-50E4 on chromosome 11 Contains the 3' end of a novel gene, two novel genes, the 5' end of the Brip1 gene for BRCA1 interacting protein C-terminal helicase 1 and a mitochondrial F0 complex H+ transporting ATP synthase subunit g (Atp5l) pseudogene, complete sequence Length = 200624 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 476 tatgcctgccaccatgccca 495 |||||||||||||||||||| Sbjct: 180607 tatgcctgccaccatgccca 180626
>gb|AY139754.1| Arabidopsis thaliana AT5g17420/T10B6_80 mRNA, complete cds Length = 3355 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 2984 cccatcagacctttgaggaatgggtagagatg 2953
>gb|AC154393.8| Mus musculus chromosome 1, clone RP23-64O1, complete sequence Length = 253733 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 cacaatgtacactgcaggtt 63 |||||||||||||||||||| Sbjct: 24735 cacaatgtacactgcaggtt 24716
>gb|AC087518.5| Homo sapiens chromosome , clone RP11-359E19, complete sequence Length = 168531 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 20800 tgcctgccaccatgcccacc 20819
>gb|AC148939.8| Pan troglodytes BAC clone CH251-51M11 from chromosome 7, complete sequence Length = 183313 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 12412 tgcctgccaccatgcccacc 12431
>gb|AY124001.1| Arabidopsis thaliana AT5g43790/MQD19_14 mRNA sequence Length = 1379 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 aatccttccgtcttcatctacaac 148 ||||||||||||||| |||||||| Sbjct: 106 aatccttccgtcttcctctacaac 129
>gb|AC113933.2| Homo sapiens chromosome 3 clone RP11-1006P7, complete sequence Length = 173769 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 45602 tgcctgccaccatgcccacc 45583
>ref|NM_010800.3| Mus musculus basic helix-loop-helix domain containing, class B, 8 (Bhlhb8), mRNA Length = 3520 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 303 gagaagatggaggcgaggaggatc 326 ||||||||||||| |||||||||| Sbjct: 913 gagaagatggaggtgaggaggatc 890
>gb|AC182463.3| Pan troglodytes BAC clone CH251-511B8 from chromosome 16, complete sequence Length = 194406 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 174719 tgcctgccaccatgcccacc 174738
>gb|AC182736.3| Pan troglodytes BAC clone CH251-15A9 from chromosome 7, complete sequence Length = 181648 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 35185 tgcctgccaccatgcccacc 35204
>gb|AC108056.3| Homo sapiens BAC clone RP11-366I1 from 4, complete sequence Length = 174916 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gacagtggttctcagcggca 88 |||||||||||||||||||| Sbjct: 118421 gacagtggttctcagcggca 118440
>gb|AC080089.5| Homo sapiens BAC clone RP11-785J10 from 4, complete sequence Length = 174023 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cagaggagggagaagatgga 313 |||||||||||||||||||| Sbjct: 68142 cagaggagggagaagatgga 68123
>gb|AC093155.2| Homo sapiens chromosome 1 clone RP11-384B12, complete sequence Length = 189760 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 62033 tgcctgccaccatgcccacc 62014
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 204 gagcgccgatgatccgatcagcag 227 |||||| ||||||||||||||||| Sbjct: 2092163 gagcgcagatgatccgatcagcag 2092186
>gb|AF440619.1|AF440619 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus section 1 of 2 Length = 350000 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 20977 tgcctgccaccatgcccacc 20958
>gb|AC025175.4| Homo sapiens chromosome 5 clone CTD-2081C10, complete sequence Length = 166907 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 7365 tgcctgccaccatgcccacc 7346
>gb|AC024571.5| Homo sapiens chromosome 5 clone CTD-2220M16, complete sequence Length = 109134 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 tgcctgccaccatgcccacc 497 |||||||||||||||||||| Sbjct: 85702 tgcctgccaccatgcccacc 85683
>dbj|AK220815.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit, partial cds, clone: RAFL22-31-O12 Length = 930 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 ||||| ||||| |||||||| ||||||||||| Sbjct: 614 cccatcagacctttgaggaatgggtagagatg 583
>gb|AC018727.10| Oryza sativa chromosome 10 BAC OSJNBa0056G17 genomic sequence, complete sequence Length = 139999 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 366 cccatgagacccttgaggaaggggtagagatg 397 |||||||| |||||| ||||||||||||||| Sbjct: 74 cccatgaggcccttggcgaaggggtagagatg 43
>gb|AC009654.8| Homo sapiens chromosome 15, clone RP11-82L7, complete sequence Length = 192296 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 403 tcacccagattgagaagaag 422 |||||||||||||||||||| Sbjct: 166789 tcacccagattgagaagaag 166808 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,233,360 Number of Sequences: 3902068 Number of extensions: 4233360 Number of successful extensions: 172635 Number of sequences better than 10.0: 289 Number of HSP's better than 10.0 without gapping: 290 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 171666 Number of HSP's gapped (non-prelim): 938 length of query: 509 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 487 effective length of database: 17,147,199,772 effective search space: 8350686288964 effective search space used: 8350686288964 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
