ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd20o19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009303.1| Triticum aestivum clone wlm1.pk0014.g10:fis, full... 88 2e-14
2emb|BX324121.9| Zebrafish DNA sequence from clone DKEY-164J20 in... 46 0.053
3emb|AL953857.7| Zebrafish DNA sequence from clone CH211-127M7, c... 46 0.053
4gb|AC132875.8| Mus musculus chromosome 15, clone RP24-381O23, co... 42 0.83
5gb|AC165415.5| Mus musculus chromosome 15, clone RP23-17G19, com... 42 0.83
6gb|AC005572.1| Homo sapiens chromosome 5, PAC clone 248b21 (LBNL... 40 3.3
7gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome 40 3.3
8gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome 40 3.3
9gb|AE006601.1| Streptococcus pyogenes M1 GAS, section 130 of 167... 40 3.3
10gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome 40 3.3
11gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome 40 3.3
12gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome 40 3.3
13gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome 40 3.3
14gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 40 3.3
15emb|CR848057.6| Zebrafish DNA sequence from clone DKEYP-84H9 in ... 40 3.3
16emb|AL833072.2|HSM804383 Homo sapiens genomic DNA; cDNA DKFZp451... 40 3.3
17gb|AC010433.9| Homo sapiens chromosome 5 clone CTD-2202L20, comp... 40 3.3
18gb|AE010083.1| Streptococcus pyogenes strain MGAS8232, section 1... 40 3.3
19gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome 40 3.3
20dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome 40 3.3

>gb|BT009303.1| Triticum aestivum clone wlm1.pk0014.g10:fis, full insert mRNA
           sequence
          Length = 813

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 83/95 (87%), Gaps = 7/95 (7%)
 Strand = Plus / Minus

                                                                       
Query: 121 acctcaatcggaaaaagaacactgtatatgatcgattgatgatgatctacaataccaaaa 180
           |||||||||  |||| ||||||||||||||||||||||||      ||||||||||||||
Sbjct: 647 acctcaatcaaaaaaggaacactgtatatgatcgattgat------ctacaataccaaaa 594

                                              
Query: 181 cgtgtagatgctaaatcgacgacga-tattacgta 214
           |||| |||| ||||||||||||||| |||||||||
Sbjct: 593 cgtgcagatactaaatcgacgacgagtattacgta 559



to top

>emb|BX324121.9| Zebrafish DNA sequence from clone DKEY-164J20 in linkage group 25,
             complete sequence
          Length = 181165

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 223   gaaatctttcctacgtattactagtatttat 253
             ||||| ||||||||| |||||||||||||||
Sbjct: 39314 gaaatgtttcctacgaattactagtatttat 39344



to top

>emb|AL953857.7| Zebrafish DNA sequence from clone CH211-127M7, complete sequence
          Length = 175586

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 223   gaaatctttcctacgtattactagtatttat 253
             ||||| ||||||||| |||||||||||||||
Sbjct: 66328 gaaatgtttcctacgaattactagtatttat 66358



to top

>gb|AC132875.8| Mus musculus chromosome 15, clone RP24-381O23, complete sequence
          Length = 185786

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 132    aaaaagaacactgtatatgat 152
              |||||||||||||||||||||
Sbjct: 115434 aaaaagaacactgtatatgat 115454



to top

>gb|AC165415.5| Mus musculus chromosome 15, clone RP23-17G19, complete sequence
          Length = 227254

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 132   aaaaagaacactgtatatgat 152
             |||||||||||||||||||||
Sbjct: 24655 aaaaagaacactgtatatgat 24635



to top

>gb|AC005572.1| Homo sapiens chromosome 5, PAC clone 248b21 (LBNL H141), complete
             sequence
          Length = 95448

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   ggaaaaagaacactgtatat 149
             ||||||||||||||||||||
Sbjct: 68705 ggaaaaagaacactgtatat 68724



to top

>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1383589 ccaaaacgtgtagatgctaa 1383570



to top

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1455713 ccaaaacgtgtagatgctaa 1455694



to top

>gb|AE006601.1| Streptococcus pyogenes M1 GAS, section 130 of 167 of the complete
            genome
          Length = 10724

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  ccaaaacgtgtagatgctaa 194
            ||||||||||||||||||||
Sbjct: 5639 ccaaaacgtgtagatgctaa 5620



to top

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1460641 ccaaaacgtgtagatgctaa 1460622



to top

>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome
          Length = 1860355

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1401932 ccaaaacgtgtagatgctaa 1401913



to top

>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1477174 ccaaaacgtgtagatgctaa 1477155



to top

>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome
          Length = 1836467

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1378042 ccaaaacgtgtagatgctaa 1378023



to top

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1453190 ccaaaacgtgtagatgctaa 1453171



to top

>emb|CR848057.6| Zebrafish DNA sequence from clone DKEYP-84H9 in linkage group 16,
              complete sequence
          Length = 184783

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 80     cttccttatacaaaccgaaa 99
              ||||||||||||||||||||
Sbjct: 178185 cttccttatacaaaccgaaa 178204



to top

>emb|AL833072.2|HSM804383 Homo sapiens genomic DNA; cDNA DKFZp451D0119 (from clone
            DKFZp451D0119)
          Length = 5281

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 130  ggaaaaagaacactgtatat 149
            ||||||||||||||||||||
Sbjct: 3485 ggaaaaagaacactgtatat 3466



to top

>gb|AC010433.9| Homo sapiens chromosome 5 clone CTD-2202L20, complete sequence
          Length = 258929

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    ggaaaaagaacactgtatat 149
              ||||||||||||||||||||
Sbjct: 120565 ggaaaaagaacactgtatat 120584



to top

>gb|AE010083.1| Streptococcus pyogenes strain MGAS8232, section 131 of 173 of the
            complete genome
          Length = 10725

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  ccaaaacgtgtagatgctaa 194
            ||||||||||||||||||||
Sbjct: 5640 ccaaaacgtgtagatgctaa 5621



to top

>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome
          Length = 1900521

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 175     ccaaaacgtgtagatgctaa 194
               ||||||||||||||||||||
Sbjct: 1492139 ccaaaacgtgtagatgctaa 1492120



to top

>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome
          Length = 1894275

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    ccaaaacgtgtagatgctaa 194
              ||||||||||||||||||||
Sbjct: 404731 ccaaaacgtgtagatgctaa 404750


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,417,682
Number of Sequences: 3902068
Number of extensions: 1417682
Number of successful extensions: 22320
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22284
Number of HSP's gapped (non-prelim): 36
length of query: 253
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 231
effective length of database: 17,147,199,772
effective search space: 3961003147332
effective search space used: 3961003147332
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top