ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd21d14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK065493.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.033
3dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.033
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
5dbj|AP005446.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
6dbj|AK071250.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
7gb|AY549651.1| Desmognathus monticola isolate VAN46 12S ribosoma... 42 2.0
8gb|AY549650.1| Desmognathus monticola isolate VAJ4 12S ribosomal... 42 2.0
9gb|AY549649.1| Desmognathus monticola isolate VAJ3 12S ribosomal... 42 2.0
10gb|AF437350.1| Desmognathus ochrophaeus isolate OJN003OC_1 12S r... 42 2.0
11dbj|AP002439.3| Homo sapiens genomic DNA, chromosome 18 clone:RP... 42 2.0
12dbj|AP005131.2| Homo sapiens genomic DNA, chromosome 18, clone:R... 42 2.0
13gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosom... 40 8.1
14gb|AC005711.2| Drosophila melanogaster clone BACR48M09, complete... 40 8.1
15gb|AC124830.8| Mus musculus chromosome 17, clone RP24-165B21, co... 40 8.1
16ref|NM_198421.1| Mus musculus ubiquitin specific peptidase 49 (U... 40 8.1
17gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, compl... 40 8.1
18gb|BC060712.1| Mus musculus ubiquitin specific peptidase 49, mRN... 40 8.1
19gb|AC139214.12| Mus musculus chromosome 17, clone RP23-345D6, co... 40 8.1
20gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complet... 40 8.1
21tpg|BK003390.1| TPA: TPA_inf: Drosophila melanogaster HDC02164 (... 40 8.1
22gb|AE012466.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 8.1
23dbj|AK141369.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 40 8.1
24gb|AC150442.2| Medicago truncatula chromosome 7 BAC clone mth2-2... 40 8.1
25gb|AC158529.2| Mus musculus BAC clone RP23-263H3 from chromosome... 40 8.1
26gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 8.1
27dbj|AK082872.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 8.1
28gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44... 40 8.1
29emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chr... 40 8.1
30dbj|AP000795.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.1

>dbj|AK065493.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013025M10, full
            insert sequence
          Length = 4113

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgctgttgatcttcggcgagacccagaaccaccaagctagacctcgggagacttgatcgc 567
            |||||||||||||| || ||||||| ||| |||||| ||||||| || ||| ||||||| 
Sbjct: 3729 tgctgttgatcttcagcaagacccaaaactaccaaggtagaccttggaagagttgatcgt 3670

                 
Query: 568  acgtt 572
            |||||
Sbjct: 3669 acgtt 3665



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 508      tgctgttgatcttcggcgagacccagaaccaccaagctagacct 551
                |||||||||||||| || ||||||| ||| |||||| |||||||
Sbjct: 29491622 tgctgttgatcttcagcaagacccaaaactaccaaggtagacct 29491579



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 409      gcggaggattcctgggtcacttccgtcgt 437
                ||||| ||||||||||||||||| |||||
Sbjct: 29491718 gcggaagattcctgggtcacttctgtcgt 29491690



to top

>dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0627E10
          Length = 163388

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 508   tgctgttgatcttcggcgagacccagaaccaccaagctagacct 551
             |||||||||||||| || ||||||| ||| |||||| |||||||
Sbjct: 18294 tgctgttgatcttcagcaagacccaaaactaccaaggtagacct 18251



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 409   gcggaggattcctgggtcacttccgtcgt 437
             ||||| ||||||||||||||||| |||||
Sbjct: 18390 gcggaagattcctgggtcacttctgtcgt 18362



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 493      tcgggtgcgggctgctgctgtt 514
                ||||||||||||||||||||||
Sbjct: 23756108 tcgggtgcgggctgctgctgtt 23756129



to top

>dbj|AP005446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0029C06
          Length = 156500

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 493    tcgggtgcgggctgctgctgtt 514
              ||||||||||||||||||||||
Sbjct: 104184 tcgggtgcgggctgctgctgtt 104205



to top

>dbj|AK071250.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088G11, full
           insert sequence
          Length = 1224

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 493 tcgggtgcgggctgctgctgtt 514
           ||||||||||||||||||||||
Sbjct: 412 tcgggtgcgggctgctgctgtt 433



to top

>gb|AY549651.1| Desmognathus monticola isolate VAN46 12S ribosomal RNA gene,
           partial sequence; tRNA-Val gene, complete sequence; and
           16S ribosomal RNA gene, partial sequence; mitochondrial
          Length = 593

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 212 tttttggtgtagcaaaatgctttat 236
           ||||||||| |||||||||||||||
Sbjct: 495 tttttggtgaagcaaaatgctttat 471



to top

>gb|AY549650.1| Desmognathus monticola isolate VAJ4 12S ribosomal RNA gene, partial
           sequence; tRNA-Val gene, complete sequence; and 16S
           ribosomal RNA gene, partial sequence; mitochondrial
          Length = 596

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 212 tttttggtgtagcaaaatgctttat 236
           ||||||||| |||||||||||||||
Sbjct: 493 tttttggtgaagcaaaatgctttat 469



to top

>gb|AY549649.1| Desmognathus monticola isolate VAJ3 12S ribosomal RNA gene, partial
           sequence; tRNA-Val gene, complete sequence; and 16S
           ribosomal RNA gene, partial sequence; mitochondrial
          Length = 590

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 212 tttttggtgtagcaaaatgctttat 236
           ||||||||| |||||||||||||||
Sbjct: 496 tttttggtgaagcaaaatgctttat 472



to top

>gb|AF437350.1| Desmognathus ochrophaeus isolate OJN003OC_1 12S ribosomal RNA gene,
           partial sequence; tRNA-Val gene, complete sequence; and
           16S ribosomal RNA gene, partial sequence; mitochondrial
           genes for mitochondrial products
          Length = 596

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 212 tttttggtgtagcaaaatgctttat 236
           ||||||||| |||||||||||||||
Sbjct: 494 tttttggtgaagcaaaatgctttat 470



to top

>dbj|AP002439.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-691H4, complete
              sequence
          Length = 188604

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 329    gcctgggaaatgactccattc 349
              |||||||||||||||||||||
Sbjct: 178220 gcctgggaaatgactccattc 178240



to top

>dbj|AP005131.2| Homo sapiens genomic DNA, chromosome 18, clone:RP11-53B2, complete
             sequence
          Length = 162119

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 329   gcctgggaaatgactccattc 349
             |||||||||||||||||||||
Sbjct: 50686 gcctgggaaatgactccattc 50706



to top

>gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosome 13, complete sequence
          Length = 167328

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 214    tttggtgtagcaaaatgctt 233
              ||||||||||||||||||||
Sbjct: 137146 tttggtgtagcaaaatgctt 137127



to top

>gb|AC005711.2| Drosophila melanogaster clone BACR48M09, complete sequence
          Length = 165267

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   atggtcttgccatgccatct 292
             ||||||||||||||||||||
Sbjct: 27849 atggtcttgccatgccatct 27868



to top

>gb|AC124830.8| Mus musculus chromosome 17, clone RP24-165B21, complete sequence
          Length = 176889

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    ctctgcggcagagctgctgg 460
              ||||||||||||||||||||
Sbjct: 111118 ctctgcggcagagctgctgg 111137



to top

>ref|NM_198421.1| Mus musculus ubiquitin specific peptidase 49 (Usp49), mRNA
          Length = 5598

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 441  ctctgcggcagagctgctgg 460
            ||||||||||||||||||||
Sbjct: 1261 ctctgcggcagagctgctgg 1242



to top

>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence
          Length = 225556

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 213   ttttggtgtagcaaaatgctttat 236
             |||||| |||||||||||||||||
Sbjct: 91186 ttttggagtagcaaaatgctttat 91209



to top

>gb|BC060712.1| Mus musculus ubiquitin specific peptidase 49, mRNA (cDNA clone
            MGC:67320 IMAGE:6406180), complete cds
          Length = 5598

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 441  ctctgcggcagagctgctgg 460
            ||||||||||||||||||||
Sbjct: 1261 ctctgcggcagagctgctgg 1242



to top

>gb|AC139214.12| Mus musculus chromosome 17, clone RP23-345D6, complete sequence
          Length = 286283

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    ctctgcggcagagctgctgg 460
              ||||||||||||||||||||
Sbjct: 263380 ctctgcggcagagctgctgg 263361



to top

>gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complete sequence
          Length = 47702

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 337  aatgactccattcggttcca 356
            ||||||||||||||||||||
Sbjct: 6208 aatgactccattcggttcca 6227



to top

>tpg|BK003390.1| TPA: TPA_inf: Drosophila melanogaster HDC02164 (HDC02164) gene,
            complete cds
          Length = 2089

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 273  atggtcttgccatgccatct 292
            ||||||||||||||||||||
Sbjct: 1824 atggtcttgccatgccatct 1843



to top

>gb|AE012466.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 374
           of 460 of the complete genome
          Length = 10846

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 466 gtggcctggttctggctgct 485
           ||||||||||||||||||||
Sbjct: 747 gtggcctggttctggctgct 728



to top

>dbj|AK141369.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430041D04 product:ubiquitin
            specific protease 49, full insert sequence
          Length = 4812

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 441  ctctgcggcagagctgctgg 460
            ||||||||||||||||||||
Sbjct: 1454 ctctgcggcagagctgctgg 1435



to top

>gb|AC150442.2| Medicago truncatula chromosome 7 BAC clone mth2-2o12, complete sequence
          Length = 89504

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   cgctattttcaaatttttgg 218
             ||||||||||||||||||||
Sbjct: 29379 cgctattttcaaatttttgg 29360



to top

>gb|AC158529.2| Mus musculus BAC clone RP23-263H3 from chromosome 13, complete sequence
          Length = 172769

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    acagatggacagcagggctc 179
              ||||||||||||||||||||
Sbjct: 110186 acagatggacagcagggctc 110167



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 466    gtggcctggttctggctgct 485
              ||||||||||||||||||||
Sbjct: 835892 gtggcctggttctggctgct 835911



to top

>dbj|AK082872.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:C330046L10 product:hypothetical Ubiquitin
           carboxyl-terminal hydrolase family 2 containing protein,
           full insert sequence
          Length = 1444

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 441 ctctgcggcagagctgctgg 460
           ||||||||||||||||||||
Sbjct: 286 ctctgcggcagagctgctgg 267



to top

>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete
              sequence
          Length = 308012

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 273    atggtcttgccatgccatct 292
              ||||||||||||||||||||
Sbjct: 238627 atggtcttgccatgccatct 238646



to top

>emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chromosome 13, complete
             sequence
          Length = 219800

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   acagatggacagcagggctc 179
             ||||||||||||||||||||
Sbjct: 61762 acagatggacagcagggctc 61743



to top

>dbj|AP000795.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-876F8, complete
             sequence
          Length = 76999

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   caaatgcagagaaggccttc 377
             ||||||||||||||||||||
Sbjct: 31931 caaatgcagagaaggccttc 31912


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,051,896
Number of Sequences: 3902068
Number of extensions: 5051896
Number of successful extensions: 98212
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98038
Number of HSP's gapped (non-prelim): 174
length of query: 592
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 569
effective length of database: 17,143,297,704
effective search space: 9754536393576
effective search space used: 9754536393576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top