>gb|AC022352.5|AC022352 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0034E23, from chromosome 10, complete sequence
          Length = 139398

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 94    ttcagttcagcaaagttcccagccatcctngttgg 128
             ||||| |||||||| |||||||||||||| |||||
Sbjct: 30286 ttcaggtcagcaaaattcccagccatcctcgttgg 30252

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 94      ttcagttcagcaaagttcccagccatcctngttgg 128
               ||||| |||||||| |||||||||||||| |||||
Sbjct: 7724407 ttcaggtcagcaaaattcccagccatcctcgttgg 7724373

>dbj|AK069438.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022N13, full
            insert sequence
          Length = 3590

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 94   ttcagttcagcaaagttcccagccatcctngttgg 128
            ||||| |||||||| |||||||||||||| |||||
Sbjct: 3274 ttcaggtcagcaaaattcccagccatcctcgttgg 3240

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 94      ttcagttcagcaaagttcccagccatcctngttgg 128
               ||||| |||||||| |||||||||||||| |||||
Sbjct: 7729506 ttcaggtcagcaaaattcccagccatcctcgttgg 7729472

>ref|NM_195569.1| Oryza sativa (japonica cultivar-group) Conserved hypothetical protein
            (OSJNBa0034E23.6), mRNA
          Length = 1770

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 100  tcagcaaagttcccagccatcctngttgg 128
            |||||||| |||||||||||||| |||||
Sbjct: 1770 tcagcaaaattcccagccatcctcgttgg 1742

>ref|NM_120855.1| Arabidopsis thaliana unknown protein AT5G07730 mRNA, complete cds
          Length = 1004

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  atcttcagccatcttcagtt 100
           ||||||||||||||||||||
Sbjct: 59  atcttcagccatcttcagtt 40

>gb|AY350712.1| Arabidopsis arenosa clone BAC Aer6D24, complete sequence
          Length = 87863

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    atcttcagccatcttcagtt 100
             ||||||||||||||||||||
Sbjct: 86857 atcttcagccatcttcagtt 86876

>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
              gene for the ortholog of rat and human ubiquinol-cytochrome
              c reductase, Rieske iron-sulfur polypeptide 1 UQCRFS1, a
              novel gene and a CpG island, complete sequence
          Length = 194065

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 156    tcactgagcttgcaccttcactgt 179
              |||| |||||||||||||||||||
Sbjct: 130528 tcacagagcttgcaccttcactgt 130505

>gb|AY741371.1| Emiliania huxleyi strain CCMP 373 chloroplast, complete genome
          Length = 105309

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    attaccaccattttttattt 53
             ||||||||||||||||||||
Sbjct: 74534 attaccaccattttttattt 74515

>gb|AC091926.4| Homo sapiens chromosome 5 clone RP11-290G6, complete sequence
          Length = 209836

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     attaccaccattttttattt 53
              ||||||||||||||||||||
Sbjct: 155175 attaccaccattttttattt 155194

>gb|AY054599.1| Arabidopsis thaliana Unknown protein (At5g07730; MBK20.19) mRNA,
           complete cds
          Length = 1004

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  atcttcagccatcttcagtt 100
           ||||||||||||||||||||
Sbjct: 59  atcttcagccatcttcagtt 40

>gb|AF165124.1|AF165124 Homo sapiens chromosome 5q31.1-q33.1 clone BAC djn082c10 containing
             GABRG2 gene, complete sequence
          Length = 195909

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    attaccaccattttttattt 53
             ||||||||||||||||||||
Sbjct: 91433 attaccaccattttttattt 91452

>gb|AC108045.3| Homo sapiens BAC clone RP11-307L18 from 4, complete sequence
          Length = 74904

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    taccaccattttttatttat 55
             ||||||||||||||||||||
Sbjct: 21162 taccaccattttttatttat 21143

>dbj|AB010070.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK20
          Length = 78172

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    atcttcagccatcttcagtt 100
             ||||||||||||||||||||
Sbjct: 58860 atcttcagccatcttcagtt 58879


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,322,378
Number of Sequences: 3902068
Number of extensions: 2322378
Number of successful extensions: 35862
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35827
Number of HSP's gapped (non-prelim): 35
length of query: 235
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 213
effective length of database: 17,147,199,772
effective search space: 3652353551436
effective search space used: 3652353551436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)