Clone Information

BLAST Search Result

Clone Name	rbasd20o09
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|NM_195569.1\| Oryza sativa (japonica cultivar-group) Conserve...	291	2e-75
2	dbj\|AK069438.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	291	2e-75
3	gb\|AY596610.1\| Saccharum officinarum clone SCCCLR1C03A03, comple...	165	3e-37
4	gb\|AC022352.5\|AC022352 Genomic Sequence for Oryza sativa, Nippon...	159	2e-35
5	dbj\|AP008216.1\| Oryza sativa (japonica cultivar-group) genomic D...	159	2e-35
6	gb\|AE016959.3\| Oryza sativa (japonica cultivar-group) chromosome...	159	2e-35
7	gb\|AC158791.4\| Mus musculus chromosome 1, clone RP23-247C6, comp...	42	2.5
8	ref\|XM_738032.1\| Plasmodium chabaudi chabaudi hypothetical prote...	42	2.5
9	gb\|AC109240.30\| Mus musculus chromosome 1, clone RP23-445I23, co...	42	2.5
10	emb\|AL035687.13\|HS142O9 Human DNA sequence from clone RP1-142O9 ...	42	2.5
11	gb\|AC020571.9\| Homo sapiens BAC clone RP11-387H5 from 2, complet...	42	2.5
12	ref\|NM_120855.1\| Arabidopsis thaliana unknown protein AT5G07730 ...	40	9.9
13	gb\|AC005348.1\| Homo sapiens chromosome 5, BAC clone 118L13 (LBNL...	40	9.9
14	gb\|AY350712.1\| Arabidopsis arenosa clone BAC Aer6D24, complete s...	40	9.9
15	gb\|AC100208.16\| Mus musculus chromosome 7, clone RP23-59J14, com...	40	9.9
16	gb\|AC129300.3\| Mus musculus BAC clone RP24-427A8 from chromosome...	40	9.9
17	emb\|CR847884.6\| Zebrafish DNA sequence from clone CH211-161H23 i...	40	9.9
18	emb\|AL805961.22\| Human DNA sequence from clone RP11-718D19 on ch...	40	9.9
19	emb\|AL157765.6\| Human DNA sequence from clone RP11-408L13 on chr...	40	9.9
20	gb\|CP000087.1\| Rickettsia bellii RML369-C, complete genome	40	9.9
21	emb\|AL611944.10\| Mouse DNA sequence from clone RP23-279E14 on ch...	40	9.9
22	gb\|AY741371.1\| Emiliania huxleyi strain CCMP 373 chloroplast, co...	40	9.9
23	gb\|AC012630.7\| Homo sapiens chromosome 5 clone CTD-2158F3, compl...	40	9.9
24	gb\|AC103409.2\| Homo sapiens chromosome 8, clone RP11-1107H4, com...	40	9.9
25	gb\|AC011614.8\| Drosophila melanogaster, chromosome X, region 16F...	40	9.9
26	gb\|AC091926.4\| Homo sapiens chromosome 5 clone RP11-290G6, compl...	40	9.9
27	gb\|AY054599.1\| Arabidopsis thaliana Unknown protein (At5g07730; ...	40	9.9
28	gb\|AF165124.1\|AF165124 Homo sapiens chromosome 5q31.1-q33.1 clon...	40	9.9
29	tpg\|BK000438.1\| TPA: TPA_exp: Homo sapiens RING finger protein C...	40	9.9
30	gb\|AC148686.1\| Macaca mulatta Major Histocompatibility Complex B...	40	9.9
31	gb\|AC148665.1\| Macaca mulatta Major Histocompatibility Complex B...	40	9.9
32	gb\|AC022348.2\|AC022348 Drosophila melanogaster, chromosome X, re...	40	9.9
33	dbj\|AB128049.1\| Macaca mulatta genes, MHC class I region, partia...	40	9.9
34	gb\|AC084552.1\|CBRG33J07 Caenorhabditis briggsae cosmid G33J07, c...	40	9.9
35	gb\|AC018801.4\|AC018801 Homo sapiens BAC clone RP11-279O19 from 8...	40	9.9
36	gb\|AC108045.3\| Homo sapiens BAC clone RP11-307L18 from 4, comple...	40	9.9
37	dbj\|AB010070.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	9.9
38	emb\|AL732567.8\| Zebrafish DNA sequence from clone CH211-263A23 i...	40	9.9
39	gb\|AE003508.4\| Drosophila melanogaster chromosome X, section 60 ...	40	9.9
40	gb\|AC113498.9\| Mus musculus chromosome 1, clone RP23-366N18, com...	40	9.9
41	dbj\|AP003466.2\| Homo sapiens genomic DNA, chromosome 8q23, clone...	40	9.9
42	emb\|AL359265.8\| Human DNA sequence from clone RP11-195C7 on chro...	40	9.9
43	emb\|BX005130.10\| Mouse DNA sequence from clone RP23-475L14 on ch...	40	9.9
44	emb\|Y14715.1\|CMY14715 Choanomphalus microtrochus mitochondrial c...	40	9.9
45	emb\|Y14713.1\|CSY14713 Choanomphalus schrencki mitochondrial cyto...	40	9.9

>ref|NM_195569.1| Oryza sativa (japonica cultivar-group) Conserved hypothetical protein
            (OSJNBa0034E23.6), mRNA
          Length = 1770

 Score =  291 bits (147), Expect = 2e-75
 Identities = 252/287 (87%)
 Strand = Plus / Minus

                                                                        
Query: 410  actgtatgtttatctttagactcaacggcttcggtggtcctgtctgacgaactcgcactc 469
            ||||||||||||||| |||||||||| |||||  | | ||| || |  |||||| |||||
Sbjct: 1628 actgtatgtttatctgtagactcaactgcttcaatagccctatcagcagaactcccactc 1569

                                                                        
Query: 470  ttgtgaagcgaagaatgcagtgaagaggagagacttgacattgttgatcgctgcaacttg 529
            |||||||||||||| ||||| ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 1568 ttgtgaagcgaagattgcagcgaagaggagaggctcgacatttttgaccgctgtaacttg 1509

                                                                        
Query: 530  ctccaagataagcgctcatccactatttgcttgagttgagacacatcctcgcaaatgaca 589
            |   | ||||||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 1508 cagaacgataagcgctcatccactatttgtttgagttgggacacatcctcacagatcaca 1449

                                                                        
Query: 590  gccatctcaccttgtagtgtatcaacaatttgaccccgctcaaccaagaattccttcagc 649
            | |||||||||||| | ||||||||| |||||||||||||||||||||||| ||||||||
Sbjct: 1448 gtcatctcaccttgcaatgtatcaacgatttgaccccgctcaaccaagaatgccttcagc 1389

                                                           
Query: 650  ttcaaattctcctctgcttctttctgcaactttcttgattcttcaac 696
            || ||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 1388 tttaaattctcctcagcttctttctgcagctttcttgattcttcaac 1342



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 256  tcagcaaagttcccagccatcctcgttgg 284
            |||||||| ||||||||||||||||||||
Sbjct: 1770 tcagcaaaattcccagccatcctcgttgg 1742

to top

>dbj|AK069438.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022N13, full
            insert sequence
          Length = 3590

 Score =  291 bits (147), Expect = 2e-75
 Identities = 252/287 (87%)
 Strand = Plus / Minus

                                                                        
Query: 410  actgtatgtttatctttagactcaacggcttcggtggtcctgtctgacgaactcgcactc 469
            ||||||||||||||| |||||||||| |||||  | | ||| || |  |||||| |||||
Sbjct: 3126 actgtatgtttatctgtagactcaactgcttcaatagccctatcagcagaactcccactc 3067

                                                                        
Query: 470  ttgtgaagcgaagaatgcagtgaagaggagagacttgacattgttgatcgctgcaacttg 529
            |||||||||||||| ||||| ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 3066 ttgtgaagcgaagattgcagcgaagaggagaggctcgacatttttgaccgctgtaacttg 3007

                                                                        
Query: 530  ctccaagataagcgctcatccactatttgcttgagttgagacacatcctcgcaaatgaca 589
            |   | ||||||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 3006 cagaacgataagcgctcatccactatttgtttgagttgggacacatcctcacagatcaca 2947

                                                                        
Query: 590  gccatctcaccttgtagtgtatcaacaatttgaccccgctcaaccaagaattccttcagc 649
            | |||||||||||| | ||||||||| |||||||||||||||||||||||| ||||||||
Sbjct: 2946 gtcatctcaccttgcaatgtatcaacgatttgaccccgctcaaccaagaatgccttcagc 2887

                                                           
Query: 650  ttcaaattctcctctgcttctttctgcaactttcttgattcttcaac 696
            || ||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 2886 tttaaattctcctcagcttctttctgcagctttcttgattcttcaac 2840



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 250  ttcagttcagcaaagttcccagccatcctcgttgg 284
            ||||| |||||||| ||||||||||||||||||||
Sbjct: 3274 ttcaggtcagcaaaattcccagccatcctcgttgg 3240

to top

>gb|AY596610.1| Saccharum officinarum clone SCCCLR1C03A03, complete sequence
          Length = 1424

 Score =  165 bits (83), Expect = 3e-37
 Identities = 113/123 (91%)
 Strand = Plus / Plus

                                                                       
Query: 587 acagccatctcaccttgtagtgtatcaacaatttgaccccgctcaaccaagaattccttc 646
           ||||||||||||||||| ||  ||||||||||||| ||||||||||||||||||||||||
Sbjct: 544 acagccatctcaccttgcagcatatcaacaatttggccccgctcaaccaagaattccttc 603

                                                                       
Query: 647 agcttcaaattctcctctgcttctttctgcaactttcttgattcttcaacaatggaattc 706
           | |||||  |||||||| ||||||||||||| ||||||||||||||||||||| ||||||
Sbjct: 604 aacttcaggttctcctcagcttctttctgcagctttcttgattcttcaacaatagaattc 663

              
Query: 707 atc 709
           |||
Sbjct: 664 atc 666



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 agactcaacggcttcggtggtcctgtctgacgaactcgcactcttgtgaagcgaagaatg 486
           |||||| | ||||||||| ||||| || || ||||||   ||||||||| | ||||||||
Sbjct: 384 agactcgatggcttcggtagtcctatccgaggaactccagctcttgtgatgagaagaatg 443

                                                                       
Query: 487 cagtgaagaggagagacttgacattgttgatcgctgcaacttgctccaagataagcgctc 546
           ||||||||| ||||| || ||||| | ||| ||||||||| ||||| | |||| ||||||
Sbjct: 444 cagtgaagaagagaggctcgacatagctgagcgctgcaacctgctcaatgataggcgctc 503

                 
Query: 547 atccac 552
           ||||||
Sbjct: 504 atccac 509

to top

>gb|AC022352.5|AC022352 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0034E23, from chromosome 10, complete sequence
          Length = 139398

 Score =  159 bits (80), Expect = 2e-35
 Identities = 164/192 (85%)
 Strand = Plus / Minus

                                                                         
Query: 410   actgtatgtttatctttagactcaacggcttcggtggtcctgtctgacgaactcgcactc 469
             ||||||||||||||| |||||||||| |||||  | | ||| || |  |||||| |||||
Sbjct: 30138 actgtatgtttatctgtagactcaactgcttcaatagccctatcagcagaactcccactc 30079

                                                                         
Query: 470   ttgtgaagcgaagaatgcagtgaagaggagagacttgacattgttgatcgctgcaacttg 529
             |||||||||||||| ||||| ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 30078 ttgtgaagcgaagattgcagcgaagaggagaggctcgacatttttgaccgctgtaacttg 30019

                                                                         
Query: 530   ctccaagataagcgctcatccactatttgcttgagttgagacacatcctcgcaaatgaca 589
             |   | ||||||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 30018 cagaacgataagcgctcatccactatttgtttgagttgggacacatcctcacagatcaca 29959

                         
Query: 590   gccatctcacct 601
             | ||||||||||
Sbjct: 29958 gtcatctcacct 29947



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                         
Query: 607   tgtatcaacaatttgaccccgctcaaccaagaattccttcagct 650
             ||||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 29164 tgtatcaacgatttgaccccgctcaaccaagaatgccttcagct 29121



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                         
Query: 653   aaattctcctctgcttctttctgcaactttcttgattcttcaac 696
             ||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 28874 aaattctcctcagcttctttctgcagctttcttgattcttcaac 28831



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 250   ttcagttcagcaaagttcccagccatcctcgttgg 284
             ||||| |||||||| ||||||||||||||||||||
Sbjct: 30286 ttcaggtcagcaaaattcccagccatcctcgttgg 30252

to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score =  159 bits (80), Expect = 2e-35
 Identities = 164/192 (85%)
 Strand = Plus / Minus

                                                                           
Query: 410     actgtatgtttatctttagactcaacggcttcggtggtcctgtctgacgaactcgcactc 469
               ||||||||||||||| |||||||||| |||||  | | ||| || |  |||||| |||||
Sbjct: 7724259 actgtatgtttatctgtagactcaactgcttcaatagccctatcagcagaactcccactc 7724200

                                                                           
Query: 470     ttgtgaagcgaagaatgcagtgaagaggagagacttgacattgttgatcgctgcaacttg 529
               |||||||||||||| ||||| ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 7724199 ttgtgaagcgaagattgcagcgaagaggagaggctcgacatttttgaccgctgtaacttg 7724140

                                                                           
Query: 530     ctccaagataagcgctcatccactatttgcttgagttgagacacatcctcgcaaatgaca 589
               |   | ||||||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 7724139 cagaacgataagcgctcatccactatttgtttgagttgggacacatcctcacagatcaca 7724080

                           
Query: 590     gccatctcacct 601
               | ||||||||||
Sbjct: 7724079 gtcatctcacct 7724068



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                           
Query: 607     tgtatcaacaatttgaccccgctcaaccaagaattccttcagct 650
               ||||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 7723285 tgtatcaacgatttgaccccgctcaaccaagaatgccttcagct 7723242



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                           
Query: 653     aaattctcctctgcttctttctgcaactttcttgattcttcaac 696
               ||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 7722995 aaattctcctcagcttctttctgcagctttcttgattcttcaac 7722952



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 250     ttcagttcagcaaagttcccagccatcctcgttgg 284
               ||||| |||||||| ||||||||||||||||||||
Sbjct: 7724407 ttcaggtcagcaaaattcccagccatcctcgttgg 7724373

to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  159 bits (80), Expect = 2e-35
 Identities = 164/192 (85%)
 Strand = Plus / Minus

                                                                           
Query: 410     actgtatgtttatctttagactcaacggcttcggtggtcctgtctgacgaactcgcactc 469
               ||||||||||||||| |||||||||| |||||  | | ||| || |  |||||| |||||
Sbjct: 7729358 actgtatgtttatctgtagactcaactgcttcaatagccctatcagcagaactcccactc 7729299

                                                                           
Query: 470     ttgtgaagcgaagaatgcagtgaagaggagagacttgacattgttgatcgctgcaacttg 529
               |||||||||||||| ||||| ||||||||||| || |||||| |||| ||||| ||||||
Sbjct: 7729298 ttgtgaagcgaagattgcagcgaagaggagaggctcgacatttttgaccgctgtaacttg 7729239

                                                                           
Query: 530     ctccaagataagcgctcatccactatttgcttgagttgagacacatcctcgcaaatgaca 589
               |   | ||||||||||||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 7729238 cagaacgataagcgctcatccactatttgtttgagttgggacacatcctcacagatcaca 7729179

                           
Query: 590     gccatctcacct 601
               | ||||||||||
Sbjct: 7729178 gtcatctcacct 7729167



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                           
Query: 607     tgtatcaacaatttgaccccgctcaaccaagaattccttcagct 650
               ||||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 7728384 tgtatcaacgatttgaccccgctcaaccaagaatgccttcagct 7728341



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                           
Query: 653     aaattctcctctgcttctttctgcaactttcttgattcttcaac 696
               ||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 7728094 aaattctcctcagcttctttctgcagctttcttgattcttcaac 7728051



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 250     ttcagttcagcaaagttcccagccatcctcgttgg 284
               ||||| |||||||| ||||||||||||||||||||
Sbjct: 7729506 ttcaggtcagcaaaattcccagccatcctcgttgg 7729472

to top

>gb|AC158791.4| Mus musculus chromosome 1, clone RP23-247C6, complete sequence
          Length = 218755

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 398   gcaactccagtgactgtatgtttatcttt 426
             ||||||||||||| || ||||||||||||
Sbjct: 92008 gcaactccagtgattgaatgtttatcttt 92036

to top

>ref|XM_738032.1| Plasmodium chabaudi chabaudi hypothetical protein (PC300960.00.0)
           partial mRNA
          Length = 957

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 185 cgattattaccaccattttttattt 209
           |||||||||||| ||||||||||||
Sbjct: 650 cgattattaccatcattttttattt 626

to top

>gb|AC109240.30| Mus musculus chromosome 1, clone RP23-445I23, complete sequence
          Length = 189545

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 398   gcaactccagtgactgtatgtttatcttt 426
             ||||||||||||| || ||||||||||||
Sbjct: 46194 gcaactccagtgattgaatgtttatcttt 46166

to top

>emb|AL035687.13|HS142O9 Human DNA sequence from clone RP1-142O9 on chromosome 6p11.1-12.3
              Contains a eukaryotic translation elongation factor 1 alpha
              1 (EEF1A1) pseudogene and a zinc finger (ZNF216)
              pseudogene, complete sequence
          Length = 131546

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 657    tctcctctgcttctttctgca 677
              |||||||||||||||||||||
Sbjct: 127123 tctcctctgcttctttctgca 127103

to top

>gb|AC020571.9| Homo sapiens BAC clone RP11-387H5 from 2, complete sequence
          Length = 165106

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 403    tccagtgactgtatgtttatcttta 427
              ||||||||||||| |||||||||||
Sbjct: 156092 tccagtgactgtaggtttatcttta 156068

to top

>ref|NM_120855.1| Arabidopsis thaliana unknown protein AT5G07730 mRNA, complete cds
          Length = 1004

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 atcttcagccatcttcagtt 256
           ||||||||||||||||||||
Sbjct: 59  atcttcagccatcttcagtt 40

to top

>gb|AC005348.1| Homo sapiens chromosome 5, BAC clone 118L13 (LBNL H176), complete
             sequence
          Length = 84132

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 559   cttgagttgagacacatcct 578
             ||||||||||||||||||||
Sbjct: 79792 cttgagttgagacacatcct 79773

to top

>gb|AY350712.1| Arabidopsis arenosa clone BAC Aer6D24, complete sequence
          Length = 87863

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 237   atcttcagccatcttcagtt 256
             ||||||||||||||||||||
Sbjct: 86857 atcttcagccatcttcagtt 86876

to top

>gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, complete sequence
          Length = 280763

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 394   ccctgcaactccagtgactg 413
             ||||||||||||||||||||
Sbjct: 65637 ccctgcaactccagtgactg 65618

to top

>gb|AC129300.3| Mus musculus BAC clone RP24-427A8 from chromosome 7, complete sequence
          Length = 155123

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 394   ccctgcaactccagtgactg 413
             ||||||||||||||||||||
Sbjct: 16230 ccctgcaactccagtgactg 16249

to top

>emb|CR847884.6| Zebrafish DNA sequence from clone CH211-161H23 in linkage group 1,
              complete sequence
          Length = 157311

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      tttatttatactatagatta 25
              ||||||||||||||||||||
Sbjct: 144071 tttatttatactatagatta 144052

to top

>emb|AL805961.22| Human DNA sequence from clone RP11-718D19 on chromosome 1, complete
             sequence
          Length = 166258

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 652   caaattctcctctgcttctttctg 675
             |||||||||||||||||| |||||
Sbjct: 66059 caaattctcctctgcttccttctg 66036

to top

>emb|AL157765.6| Human DNA sequence from clone RP11-408L13 on chromosome 13, complete
             sequence
          Length = 129654

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 475   aagcgaagaatgcagtgaag 494
             ||||||||||||||||||||
Sbjct: 16008 aagcgaagaatgcagtgaag 15989

to top

>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 677    aactttcttgattcttcaac 696
              ||||||||||||||||||||
Sbjct: 677234 aactttcttgattcttcaac 677215

to top

>emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on chromosome 13 Contains the
              gene for the ortholog of rat and human ubiquinol-cytochrome
              c reductase, Rieske iron-sulfur polypeptide 1 UQCRFS1, a
              novel gene and a CpG island, complete sequence
          Length = 194065

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 312    tcactgagcttgcaccttcactgt 335
              |||| |||||||||||||||||||
Sbjct: 130528 tcacagagcttgcaccttcactgt 130505

to top

>gb|AY741371.1| Emiliania huxleyi strain CCMP 373 chloroplast, complete genome
          Length = 105309

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   attaccaccattttttattt 209
             ||||||||||||||||||||
Sbjct: 74534 attaccaccattttttattt 74515

to top

>gb|AC012630.7| Homo sapiens chromosome 5 clone CTD-2158F3, complete sequence
          Length = 70065

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 559   cttgagttgagacacatcct 578
             ||||||||||||||||||||
Sbjct: 30329 cttgagttgagacacatcct 30348

to top

>gb|AC103409.2| Homo sapiens chromosome 8, clone RP11-1107H4, complete sequence
          Length = 210230

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 128    aagtcctggaaatataagttcact 151
              |||||||| |||||||||||||||
Sbjct: 122118 aagtcctgcaaatataagttcact 122141

to top

>gb|AC011614.8| Drosophila melanogaster, chromosome X, region 16F-17A, BAC clone
            BACR48L05, complete sequence
          Length = 177138

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 96   ccgccacccaaaaggccaag 115
            ||||||||||||||||||||
Sbjct: 2597 ccgccacccaaaaggccaag 2578

to top

>gb|AC091926.4| Homo sapiens chromosome 5 clone RP11-290G6, complete sequence
          Length = 209836

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 190    attaccaccattttttattt 209
              ||||||||||||||||||||
Sbjct: 155175 attaccaccattttttattt 155194

to top

>gb|AY054599.1| Arabidopsis thaliana Unknown protein (At5g07730; MBK20.19) mRNA,
           complete cds
          Length = 1004

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 atcttcagccatcttcagtt 256
           ||||||||||||||||||||
Sbjct: 59  atcttcagccatcttcagtt 40

to top

>gb|AF165124.1|AF165124 Homo sapiens chromosome 5q31.1-q33.1 clone BAC djn082c10 containing
             GABRG2 gene, complete sequence
          Length = 195909

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   attaccaccattttttattt 209
             ||||||||||||||||||||
Sbjct: 91433 attaccaccattttttattt 91452

to top

>tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein COP1 gene, complete cds
          Length = 421987

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      ttatttatactatagattaa 26
              ||||||||||||||||||||
Sbjct: 137526 ttatttatactatagattaa 137507

to top

>gb|AC148686.1| Macaca mulatta Major Histocompatibility Complex BAC MMU192G09, complete
              sequence
          Length = 181166

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 656    ttctcctctgcttctttctg 675
              ||||||||||||||||||||
Sbjct: 156591 ttctcctctgcttctttctg 156610

to top

>gb|AC148665.1| Macaca mulatta Major Histocompatibility Complex BAC MMU023M02,
            complete sequence
          Length = 182939

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 656  ttctcctctgcttctttctg 675
            ||||||||||||||||||||
Sbjct: 1697 ttctcctctgcttctttctg 1716

to top

>gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, region 17E-18A, BAC clone
             BACR32F24, complete sequence
          Length = 162307

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 96    ccgccacccaaaaggccaag 115
             ||||||||||||||||||||
Sbjct: 46900 ccgccacccaaaaggccaag 46919

to top

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 656    ttctcctctgcttctttctg 675
              ||||||||||||||||||||
Sbjct: 680058 ttctcctctgcttctttctg 680039

to top

>gb|AC084552.1|CBRG33J07 Caenorhabditis briggsae cosmid G33J07, complete sequence
          Length = 37298

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 296   ttgctgttgtcttcactcac 315
             ||||||||||||||||||||
Sbjct: 36448 ttgctgttgtcttcactcac 36429

to top

>gb|AC018801.4|AC018801 Homo sapiens BAC clone RP11-279O19 from 8, complete sequence
          Length = 177130

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 415   atgtttatctttagactcaa 434
             ||||||||||||||||||||
Sbjct: 39738 atgtttatctttagactcaa 39757

to top

>gb|AC108045.3| Homo sapiens BAC clone RP11-307L18 from 4, complete sequence
          Length = 74904

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   taccaccattttttatttat 211
             ||||||||||||||||||||
Sbjct: 21162 taccaccattttttatttat 21143

to top

>dbj|AB010070.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK20
          Length = 78172

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 237   atcttcagccatcttcagtt 256
             ||||||||||||||||||||
Sbjct: 58860 atcttcagccatcttcagtt 58879

to top

>emb|AL732567.8| Zebrafish DNA sequence from clone CH211-263A23 in linkage group 6,
              complete sequence
          Length = 152840

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    aaatataagttcactaattt 156
              ||||||||||||||||||||
Sbjct: 135437 aaatataagttcactaattt 135456

to top

>gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 of 74 of the complete
             sequence
          Length = 290619

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 96    ccgccacccaaaaggccaag 115
             ||||||||||||||||||||
Sbjct: 83494 ccgccacccaaaaggccaag 83513

to top

>gb|AC113498.9| Mus musculus chromosome 1, clone RP23-366N18, complete sequence
          Length = 206252

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   gccaagctattccatgacaa 129
             ||||||||||||||||||||
Sbjct: 61924 gccaagctattccatgacaa 61905

to top

>dbj|AP003466.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1047C11
          Length = 154371

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   atgtttatctttagactcaa 434
             ||||||||||||||||||||
Sbjct: 14811 atgtttatctttagactcaa 14792

to top

>emb|AL359265.8| Human DNA sequence from clone RP11-195C7 on chromosome 1 Contains the
             5' end of the gene for constitutive photomorphogenic
             protein (COP1), a novel gene, a ribosomal protein L13
             (RPL13) pseudogene, a novel pseudogene and a CpG island,
             complete sequence
          Length = 155805

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     ttatttatactatagattaa 26
             ||||||||||||||||||||
Sbjct: 18280 ttatttatactatagattaa 18299

to top

>emb|BX005130.10| Mouse DNA sequence from clone RP23-475L14 on chromosome 2, complete
             sequence
          Length = 127298

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   aagtcctggaaatataagtt 147
             ||||||||||||||||||||
Sbjct: 72501 aagtcctggaaatataagtt 72482

to top

>emb|Y14715.1|CMY14715 Choanomphalus microtrochus mitochondrial cytochrome c oxidase
           subunit I gene, partial
          Length = 591

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 186 gattattaccaccattttttattt 209
           ||||||||||||||| ||||||||
Sbjct: 236 gattattaccaccatcttttattt 259

to top

>emb|Y14713.1|CSY14713 Choanomphalus schrencki mitochondrial cytochrome c oxidase subunit
           I gene, partial
          Length = 572

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 186 gattattaccaccattttttattt 209
           ||||||||||||||| ||||||||
Sbjct: 236 gattattaccaccatcttttattt 259


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,921,787
Number of Sequences: 3902068
Number of extensions: 7921787
Number of successful extensions: 161021
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 160766
Number of HSP's gapped (non-prelim): 255
length of query: 721
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 698
effective length of database: 17,143,297,704
effective search space: 11966021797392
effective search space used: 11966021797392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result