ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd21c22 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475831.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 300 Score = 313 bits (158), Expect = 4e-82 Identities = 250/278 (89%), Gaps = 2/278 (0%) Strand = Plus / Minus Query: 351 tcatggagcaacacgtactcccggctactattgccaaacttaatgttgtccctttcgaag 410 ||||| ||||| || |||||||||||||||||||||||||||||| | ||| |||| ||| Sbjct: 284 tcatgaagcaaaacatactcccggctactattgccaaacttaatggtatccttttcaaag 225 Query: 411 agttcgtagtagcggagggactcaacacgattctcattgatgaaagtcccgttggtacta 470 ||||| ||||| ||| || ||||| |||||||||||| |||||||| || ||||||||| Sbjct: 224 agttcatagtaacggctgggctcaatacgattctcattaatgaaagttccattggtacta 165 Query: 471 ccaagatccatcagataaggcctcacttgctttgacatcatgccattctggttgctcctt 530 ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| Sbjct: 164 ccaagatccatcagataaggcctcacttgctttgacatcatgcca-tctggctgctcctt 106 Query: 531 ctctacaagtctgtattgaagaactgcatgttgcttgctgcaggagggatgggtctgtgg 590 |||||||||||| |||||||||||||||||||| || ||||||||||||| | ||| ||| Sbjct: 105 ctctacaagtctatattgaagaactgcatgttgtttactgcaggagggat-gatctatgg 47 Query: 591 ggatatctgcaattctcctttcccttccaaaaaggtag 628 |||| ||||||| | ||| ||||||||||||||||||| Sbjct: 46 ggatgtctgcaactttccgttcccttccaaaaaggtag 9
>gb|AY107711.1| Zea mays PCO111767 mRNA sequence Length = 810 Score = 278 bits (140), Expect = 2e-71 Identities = 305/356 (85%), Gaps = 3/356 (0%) Strand = Plus / Minus Query: 354 tggagcaacacgtactcccggctactattgccaaacttaatgttgtccctttcgaagagt 413 |||||||| || |||||||||||||||||||||||||| || ||||| |||| || | Sbjct: 477 tggagcaaaacatactcccggctactattgccaaacttgattgtgtccttttcaaataac 418 Query: 414 tcgtagtagcggagggactcaacacgattctcattgatgaaagtcccgttggtactacca 473 || || || || | | ||||| ||||| ||||||||||||| || || |||||| || Sbjct: 417 tcataatatcgccgaggctcaatgcgatttccattgatgaaagttccatttgtactatca 358 Query: 474 agatccatcagataaggcctcacttgctttgacatcatgccattctggttgctccttctc 533 |||||||||||||||||||| | || ||||| ||||||||||| || ||||||||||||| Sbjct: 357 agatccatcagataaggccttattttctttgtcatcatgccat-ctagttgctccttctc 299 Query: 534 tacaagtctgtattgaagaactgcatgttgcttgctgcaggagggatgggtctgtgggga 593 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| Sbjct: 298 cacaagtctgtattgaagaactgcatgttgcttgctgcaggagggat-gatctgtgggga 240 Query: 594 tatctgcaattctcctttcccttccaaaaaggtagtggctcatgcgatgaacatacaacg 653 |||||||| | ||||||| ||||||||||||||| | |||| ||||||||||||| | Sbjct: 239 catctgcaactttcctttctcttccaaaaaggtagcaggtcatccgatgaacatacagtg 180 Query: 654 gttcatttcagtgcttcaccacccttgaatacatagagtctccatctaatatctga 709 ||||| ||||||| ||||||| | || ||||||||||| ||||||||||| ||||| Sbjct: 179 gttca-ttcagtggttcaccatctttaaatacatagagcctccatctaatctctga 125
>gb|AC104278.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1345_B12, complete sequence Length = 119909 Score = 115 bits (58), Expect = 2e-22 Identities = 101/114 (88%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 544 tattgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaat 603 ||||||||||||||||||||||| ||||||||||||| | ||||||||||| ||||||| Sbjct: 42909 tattgaagaactgcatgttgcttactgcaggagggat-gatctgtggggatgtctgcaac 42851 Query: 604 tctcctttcccttccaaaaaggtagtggctcatgcgatgaacatacaacggttc 657 | ||| ||||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 42850 tttccgttcccttccaaaaaggtagctgctcatccggtgaacatataatggttc 42797 Score = 99.6 bits (50), Expect = 1e-17 Identities = 99/114 (86%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 544 tattgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaat 603 |||||||||||||||||||| || ||||||||||||| | ||| ||||||| ||||||| Sbjct: 71411 tattgaagaactgcatgttgtttactgcaggagggat-gatctatggggatgtctgcaac 71353 Query: 604 tctcctttcccttccaaaaaggtagtggctcatgcgatgaacatacaacggttc 657 | ||| ||||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 71352 tttccgttcccttccaaaaaggtagctgctcatccggtgaacatataatggttc 71299 Score = 81.8 bits (41), Expect = 3e-12 Identities = 51/53 (96%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 491 cctcacttgctttgacatcatgccattctggttgctccttctctacaagtctg 543 ||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 71825 cctcacttgctttgacatcatgcca-tctggctgctccttctctacaagtctg 71774 Score = 81.8 bits (41), Expect = 3e-12 Identities = 51/53 (96%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 491 cctcacttgctttgacatcatgccattctggttgctccttctctacaagtctg 543 ||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 43327 cctcacttgctttgacatcatgcca-tctggctgctccttctctacaagtctg 43276 Score = 75.8 bits (38), Expect = 2e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 663 agtgcttcaccacccttgaatacatagagtctccatctaatatctgatttgcga 716 |||| ||||||||||||||| || ||||||||||||||||||||||| |||||| Sbjct: 41848 agtggttcaccacccttgaagacgtagagtctccatctaatatctgacttgcga 41795 Score = 73.8 bits (37), Expect = 7e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 445 cattgatgaaagtcccgttggtactaccaagatccatcagataaggcct 493 |||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 71989 cattaatgaaagttccattggtactaccaagatccatcagataaggcct 71941 Score = 73.8 bits (37), Expect = 7e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 445 cattgatgaaagtcccgttggtactaccaagatccatcagataaggcct 493 |||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 43490 cattaatgaaagttccattggtactaccaagatccatcagataaggcct 43442 Score = 61.9 bits (31), Expect = 3e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 375 ctactattgccaaacttaatgttgtccctttcgaagagttcgtagtagcggagggactca 434 ||||||||||||||||||||| | ||| |||| |||||||| ||||| ||| || |||| Sbjct: 72162 ctactattgccaaacttaatggtatccttttcaaagagttcatagtaacggctgggctca 72103 Query: 435 acacgattctc 445 | ||||||||| Sbjct: 72102 atacgattctc 72092 Score = 54.0 bits (27), Expect = 7e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 375 ctactattgccaaacttaatgttgtccctttcgaagagttcgtagtagcggagggactca 434 ||||||||||||||||||||| | ||| |||| |||||||| || || ||| || |||| Sbjct: 43663 ctactattgccaaacttaatggtatccttttcaaagagttcataataacggctgggctca 43604 Query: 435 acacgattctc 445 | ||||||||| Sbjct: 43603 atacgattctc 43593 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79414 tatgtatgtatgtatgtatgt 79434 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79410 tatgtatgtatgtatgtatgt 79430
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 115 bits (58), Expect = 2e-22 Identities = 101/114 (88%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 544 tattgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaat 603 ||||||||||||||||||||||| ||||||||||||| | ||||||||||| ||||||| Sbjct: 26890477 tattgaagaactgcatgttgcttactgcaggagggat-gatctgtggggatgtctgcaac 26890419 Query: 604 tctcctttcccttccaaaaaggtagtggctcatgcgatgaacatacaacggttc 657 | ||| ||||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 26890418 tttccgttcccttccaaaaaggtagctgctcatccggtgaacatataatggttc 26890365 Score = 99.6 bits (50), Expect = 1e-17 Identities = 99/114 (86%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 544 tattgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaat 603 |||||||||||||||||||| || ||||||||||||| | ||| ||||||| ||||||| Sbjct: 26918979 tattgaagaactgcatgttgtttactgcaggagggat-gatctatggggatgtctgcaac 26918921 Query: 604 tctcctttcccttccaaaaaggtagtggctcatgcgatgaacatacaacggttc 657 | ||| ||||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 26918920 tttccgttcccttccaaaaaggtagctgctcatccggtgaacatataatggttc 26918867 Score = 81.8 bits (41), Expect = 3e-12 Identities = 51/53 (96%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 491 cctcacttgctttgacatcatgccattctggttgctccttctctacaagtctg 543 ||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 26919393 cctcacttgctttgacatcatgcca-tctggctgctccttctctacaagtctg 26919342 Score = 81.8 bits (41), Expect = 3e-12 Identities = 51/53 (96%), Gaps = 1/53 (1%) Strand = Plus / Minus Query: 491 cctcacttgctttgacatcatgccattctggttgctccttctctacaagtctg 543 ||||||||||||||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 26890895 cctcacttgctttgacatcatgcca-tctggctgctccttctctacaagtctg 26890844 Score = 75.8 bits (38), Expect = 2e-10 Identities = 50/54 (92%) Strand = Plus / Minus Query: 663 agtgcttcaccacccttgaatacatagagtctccatctaatatctgatttgcga 716 |||| ||||||||||||||| || ||||||||||||||||||||||| |||||| Sbjct: 26889416 agtggttcaccacccttgaagacgtagagtctccatctaatatctgacttgcga 26889363 Score = 73.8 bits (37), Expect = 7e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 445 cattgatgaaagtcccgttggtactaccaagatccatcagataaggcct 493 |||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 26919557 cattaatgaaagttccattggtactaccaagatccatcagataaggcct 26919509 Score = 73.8 bits (37), Expect = 7e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 445 cattgatgaaagtcccgttggtactaccaagatccatcagataaggcct 493 |||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 26891058 cattaatgaaagttccattggtactaccaagatccatcagataaggcct 26891010 Score = 61.9 bits (31), Expect = 3e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 375 ctactattgccaaacttaatgttgtccctttcgaagagttcgtagtagcggagggactca 434 ||||||||||||||||||||| | ||| |||| |||||||| ||||| ||| || |||| Sbjct: 26919730 ctactattgccaaacttaatggtatccttttcaaagagttcatagtaacggctgggctca 26919671 Query: 435 acacgattctc 445 | ||||||||| Sbjct: 26919670 atacgattctc 26919660 Score = 54.0 bits (27), Expect = 7e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 375 ctactattgccaaacttaatgttgtccctttcgaagagttcgtagtagcggagggactca 434 ||||||||||||||||||||| | ||| |||| |||||||| || || ||| || |||| Sbjct: 26891231 ctactattgccaaacttaatggtatccttttcaaagagttcataataacggctgggctca 26891172 Query: 435 acacgattctc 445 | ||||||||| Sbjct: 26891171 atacgattctc 26891161 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtgg 169 ||||||||||||||||||||||| Sbjct: 16244671 tatgtatgtatgtatgtatgtgg 16244649 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 24598282 tatgtatgtatgtatgtatgtg 24598303 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtat 165 |||||||||||||||||||||| Sbjct: 21854759 atctatgtatgtatgtatgtat 21854738 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 21842225 tatgtatgtatgtatgtatgtg 21842204 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26926982 tatgtatgtatgtatgtatgt 26927002 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26926978 tatgtatgtatgtatgtatgt 26926998 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545761 tatgtatgtatgtatgtatgt 25545781 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545757 tatgtatgtatgtatgtatgt 25545777 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545753 tatgtatgtatgtatgtatgt 25545773 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545749 tatgtatgtatgtatgtatgt 25545769 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545745 tatgtatgtatgtatgtatgt 25545765 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25545741 tatgtatgtatgtatgtatgt 25545761 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24699393 tatgtatgtatgtatgtatgt 24699373 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24699389 tatgtatgtatgtatgtatgt 24699369 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24699385 tatgtatgtatgtatgtatgt 24699365 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614894 tatgtatgtatgtatgtatgt 24614874 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614890 tatgtatgtatgtatgtatgt 24614870 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614886 tatgtatgtatgtatgtatgt 24614866 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614882 tatgtatgtatgtatgtatgt 24614862 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614878 tatgtatgtatgtatgtatgt 24614858 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614874 tatgtatgtatgtatgtatgt 24614854 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614870 tatgtatgtatgtatgtatgt 24614850 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614866 tatgtatgtatgtatgtatgt 24614846 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614862 tatgtatgtatgtatgtatgt 24614842 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24614858 tatgtatgtatgtatgtatgt 24614838 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24598278 tatgtatgtatgtatgtatgt 24598298 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24598274 tatgtatgtatgtatgtatgt 24598294 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24598270 tatgtatgtatgtatgtatgt 24598290 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24597599 tatgtatgtatgtatgtatgt 24597579 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24597595 tatgtatgtatgtatgtatgt 24597575 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572439 tatgtatgtatgtatgtatgt 23572419 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572435 tatgtatgtatgtatgtatgt 23572415 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572431 tatgtatgtatgtatgtatgt 23572411 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572427 tatgtatgtatgtatgtatgt 23572407 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572423 tatgtatgtatgtatgtatgt 23572403 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572419 tatgtatgtatgtatgtatgt 23572399 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572415 tatgtatgtatgtatgtatgt 23572395 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572411 tatgtatgtatgtatgtatgt 23572391 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572407 tatgtatgtatgtatgtatgt 23572387 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572403 tatgtatgtatgtatgtatgt 23572383 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572399 tatgtatgtatgtatgtatgt 23572379 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572395 tatgtatgtatgtatgtatgt 23572375 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572391 tatgtatgtatgtatgtatgt 23572371 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572387 tatgtatgtatgtatgtatgt 23572367 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572383 tatgtatgtatgtatgtatgt 23572363 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572379 tatgtatgtatgtatgtatgt 23572359 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572375 tatgtatgtatgtatgtatgt 23572355 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572371 tatgtatgtatgtatgtatgt 23572351 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572367 tatgtatgtatgtatgtatgt 23572347 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572363 tatgtatgtatgtatgtatgt 23572343 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572359 tatgtatgtatgtatgtatgt 23572339 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572355 tatgtatgtatgtatgtatgt 23572335 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572351 tatgtatgtatgtatgtatgt 23572331 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572347 tatgtatgtatgtatgtatgt 23572327 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572319 tatgtatgtatgtatgtatgt 23572299 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23572315 tatgtatgtatgtatgtatgt 23572295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23571425 tatgtatgtatgtatgtatgt 23571405 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842297 tatgtatgtatgtatgtatgt 21842277 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842293 tatgtatgtatgtatgtatgt 21842273 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842289 tatgtatgtatgtatgtatgt 21842269 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842285 tatgtatgtatgtatgtatgt 21842265 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842281 tatgtatgtatgtatgtatgt 21842261 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842277 tatgtatgtatgtatgtatgt 21842257 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842273 tatgtatgtatgtatgtatgt 21842253 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842269 tatgtatgtatgtatgtatgt 21842249 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842265 tatgtatgtatgtatgtatgt 21842245 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842261 tatgtatgtatgtatgtatgt 21842241 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842257 tatgtatgtatgtatgtatgt 21842237 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842253 tatgtatgtatgtatgtatgt 21842233 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842249 tatgtatgtatgtatgtatgt 21842229 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842245 tatgtatgtatgtatgtatgt 21842225 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842241 tatgtatgtatgtatgtatgt 21842221 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842237 tatgtatgtatgtatgtatgt 21842217 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842233 tatgtatgtatgtatgtatgt 21842213 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21842229 tatgtatgtatgtatgtatgt 21842209 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21796711 tatgtatgtatgtatgtatgt 21796731 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21796707 tatgtatgtatgtatgtatgt 21796727 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21046160 tatgtatgtatgtatgtatgt 21046140 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16244691 tatgtatgtatgtatgtatgt 16244671 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16244687 tatgtatgtatgtatgtatgt 16244667 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16244683 tatgtatgtatgtatgtatgt 16244663 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16244679 tatgtatgtatgtatgtatgt 16244659 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16244675 tatgtatgtatgtatgtatgt 16244655 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15014763 tatgtatgtatgtatgtatgt 15014743 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15014759 tatgtatgtatgtatgtatgt 15014739 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15014755 tatgtatgtatgtatgtatgt 15014735 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15014751 tatgtatgtatgtatgtatgt 15014731 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggctacaa 175 ||||||||||||||||||| ||| ||||| Sbjct: 14640687 tatgtatgtatgtatgtatttggatacaa 14640715 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14640683 tatgtatgtatgtatgtatgt 14640703 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13510640 tatgtatgtatgtatgtatgt 13510620 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13227066 tatgtatgtatgtatgtatgt 13227086 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13227062 tatgtatgtatgtatgtatgt 13227082 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13226944 tatgtatgtatgtatgtatgt 13226964 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13226940 tatgtatgtatgtatgtatgt 13226960 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13226936 tatgtatgtatgtatgtatgt 13226956 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13226932 tatgtatgtatgtatgtatgt 13226952 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 107 aagccagcaaacaaacaaaaaatcc 131 ||||||| ||||||||||||||||| Sbjct: 12846518 aagccagtaaacaaacaaaaaatcc 12846542 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464806 tatgtatgtatgtatgtatgt 12464826 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464802 tatgtatgtatgtatgtatgt 12464822 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464798 tatgtatgtatgtatgtatgt 12464818 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464794 tatgtatgtatgtatgtatgt 12464814 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464790 tatgtatgtatgtatgtatgt 12464810 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464786 tatgtatgtatgtatgtatgt 12464806 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 12464782 tatgtatgtatgtatgtatgt 12464802 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10923236 tatgtatgtatgtatgtatgt 10923256 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10923232 tatgtatgtatgtatgtatgt 10923252 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10923228 tatgtatgtatgtatgtatgt 10923248 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10923224 tatgtatgtatgtatgtatgt 10923244 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10923220 tatgtatgtatgtatgtatgt 10923240 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379361 tatgtatgtatgtatgtatgt 9379341 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379357 tatgtatgtatgtatgtatgt 9379337 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379353 tatgtatgtatgtatgtatgt 9379333 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379349 tatgtatgtatgtatgtatgt 9379329 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379345 tatgtatgtatgtatgtatgt 9379325 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379341 tatgtatgtatgtatgtatgt 9379321 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379337 tatgtatgtatgtatgtatgt 9379317 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379333 tatgtatgtatgtatgtatgt 9379313 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379329 tatgtatgtatgtatgtatgt 9379309 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379325 tatgtatgtatgtatgtatgt 9379305 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9379321 tatgtatgtatgtatgtatgt 9379301 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7426576 tatgtatgtatgtatgtatgt 7426556 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5796099 tatgtatgtatgtatgtatgt 5796119 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746456 tatgtatgtatgtatgtatgt 5746476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746452 tatgtatgtatgtatgtatgt 5746472 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746448 tatgtatgtatgtatgtatgt 5746468 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746444 tatgtatgtatgtatgtatgt 5746464 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746440 tatgtatgtatgtatgtatgt 5746460 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746436 tatgtatgtatgtatgtatgt 5746456 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5746432 tatgtatgtatgtatgtatgt 5746452 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215842 tatgtatgtatgtatgtatgt 5215862 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215810 tatgtatgtatgtatgtatgt 5215830 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215806 tatgtatgtatgtatgtatgt 5215826 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215774 tatgtatgtatgtatgtatgt 5215794 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215752 tatgtatgtatgtatgtatgt 5215772 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215748 tatgtatgtatgtatgtatgt 5215768 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215720 tatgtatgtatgtatgtatgt 5215740 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215716 tatgtatgtatgtatgtatgt 5215736 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215712 tatgtatgtatgtatgtatgt 5215732 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215684 tatgtatgtatgtatgtatgt 5215704 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215680 tatgtatgtatgtatgtatgt 5215700 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215676 tatgtatgtatgtatgtatgt 5215696 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5215648 tatgtatgtatgtatgtatgt 5215668 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4746237 tatgtatgtatgtatgtatgt 4746257 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4746233 tatgtatgtatgtatgtatgt 4746253 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4746229 tatgtatgtatgtatgtatgt 4746249 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4746225 tatgtatgtatgtatgtatgt 4746245 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4746221 tatgtatgtatgtatgtatgt 4746241 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328036 tatgtatgtatgtatgtatgt 328056 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328032 tatgtatgtatgtatgtatgt 328052 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328028 tatgtatgtatgtatgtatgt 328048 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328024 tatgtatgtatgtatgtatgt 328044 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328020 tatgtatgtatgtatgtatgt 328040 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328016 tatgtatgtatgtatgtatgt 328036 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328012 tatgtatgtatgtatgtatgt 328032 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328008 tatgtatgtatgtatgtatgt 328028 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328004 tatgtatgtatgtatgtatgt 328024 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 328000 tatgtatgtatgtatgtatgt 328020 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 327996 tatgtatgtatgtatgtatgt 328016 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 195580 tatgtatgtatgtatgtatgt 195560 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162869 tatgtatgtatgtatgtatgt 162889 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162865 tatgtatgtatgtatgtatgt 162885 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162861 tatgtatgtatgtatgtatgt 162881 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162857 tatgtatgtatgtatgtatgt 162877 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162853 tatgtatgtatgtatgtatgt 162873 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162849 tatgtatgtatgtatgtatgt 162869 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162845 tatgtatgtatgtatgtatgt 162865 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162841 tatgtatgtatgtatgtatgt 162861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162837 tatgtatgtatgtatgtatgt 162857 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162833 tatgtatgtatgtatgtatgt 162853 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 20316090 atgtatgtatgtatgtatgt 20316071 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 7426579 atgtatgtatgtatgtatgt 7426560 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 328040 tatgtatgtatgtatgtatg 328059 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 162873 tatgtatgtatgtatgtatg 162892 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 162830 atgtatgtatgtatgtatgt 162849
>gb|AC147434.12| Medicago truncatula clone mth2-28h7, complete sequence Length = 127300 Score = 69.9 bits (35), Expect = 1e-08 Identities = 72/83 (86%), Gaps = 1/83 (1%) Strand = Plus / Minus Query: 545 attgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaatt 604 |||||| ||| ||||||||||||||||| || ||||| ||||| |||||||| |||| Sbjct: 73583 attgaataacagcatgttgcttgctgcaagatggatga-tctgttgggatatcagcaacc 73525 Query: 605 ctcctttcccttccaaaaaggta 627 || |||||||||||||||||||| Sbjct: 73524 cttctttcccttccaaaaaggta 73502
>gb|AC129324.4| Mus musculus BAC clone RP23-253G24 from chromosome 18, complete sequence Length = 166990 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 141 aaaatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||||| Sbjct: 148323 aaaatctatgtatgtatgtatgtatgt 148297 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 148313 tatgtatgtatgtatgtatgt 148293 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 148309 tatgtatgtatgtatgtatgt 148289 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 148305 tatgtatgtatgtatgtatgt 148285 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 148301 tatgtatgtatgtatgtatgt 148281
>gb|AC024584.5| Homo sapiens chromosome 19 clone LLNLF-187D8, complete sequence Length = 39200 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 141 aaaatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||||| Sbjct: 37589 aaaatctatgtatgtatgtatgtatgt 37615 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37611 tatgtatgtatgtatgtatgt 37631 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37607 tatgtatgtatgtatgtatgt 37627 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37603 tatgtatgtatgtatgtatgt 37623 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37599 tatgtatgtatgtatgtatgt 37619
>gb|AC098576.7| Drosophila melanogaster X BAC RP98-3E12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175262 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtggc 170 ||||||||||||||||||||||||||| Sbjct: 59773 atctatgtatgtatgtatgtatgtggc 59799
>gb|AC154201.2| Mus musculus BAC clone RP24-83I8 from chromosome 16, complete sequence Length = 172923 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 141 aaaatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||||| Sbjct: 66795 aaaatctatgtatgtatgtatgtatgt 66769 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66785 tatgtatgtatgtatgtatgt 66765 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66781 tatgtatgtatgtatgtatgt 66761 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66777 tatgtatgtatgtatgtatgt 66757 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 23187 atgtatgtatgtatgtatgt 23206
>gb|AC007193.1|AC007193 Homo sapiens chromosome 19, BAC 82621 (CIT-B-139a18), complete sequence Length = 146180 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 141 aaaatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||||| Sbjct: 143861 aaaatctatgtatgtatgtatgtatgt 143835 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 143851 tatgtatgtatgtatgtatgt 143831 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 143847 tatgtatgtatgtatgtatgt 143827 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 143843 tatgtatgtatgtatgtatgt 143823
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtggc 170 ||||||||||||||||||||||||||| Sbjct: 267576 atctatgtatgtatgtatgtatgtggc 267602 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgtg 168 ||||||||||||||||||||| Sbjct: 179078 atgtatgtatgtatgtatgtg 179058 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 166360 tatgtatgtatgtatgtatg 166379
>emb|CT030234.9| M.truncatula DNA sequence from clone MTH2-22I15 on chromosome 3, complete sequence Length = 112511 Score = 54.0 bits (27), Expect = 7e-04 Identities = 70/83 (84%), Gaps = 1/83 (1%) Strand = Plus / Plus Query: 545 attgaagaactgcatgttgcttgctgcaggagggatgggtctgtggggatatctgcaatt 604 |||||| ||| ||||||||||||||||| || |||| | ||||| |||| ||| |||| Sbjct: 41369 attgaataacagcatgttgcttgctgcaagaaggat-gatctgttgggacatcagcaacc 41427 Query: 605 ctcctttcccttccaaaaaggta 627 || ||||| |||||||||||||| Sbjct: 41428 cttctttctcttccaaaaaggta 41450
>emb|AL030994.1|DMC4F1 Drosophila melanogaster cosmid clone 4F1 Length = 44352 Score = 54.0 bits (27), Expect = 7e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtggc 170 ||||||||||||||||||||||||||| Sbjct: 9223 atctatgtatgtatgtatgtatgtggc 9249
>ref|NM_112947.2| Arabidopsis thaliana DDL (DAWDLE) AT3G20550 (DDL) mRNA, complete cds Length = 1276 Score = 52.0 bits (26), Expect = 0.003 Identities = 38/42 (90%) Strand = Plus / Minus Query: 461 gttggtactaccaagatccatcagataaggcctcacttgctt 502 ||||||||||||||||||||| | |||||| |||||||||| Sbjct: 919 gttggtactaccaagatccattatgtaaggcttcacttgctt 878
>gb|AC155825.2| Mus musculus BAC clone RP23-54D15 from chromosome 16, complete sequence Length = 192183 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 26694 aaatctatgtatgtatgtatgtatgt 26719 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160456 tatgtatgtatgtatgtatgt 160476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160452 tatgtatgtatgtatgtatgt 160472 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160448 tatgtatgtatgtatgtatgt 160468 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160444 tatgtatgtatgtatgtatgt 160464 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160440 tatgtatgtatgtatgtatgt 160460 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120938 tatgtatgtatgtatgtatgt 120958 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120934 tatgtatgtatgtatgtatgt 120954 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120930 tatgtatgtatgtatgtatgt 120950 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120926 tatgtatgtatgtatgtatgt 120946 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26719 tatgtatgtatgtatgtatgt 26739 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26715 tatgtatgtatgtatgtatgt 26735 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26711 tatgtatgtatgtatgtatgt 26731 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26707 tatgtatgtatgtatgtatgt 26727 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26703 tatgtatgtatgtatgtatgt 26723
>gb|AC158901.5| Mus musculus chromosome 15, clone RP23-77K13, complete sequence Length = 192643 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 84108 aaatctatgtatgtatgtatgtatgt 84133 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84117 tatgtatgtatgtatgtatgt 84137
>gb|AC111126.16| Mus musculus chromosome 5, clone RP23-336F4, complete sequence Length = 236880 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggcta 172 |||||||||||||||||||||||||| Sbjct: 65710 tatgtatgtatgtatgtatgtggcta 65735 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 149120 tatgtatgtatgtatgtatgtg 149099 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149140 tatgtatgtatgtatgtatgt 149120 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149136 tatgtatgtatgtatgtatgt 149116 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149132 tatgtatgtatgtatgtatgt 149112 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149128 tatgtatgtatgtatgtatgt 149108 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149124 tatgtatgtatgtatgtatgt 149104 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 65706 tatgtatgtatgtatgtatgt 65726 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 65702 tatgtatgtatgtatgtatgt 65722 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 185738 tgtatgtatgtatgtatgtg 185757 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 65699 atgtatgtatgtatgtatgt 65718
>gb|AC137974.13| Mus musculus chromosome 15, clone RP23-17J3, complete sequence Length = 219617 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 42683 aaatctatgtatgtatgtatgtatgt 42708 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42692 tatgtatgtatgtatgtatgt 42712
>gb|AC135240.2| Mus musculus BAC clone RP24-63O24 from chromosome 5, complete sequence Length = 196371 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 132083 aaatctatgtatgtatgtatgtatgt 132058 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132074 tatgtatgtatgtatgtatgt 132054 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132070 tatgtatgtatgtatgtatgt 132050 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132066 tatgtatgtatgtatgtatgt 132046 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132062 tatgtatgtatgtatgtatgt 132042 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132058 tatgtatgtatgtatgtatgt 132038 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132054 tatgtatgtatgtatgtatgt 132034 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132050 tatgtatgtatgtatgtatgt 132030
>gb|AC141481.4| Mus musculus BAC clone RP23-145E16 from chromosome 15, complete sequence Length = 195197 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 187323 aaatctatgtatgtatgtatgtatgt 187348 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187344 tatgtatgtatgtatgtatgt 187364 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187340 tatgtatgtatgtatgtatgt 187360 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187336 tatgtatgtatgtatgtatgt 187356 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187332 tatgtatgtatgtatgtatgt 187352
>gb|AC110200.9| Mus musculus chromosome 16, clone RP23-150K16, complete sequence Length = 179548 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 7382 aaatctatgtatgtatgtatgtatgt 7357 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7373 tatgtatgtatgtatgtatgt 7353 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7369 tatgtatgtatgtatgtatgt 7349 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7365 tatgtatgtatgtatgtatgt 7345 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7361 tatgtatgtatgtatgtatgt 7341 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7357 tatgtatgtatgtatgtatgt 7337
>gb|AC164633.2| Mus musculus chromosome 15, clone RP24-374C19, complete sequence Length = 157653 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 122349 aaatctatgtatgtatgtatgtatgt 122324 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122340 tatgtatgtatgtatgtatgt 122320 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122336 tatgtatgtatgtatgtatgt 122316 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122332 tatgtatgtatgtatgtatgt 122312 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122328 tatgtatgtatgtatgtatgt 122308
>gb|AC156496.10| Mus musculus chromosome 7, clone RP24-246N21, complete sequence Length = 143815 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 51353 aaatctatgtatgtatgtatgtatgt 51328 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 51328 tatgtatgtatgtatgtatgtg 51307 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51344 tatgtatgtatgtatgtatgt 51324 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51340 tatgtatgtatgtatgtatgt 51320 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51336 tatgtatgtatgtatgtatgt 51316 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51332 tatgtatgtatgtatgtatgt 51312 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 35183 tatgtatgtatgtatgtatg 35202
>emb|AL513353.7| Human DNA sequence from clone RP11-309N12 on chromosome 9 Contains part of the AUH gene for AU RNA binding protein/enoyl-Coenzyme A hydratase, complete sequence Length = 105225 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 141 aaaatctatgtatgtatgtatgtatg 166 |||||||||||||||||||||||||| Sbjct: 41662 aaaatctatgtatgtatgtatgtatg 41687
>gb|AC124926.7| Rattus norvegicus X BAC CH230-155H3 (Children's Hospital Oakland Research Institute) complete sequence Length = 217309 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 163431 aaatctatgtatgtatgtatgtatgt 163456 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 198313 tatgtatgtatgtatgtatgt 198333 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 198309 tatgtatgtatgtatgtatgt 198329 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 198305 tatgtatgtatgtatgtatgt 198325 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 198301 tatgtatgtatgtatgtatgt 198321 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163472 tatgtatgtatgtatgtatgt 163492 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163468 tatgtatgtatgtatgtatgt 163488 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163464 tatgtatgtatgtatgtatgt 163484 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163460 tatgtatgtatgtatgtatgt 163480 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163456 tatgtatgtatgtatgtatgt 163476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163452 tatgtatgtatgtatgtatgt 163472 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163448 tatgtatgtatgtatgtatgt 163468 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163444 tatgtatgtatgtatgtatgt 163464 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163440 tatgtatgtatgtatgtatgt 163460 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159865 tatgtatgtatgtatgtatgt 159885 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159861 tatgtatgtatgtatgtatgt 159881 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159857 tatgtatgtatgtatgtatgt 159877
>gb|BT000005.1| Arabidopsis thaliana Unknown protein (At3g20560) mRNA, complete cds Length = 1034 Score = 52.0 bits (26), Expect = 0.003 Identities = 38/42 (90%) Strand = Plus / Minus Query: 461 gttggtactaccaagatccatcagataaggcctcacttgctt 502 ||||||||||||||||||||| | |||||| |||||||||| Sbjct: 819 gttggtactaccaagatccattatgtaaggcttcacttgctt 778
>gb|AC110012.5| Homo sapiens chromosome 8, clone CTD-2024L13, complete sequence Length = 163126 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 142291 aaatctatgtatgtatgtatgtatgt 142266 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 136277 atctatgtatgtatgtatgtatgt 136254 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142282 tatgtatgtatgtatgtatgt 142262 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142278 tatgtatgtatgtatgtatgt 142258 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142274 tatgtatgtatgtatgtatgt 142254 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 136270 tatgtatgtatgtatgtatgt 136250 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 136266 tatgtatgtatgtatgtatgt 136246 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 142270 tatgtatgtatgtatgtatg 142251
>gb|AC024681.12| Homo sapiens chromosome 8, clone RP11-622O11, complete sequence Length = 194516 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 54204 aaatctatgtatgtatgtatgtatgt 54229 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54221 tatgtatgtatgtatgtatgt 54241 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54217 tatgtatgtatgtatgtatgt 54237 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54213 tatgtatgtatgtatgtatgt 54233
>gb|AC090568.5| Homo sapiens chromosome 8, clone RP11-69I13, complete sequence Length = 166398 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 129243 aaatctatgtatgtatgtatgtatgt 129268 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 135272 atctatgtatgtatgtatgtatgt 135295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135291 tatgtatgtatgtatgtatgt 135311 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135287 tatgtatgtatgtatgtatgt 135307 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135283 tatgtatgtatgtatgtatgt 135303 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135279 tatgtatgtatgtatgtatgt 135299 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129268 tatgtatgtatgtatgtatgt 129288 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129264 tatgtatgtatgtatgtatgt 129284 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129260 tatgtatgtatgtatgtatgt 129280 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129256 tatgtatgtatgtatgtatgt 129276 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129252 tatgtatgtatgtatgtatgt 129272 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 129272 tatgtatgtatgtatgtatg 129291
>gb|AY062626.1| Arabidopsis thaliana Unknown protein (At3g20560; K10D20.9) mRNA, complete cds Length = 1276 Score = 52.0 bits (26), Expect = 0.003 Identities = 38/42 (90%) Strand = Plus / Minus Query: 461 gttggtactaccaagatccatcagataaggcctcacttgctt 502 ||||||||||||||||||||| | |||||| |||||||||| Sbjct: 919 gttggtactaccaagatccattatgtaaggcttcacttgctt 878
>gb|AC154333.2| Mus musculus BAC clone RP24-496M21 from 14, complete sequence Length = 163565 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggcta 172 |||||||||||||||||||||||||| Sbjct: 36952 tatgtatgtatgtatgtatgtggcta 36977 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36948 tatgtatgtatgtatgtatgt 36968 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36944 tatgtatgtatgtatgtatgt 36964
>emb|CT573047.6| Mouse DNA sequence from clone RP23-73L5 on chromosome 14, complete sequence Length = 211944 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggcta 172 |||||||||||||||||||||||||| Sbjct: 93206 tatgtatgtatgtatgtatgtggcta 93181 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 93214 tatgtatgtatgtatgtatgt 93194 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 93210 tatgtatgtatgtatgtatgt 93190
>gb|AC140220.4| Mus musculus BAC clone RP23-279P6 from 5, complete sequence Length = 182156 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||||| Sbjct: 181877 aaatctatgtatgtatgtatgtatgt 181902 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181910 tatgtatgtatgtatgtatgt 181930 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181906 tatgtatgtatgtatgtatgt 181926 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181902 tatgtatgtatgtatgtatgt 181922 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181898 tatgtatgtatgtatgtatgt 181918 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181894 tatgtatgtatgtatgtatgt 181914 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181890 tatgtatgtatgtatgtatgt 181910 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 181886 tatgtatgtatgtatgtatgt 181906 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59987 tatgtatgtatgtatgtatgt 60007 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59983 tatgtatgtatgtatgtatgt 60003 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59979 tatgtatgtatgtatgtatgt 59999 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59975 tatgtatgtatgtatgtatgt 59995 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 59991 tatgtatgtatgtatgtatg 60010 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 59972 atgtatgtatgtatgtatgt 59991
>gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, complete sequence Length = 196761 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 60015 aatctatgtatgtatgtatgtatgt 59991 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 60007 tatgtatgtatgtatgtatgt 59987 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 60003 tatgtatgtatgtatgtatgt 59983 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59999 tatgtatgtatgtatgtatgt 59979
>ref|NM_020274.2| Mus musculus 5-hydroxytryptamine (serotonin) receptor 3B (Htr3b), mRNA Length = 2420 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 2189 aatctatgtatgtatgtatgtatgt 2165 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2181 tatgtatgtatgtatgtatgt 2161 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2177 tatgtatgtatgtatgtatgt 2157 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2173 tatgtatgtatgtatgtatgt 2153 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2169 tatgtatgtatgtatgtatgt 2149 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2165 tatgtatgtatgtatgtatgt 2145 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2161 tatgtatgtatgtatgtatgt 2141 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2157 tatgtatgtatgtatgtatgt 2137 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2153 tatgtatgtatgtatgtatgt 2133 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2149 tatgtatgtatgtatgtatgt 2129
>gb|AY017694.1| Oryza sativa microsatellite MRG0019 containing (AC)X13, closest to marker S2518, genomic sequence Length = 226 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 85 tatgtatgtatgtatgtatgtggct 61
>gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, complete sequence Length = 176074 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 54141 aatctatgtatgtatgtatgtatgt 54117 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 97368 tatgtatgtatgtatgtatgtg 97347 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97384 tatgtatgtatgtatgtatgt 97364 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97380 tatgtatgtatgtatgtatgt 97360 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97376 tatgtatgtatgtatgtatgt 97356 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97372 tatgtatgtatgtatgtatgt 97352 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54133 tatgtatgtatgtatgtatgt 54113 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54129 tatgtatgtatgtatgtatgt 54109 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54125 tatgtatgtatgtatgtatgt 54105 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54121 tatgtatgtatgtatgtatgt 54101 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54117 tatgtatgtatgtatgtatgt 54097 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54113 tatgtatgtatgtatgtatgt 54093 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54109 tatgtatgtatgtatgtatgt 54089
>gb|AC069539.5| Homo sapiens chromosome 11 clone RP11-321E15, complete sequence Length = 181471 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 132015 atctatgtatgtatgtatgtatgtg 132039
>gb|AC147122.2| Mus musculus BAC clone RP24-163F9 from chromosome 9, complete sequence Length = 153867 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 79399 aatctatgtatgtatgtatgtatgt 79375 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 97036 tctatgtatgtatgtatgtatgt 97014 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97030 tatgtatgtatgtatgtatgt 97010 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97026 tatgtatgtatgtatgtatgt 97006 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97022 tatgtatgtatgtatgtatgt 97002 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97018 tatgtatgtatgtatgtatgt 96998 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97014 tatgtatgtatgtatgtatgt 96994 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97010 tatgtatgtatgtatgtatgt 96990 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79391 tatgtatgtatgtatgtatgt 79371
>gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-203F1, complete sequence Length = 148170 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 10273 atctatgtatgtatgtatgtatgtg 10249 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56911 tatgtatgtatgtatgtatgt 56891 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56907 tatgtatgtatgtatgtatgt 56887 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56903 tatgtatgtatgtatgtatgt 56883 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56899 tatgtatgtatgtatgtatgt 56879 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50268 tatgtatgtatgtatgtatgt 50288 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50264 tatgtatgtatgtatgtatgt 50284 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50260 tatgtatgtatgtatgtatgt 50280 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10246 tatgtatgtatgtatgtatgt 10226 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10242 tatgtatgtatgtatgtatgt 10222 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 56895 tatgtatgtatgtatgtatg 56876 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 50257 atgtatgtatgtatgtatgt 50276 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 36805 tatgtatgtatgtatgtatg 36786 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||| ||||||||| Sbjct: 10285 atctatgtatgtatctatgtatgt 10262
>gb|AC107456.9| Mus musculus chromosome 3, clone RP23-273L6, complete sequence Length = 185661 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 76571 aatctatgtatgtatgtatgtatgt 76595 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155718 tatgtatgtatgtatgtatgt 155698 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155714 tatgtatgtatgtatgtatgt 155694 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76603 tatgtatgtatgtatgtatgt 76623 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76599 tatgtatgtatgtatgtatgt 76619 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76595 tatgtatgtatgtatgtatgt 76615 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76591 tatgtatgtatgtatgtatgt 76611 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76587 tatgtatgtatgtatgtatgt 76607 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76583 tatgtatgtatgtatgtatgt 76603 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 76579 tatgtatgtatgtatgtatgt 76599
>ref|XM_993148.1| PREDICTED: Mus musculus polymerase (RNA) III (DNA directed) polypeptide G, transcript variant 1 (Polr3g), mRNA Length = 1231 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 1067 acaaaaactatgtatgtatgtatgtatgt 1095 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1087 tatgtatgtatgtatgtatgt 1107 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1083 tatgtatgtatgtatgtatgt 1103 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1079 tatgtatgtatgtatgtatgt 1099
>ref|XM_980959.1| PREDICTED: Mus musculus polymerase (RNA) III (DNA directed) polypeptide G, transcript variant 7 (Polr3g), mRNA Length = 1231 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 1067 acaaaaactatgtatgtatgtatgtatgt 1095 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1087 tatgtatgtatgtatgtatgt 1107 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1083 tatgtatgtatgtatgtatgt 1103 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1079 tatgtatgtatgtatgtatgt 1099
>ref|XM_990982.1| PREDICTED: Mus musculus polymerase (RNA) III (DNA directed) polypeptide G, transcript variant 4 (Polr3g), mRNA Length = 1231 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 1067 acaaaaactatgtatgtatgtatgtatgt 1095 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1087 tatgtatgtatgtatgtatgt 1107 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1083 tatgtatgtatgtatgtatgt 1103 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1079 tatgtatgtatgtatgtatgt 1099
>gb|AC125042.4| Mus musculus BAC clone RP23-339G10 from chromosome 9, complete sequence Length = 219183 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 17508 aatctatgtatgtatgtatgtatgt 17484 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 152012 tctatgtatgtatgtatgtatgt 151990 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 35145 tctatgtatgtatgtatgtatgt 35123 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155554 tatgtatgtatgtatgtatgt 155574 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155550 tatgtatgtatgtatgtatgt 155570 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95692 tatgtatgtatgtatgtatgt 95672 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95688 tatgtatgtatgtatgtatgt 95668 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95684 tatgtatgtatgtatgtatgt 95664 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95680 tatgtatgtatgtatgtatgt 95660 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95676 tatgtatgtatgtatgtatgt 95656 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35139 tatgtatgtatgtatgtatgt 35119 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35135 tatgtatgtatgtatgtatgt 35115 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35131 tatgtatgtatgtatgtatgt 35111 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35127 tatgtatgtatgtatgtatgt 35107 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35123 tatgtatgtatgtatgtatgt 35103 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35119 tatgtatgtatgtatgtatgt 35099 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17500 tatgtatgtatgtatgtatgt 17480 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 152006 tatgtatgtatgtatgtatg 151987
>emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chromosome 14, complete sequence Length = 227368 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 29558 aatctatgtatgtatgtatgtatgt 29534 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 211820 tatgtatgtatgtatgtatgt 211840 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 211816 tatgtatgtatgtatgtatgt 211836 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 211812 tatgtatgtatgtatgtatgt 211832 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 211808 tatgtatgtatgtatgtatgt 211828 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 211804 tatgtatgtatgtatgtatgt 211824 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29550 tatgtatgtatgtatgtatgt 29530
>emb|CR407585.14| Zebrafish DNA sequence from clone CH211-141O18 in linkage group 6, complete sequence Length = 164483 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 130505 atctatgtatgtatgtatgtatgtg 130481 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130478 tatgtatgtatgtatgtatgt 130458 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130474 tatgtatgtatgtatgtatgt 130454 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130470 tatgtatgtatgtatgtatgt 130450 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130466 tatgtatgtatgtatgtatgt 130446 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130462 tatgtatgtatgtatgtatgt 130442 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130458 tatgtatgtatgtatgtatgt 130438 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130454 tatgtatgtatgtatgtatgt 130434
>gb|AC125350.3| Mus musculus BAC clone RP23-423B11 from chromosome 13, complete sequence Length = 205567 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 30762 tatgtatgtatgtatgtatgtggct 30738 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 29870 tatgtatgtatgtatgtatgtggct 29846 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatg 166 ||||||||||||||||||||||| Sbjct: 2409 atctatgtatgtatgtatgtatg 2387 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 30778 tatgtatgtatgtatgtatgt 30758 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 30774 tatgtatgtatgtatgtatgt 30754 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 30770 tatgtatgtatgtatgtatgt 30750 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 30766 tatgtatgtatgtatgtatgt 30746 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29882 tatgtatgtatgtatgtatgt 29862 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29878 tatgtatgtatgtatgtatgt 29858 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29874 tatgtatgtatgtatgtatgt 29854
>gb|AC139757.4| Mus musculus BAC clone RP23-440H11 from chromosome 18, complete sequence Length = 193847 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 79078 atctatgtatgtatgtatgtatgtg 79102
>gb|AC125316.4| Mus musculus BAC clone RP24-250N3 from chromosome 3, complete sequence Length = 138128 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 15099 aatctatgtatgtatgtatgtatgt 15123 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 128976 tatgtatgtatgtatgtatgt 128996 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 128972 tatgtatgtatgtatgtatgt 128992 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 128968 tatgtatgtatgtatgtatgt 128988 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 128964 tatgtatgtatgtatgtatgt 128984 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 128960 tatgtatgtatgtatgtatgt 128980 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15115 tatgtatgtatgtatgtatgt 15135 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15111 tatgtatgtatgtatgtatgt 15131 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15107 tatgtatgtatgtatgtatgt 15127
>gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosome 7, complete sequence Length = 147686 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 129209 acaaaacctatgtatgtatgtatgtatgt 129181
>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence Length = 200673 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 105404 aatctatgtatgtatgtatgtatgt 105380 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 64545 atctatgtatgtatgtatgtatgt 64522 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 39540 tatgtatgtatgtatgtatgtg 39561 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105396 tatgtatgtatgtatgtatgt 105376 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105392 tatgtatgtatgtatgtatgt 105372 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105388 tatgtatgtatgtatgtatgt 105368 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105384 tatgtatgtatgtatgtatgt 105364 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64538 tatgtatgtatgtatgtatgt 64518 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64534 tatgtatgtatgtatgtatgt 64514 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64530 tatgtatgtatgtatgtatgt 64510 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64526 tatgtatgtatgtatgtatgt 64506 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64522 tatgtatgtatgtatgtatgt 64502 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 64553 atctatgtatctatgtatgtatgt 64530
>gb|AC131726.3| Mus musculus BAC clone RP23-132P9 from 3, complete sequence Length = 190554 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 50583 tatgtatgtatgtatgtatgtggct 50559 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125506 tatgtatgtatgtatgtatgt 125486 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125502 tatgtatgtatgtatgtatgt 125482 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125498 tatgtatgtatgtatgtatgt 125478 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125494 tatgtatgtatgtatgtatgt 125474 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125490 tatgtatgtatgtatgtatgt 125470 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125486 tatgtatgtatgtatgtatgt 125466 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 125482 tatgtatgtatgtatgtatgt 125462 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53074 tatgtatgtatgtatgtatgt 53094 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53070 tatgtatgtatgtatgtatgt 53090 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50615 tatgtatgtatgtatgtatgt 50595 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50611 tatgtatgtatgtatgtatgt 50591 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50607 tatgtatgtatgtatgtatgt 50587 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50603 tatgtatgtatgtatgtatgt 50583 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50599 tatgtatgtatgtatgtatgt 50579 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50595 tatgtatgtatgtatgtatgt 50575 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50591 tatgtatgtatgtatgtatgt 50571 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50587 tatgtatgtatgtatgtatgt 50567
>gb|AC121582.3| Mus musculus BAC clone RP23-257I21 from 3, complete sequence Length = 201935 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 19697 aatctatgtatgtatgtatgtatgt 19721 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 83189 tctatgtatgtatgtatgtatgt 83167 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 83183 tatgtatgtatgtatgtatgt 83163 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 83179 tatgtatgtatgtatgtatgt 83159 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 83175 tatgtatgtatgtatgtatgt 83155 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 19713 tatgtatgtatgtatgtatgt 19733 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 19709 tatgtatgtatgtatgtatgt 19729 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 19705 tatgtatgtatgtatgtatgt 19725
>gb|AC122294.2| Mus musculus BAC clone RP23-259F3 from 19, complete sequence Length = 160892 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 15288 aatctatgtatgtatgtatgtatgt 15312 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 120336 tatgtatgtatgtatgtatgtg 120357 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120332 tatgtatgtatgtatgtatgt 120352 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120328 tatgtatgtatgtatgtatgt 120348 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110154 tatgtatgtatgtatgtatgt 110174 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110150 tatgtatgtatgtatgtatgt 110170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110146 tatgtatgtatgtatgtatgt 110166 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15320 tatgtatgtatgtatgtatgt 15340 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15316 tatgtatgtatgtatgtatgt 15336 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15312 tatgtatgtatgtatgtatgt 15332 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15308 tatgtatgtatgtatgtatgt 15328 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15304 tatgtatgtatgtatgtatgt 15324 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15300 tatgtatgtatgtatgtatgt 15320 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15296 tatgtatgtatgtatgtatgt 15316 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 110158 tatgtatgtatgtatgtatg 110177
>gb|AC121772.2| Mus musculus BAC clone RP23-349L11 from 3, complete sequence Length = 201923 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 2733 aatctatgtatgtatgtatgtatgt 2709 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2725 tatgtatgtatgtatgtatgt 2705 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2721 tatgtatgtatgtatgtatgt 2701 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2717 tatgtatgtatgtatgtatgt 2697
>gb|AC002486.1| Homo sapiens BAC clone CTA-367O17 from 7, complete sequence Length = 79611 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 6172 aatctatgtatgtatgtatgtatgt 6148 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79590 tatgtatgtatgtatgtatgt 79570 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79586 tatgtatgtatgtatgtatgt 79566 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79582 tatgtatgtatgtatgtatgt 79562 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79578 tatgtatgtatgtatgtatgt 79558 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79574 tatgtatgtatgtatgtatgt 79554 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 6164 tatgtatgtatgtatgtatgt 6144 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 6160 tatgtatgtatgtatgtatgt 6140
>ref|XM_727777.1| Plasmodium chabaudi chabaudi hypothetical protein (PC400578.00.0) partial mRNA Length = 216 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 79 aatctatgtatgtatgtatgtatgt 55 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 71 tatgtatgtatgtatgtatgt 51 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67 tatgtatgtatgtatgtatgt 47 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63 tatgtatgtatgtatgtatgt 43 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59 tatgtatgtatgtatgtatgt 39 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 55 tatgtatgtatgtatgtatgt 35 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51 tatgtatgtatgtatgtatgt 31
>emb|AL683807.22| Human DNA sequence from clone RP13-297E16 on chromosome X Contains the DXYS155E gene for DNA segment on chromosome X and Y (unique) 155 expressed sequence (XE7, XE7Y), the ASMT gene for acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY), three novel genes and three CpG islands, complete sequence Length = 189825 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 142520 atctatgtatgtatgtatgtatgtg 142544
>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3' end of the IL3RA gene for interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174), the SLC25A6 gene for solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for acetylserotonin O-methyltransferase-like (ASMTLX), a novel gene (LOC286530), a novel gene (FLJ13330) and six CpG islands, complete sequence Length = 162377 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 80807 atctatgtatgtatgtatgtatgtg 80831 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 151061 atctatgtatgtatgtatgtatgt 151084 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 78697 atctatgtatgtatgtatgtatgt 78720 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtat 165 |||||||||||||||||||||| Sbjct: 78665 atctatgtatgtatgtatgtat 78686 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||| ||||| Sbjct: 151424 aatctatgtatgtatgtatatatgt 151448 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 151072 tatgtatgtatgtatgtatgt 151092 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 151068 tatgtatgtatgtatgtatgt 151088 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 145 tctatgtatgtatgtatgtat 165 ||||||||||||||||||||| Sbjct: 79047 tctatgtatgtatgtatgtat 79067 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 151903 atgtatgtatgtatgtatgt 151922 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 151076 tatgtatgtatgtatgtatg 151095 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 80861 tgtatgtatgtatgtatgtg 80880 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgt 163 |||||||||||||||||||| Sbjct: 79398 atctatgtatgtatgtatgt 79417
>gb|AC108781.9| Mus musculus, clone RP23-304K14, complete sequence Length = 183718 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 90511 aatctatgtatgtatgtatgtatgt 90535 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 90527 tatgtatgtatgtatgtatgt 90547 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 90523 tatgtatgtatgtatgtatgt 90543 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 90519 tatgtatgtatgtatgtatgt 90539 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26273 tatgtatgtatgtatgtatgt 26293 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26269 tatgtatgtatgtatgtatgt 26289 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26265 tatgtatgtatgtatgtatgt 26285
>emb|AL355512.22| Human DNA sequence from clone RP11-525A16 on chromosome 10 Contains the DUSP5 gene for dual specificity phosphatase 5 (HVH3), two novel genes, a high-mobility group box 3 (HMGB3) pseudogene and a CpG island, complete sequence Length = 199785 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 45867 aatctatgtatgtatgtatgtatgt 45843 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 45855 tatgtatgtatgtatgtatgtg 45834 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 45859 tatgtatgtatgtatgtatgt 45839
>gb|AC108527.6| Rattus norvegicus 9 BAC CH230-7F11 (Children's Hospital Oakland Research Institute) complete sequence Length = 225777 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 171796 aatctatgtatgtatgtatgtatgt 171772 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtat 165 |||||||||||||||||||||| Sbjct: 171764 atctatgtatgtatgtatgtat 171743 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23487 tatgtatgtatgtatgtatgt 23467 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23483 tatgtatgtatgtatgtatgt 23463 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23479 tatgtatgtatgtatgtatgt 23459
>emb|AL078638.9|HSA535K18 Human DNA sequence from clone RP11-535K18 on chromosome Xq26.2-27.1 Contains the FHL1 gene for four and a half LIM domains 1, the gene for a novel protein (FLJ12694), a serine/threonine kinase 24 (STE20 homolog, yeast) (STK24) pseudogene, the 5' end of the GPR112 gene for G protein-coupled receptor 112 and two CpG islands, complete sequence Length = 182408 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 129522 aatctatgtatgtatgtatgtatgt 129546 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129530 tatgtatgtatgtatgtatgt 129550
>gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, complete sequence Length = 202205 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 81513 tatgtatgtatgtatgtatgtggct 81537 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 196270 tatgtatgtatgtatgtatgtg 196249 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196274 tatgtatgtatgtatgtatgt 196254 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196208 tatgtatgtatgtatgtatgt 196188 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196144 tatgtatgtatgtatgtatgt 196124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196140 tatgtatgtatgtatgtatgt 196120 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196136 tatgtatgtatgtatgtatgt 196116 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196132 tatgtatgtatgtatgtatgt 196112 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196128 tatgtatgtatgtatgtatgt 196108 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 196058 tatgtatgtatgtatgtatgt 196038 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 178865 tatgtatgtatgtatgtatgt 178845 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 178861 tatgtatgtatgtatgtatgt 178841 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 178857 tatgtatgtatgtatgtatgt 178837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 178853 tatgtatgtatgtatgtatgt 178833 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 178849 tatgtatgtatgtatgtatgt 178829 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81509 tatgtatgtatgtatgtatgt 81529 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81505 tatgtatgtatgtatgtatgt 81525 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81501 tatgtatgtatgtatgtatgt 81521 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81497 tatgtatgtatgtatgtatgt 81517 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81493 tatgtatgtatgtatgtatgt 81513 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 178845 tatgtatgtatgtatgtatg 178826
>gb|AC159256.2| Mus musculus BAC clone RP24-109N11 from chromosome 13, complete sequence Length = 179979 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Plus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 171868 acaaaaactatgtatgtatgtatgtatgt 171896 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 171888 tatgtatgtatgtatgtatgt 171908 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 171884 tatgtatgtatgtatgtatgt 171904 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 171880 tatgtatgtatgtatgtatgt 171900 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10101 tatgtatgtatgtatgtatgt 10121
>gb|AC103579.10| Mus Musculus Strain C57BL6/J Chromosome 14 BAC Clone RP23-145J23, Complete Sequence, complete sequence Length = 227361 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 218476 aatctatgtatgtatgtatgtatgt 218500 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 218484 tatgtatgtatgtatgtatgt 218504 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36232 tatgtatgtatgtatgtatgt 36212 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36228 tatgtatgtatgtatgtatgt 36208 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36224 tatgtatgtatgtatgtatgt 36204 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36220 tatgtatgtatgtatgtatgt 36200 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36216 tatgtatgtatgtatgtatgt 36196 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36212 tatgtatgtatgtatgtatgt 36192
>emb|BX511268.5| Zebrafish DNA sequence from clone CH211-66B9 in linkage group 2, complete sequence Length = 167067 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 51236 atctatgtatgtatgtatgtatgtg 51212 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50218 tatgtatgtatgtatgtatgt 50198
>gb|AC080100.7| Homo sapiens chromosome 11, clone RP11-454H19, complete sequence Length = 149466 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 122353 aatctatgtatgtatgtatgtatgt 122377 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122393 tatgtatgtatgtatgtatgt 122413 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122389 tatgtatgtatgtatgtatgt 122409 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122385 tatgtatgtatgtatgtatgt 122405 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122381 tatgtatgtatgtatgtatgt 122401 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122377 tatgtatgtatgtatgtatgt 122397 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122373 tatgtatgtatgtatgtatgt 122393 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122369 tatgtatgtatgtatgtatgt 122389 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122365 tatgtatgtatgtatgtatgt 122385 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122361 tatgtatgtatgtatgtatgt 122381
>gb|AC111399.4| Rattus norvegicus Mcs BAC CH230-138L13 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 210984 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 118868 aatctatgtatgtatgtatgtatgt 118892 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 118896 tatgtatgtatgtatgtatgtg 118917 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180676 tatgtatgtatgtatgtatgt 180696 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180672 tatgtatgtatgtatgtatgt 180692 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180668 tatgtatgtatgtatgtatgt 180688 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180608 tatgtatgtatgtatgtatgt 180628 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180604 tatgtatgtatgtatgtatgt 180624 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118892 tatgtatgtatgtatgtatgt 118912 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118888 tatgtatgtatgtatgtatgt 118908 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118884 tatgtatgtatgtatgtatgt 118904 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118880 tatgtatgtatgtatgtatgt 118900 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118876 tatgtatgtatgtatgtatgt 118896 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 180601 atgtatgtatgtatgtatgt 180620
>gb|AC160059.7| Mus musculus 6 BAC RP23-172L21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 212292 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 193996 atctatgtatgtatgtatgtatgtg 193972 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 194004 atctatgtatctatgtatgtatgt 193981
>gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's Hospital Oakland Research Institute) complete sequence Length = 213875 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 202429 aatctatgtatgtatgtatgtatgt 202453 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 202457 tatgtatgtatgtatgtatgtg 202478 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 202453 tatgtatgtatgtatgtatgt 202473 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 202449 tatgtatgtatgtatgtatgt 202469 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 202445 tatgtatgtatgtatgtatgt 202465 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 202441 tatgtatgtatgtatgtatgt 202461 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 202437 tatgtatgtatgtatgtatgt 202457
>dbj|AK085213.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched library, clone:D530019I20 product:5-hydroxytryptamine (serotonin) receptor 3B, full insert sequence Length = 2420 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 2189 aatctatgtatgtatgtatgtatgt 2165 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2181 tatgtatgtatgtatgtatgt 2161 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2177 tatgtatgtatgtatgtatgt 2157 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2173 tatgtatgtatgtatgtatgt 2153 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2169 tatgtatgtatgtatgtatgt 2149 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2165 tatgtatgtatgtatgtatgt 2145 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2161 tatgtatgtatgtatgtatgt 2141 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2157 tatgtatgtatgtatgtatgt 2137 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2153 tatgtatgtatgtatgtatgt 2133 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2149 tatgtatgtatgtatgtatgt 2129
>gb|AC154371.2| Mus musculus BAC clone RP23-102A13 from chromosome 14, complete sequence Length = 206234 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 638 cgatgaacatacaacggttcatttc 662 ||||||||||||||||||||||||| Sbjct: 14599 cgatgaacatacaacggttcatttc 14575
>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence Length = 241917 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 63259 aatctatgtatgtatgtatgtatgt 63283 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 72665 atctatgtatgtatgtatgtatgt 72688 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 95331 tatgtatgtatgtatgtatgtg 95352 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 67031 tatgtatgtatgtatgtatgtg 67052 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123853 tatgtatgtatgtatgtatgt 123873 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95327 tatgtatgtatgtatgtatgt 95347 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95323 tatgtatgtatgtatgtatgt 95343 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95319 tatgtatgtatgtatgtatgt 95339 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95315 tatgtatgtatgtatgtatgt 95335 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 95311 tatgtatgtatgtatgtatgt 95331 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 72672 tatgtatgtatgtatgtatgt 72692 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67027 tatgtatgtatgtatgtatgt 67047 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67023 tatgtatgtatgtatgtatgt 67043 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67019 tatgtatgtatgtatgtatgt 67039 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67015 tatgtatgtatgtatgtatgt 67035 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63291 tatgtatgtatgtatgtatgt 63311 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63287 tatgtatgtatgtatgtatgt 63307 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63283 tatgtatgtatgtatgtatgt 63303 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63279 tatgtatgtatgtatgtatgt 63299 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63275 tatgtatgtatgtatgtatgt 63295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63271 tatgtatgtatgtatgtatgt 63291 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 63267 tatgtatgtatgtatgtatgt 63287 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 123857 tatgtatgtatgtatgtatg 123876 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 72657 atctatgtatctatgtatgtatgt 72680
>gb|AC156501.3| Mus musculus BAC clone RP23-358M3 from chromosome 14, complete sequence Length = 195115 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 137452 aatctatgtatgtatgtatgtatgt 137428 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137444 tatgtatgtatgtatgtatgt 137424 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137440 tatgtatgtatgtatgtatgt 137420 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137436 tatgtatgtatgtatgtatgt 137416
>gb|AC018951.8|AC018951 Homo sapiens chromosome 11, clone RP11-307P14, complete sequence Length = 194547 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 182820 aatctatgtatgtatgtatgtatgt 182796 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182812 tatgtatgtatgtatgtatgt 182792 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182808 tatgtatgtatgtatgtatgt 182788 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182804 tatgtatgtatgtatgtatgt 182784 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182800 tatgtatgtatgtatgtatgt 182780 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182796 tatgtatgtatgtatgtatgt 182776 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182792 tatgtatgtatgtatgtatgt 182772 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182788 tatgtatgtatgtatgtatgt 182768 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182784 tatgtatgtatgtatgtatgt 182764 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182780 tatgtatgtatgtatgtatgt 182760
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 196039 tatgtatgtatgtatgtatgtggct 196015 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 5467047 tctatgtatgtatgtatgtatgt 5467069 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 3495125 tatgtatgtatgtatgtatgtg 3495146 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 146 ctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||| Sbjct: 89551 ctatgtatgtatgtatgtatgt 89530 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715614 tatgtatgtatgtatgtatgt 27715594 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715610 tatgtatgtatgtatgtatgt 27715590 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715606 tatgtatgtatgtatgtatgt 27715586 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715602 tatgtatgtatgtatgtatgt 27715582 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715598 tatgtatgtatgtatgtatgt 27715578 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715594 tatgtatgtatgtatgtatgt 27715574 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715590 tatgtatgtatgtatgtatgt 27715570 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715586 tatgtatgtatgtatgtatgt 27715566 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715582 tatgtatgtatgtatgtatgt 27715562 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715578 tatgtatgtatgtatgtatgt 27715558 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715574 tatgtatgtatgtatgtatgt 27715554 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715570 tatgtatgtatgtatgtatgt 27715550 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27715566 tatgtatgtatgtatgtatgt 27715546 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194323 tatgtatgtatgtatgtatgt 27194343 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194319 tatgtatgtatgtatgtatgt 27194339 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194315 tatgtatgtatgtatgtatgt 27194335 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194311 tatgtatgtatgtatgtatgt 27194331 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194307 tatgtatgtatgtatgtatgt 27194327 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194303 tatgtatgtatgtatgtatgt 27194323 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194299 tatgtatgtatgtatgtatgt 27194319 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194295 tatgtatgtatgtatgtatgt 27194315 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194291 tatgtatgtatgtatgtatgt 27194311 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194287 tatgtatgtatgtatgtatgt 27194307 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194283 tatgtatgtatgtatgtatgt 27194303 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194279 tatgtatgtatgtatgtatgt 27194299 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194275 tatgtatgtatgtatgtatgt 27194295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194271 tatgtatgtatgtatgtatgt 27194291 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194267 tatgtatgtatgtatgtatgt 27194287 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194263 tatgtatgtatgtatgtatgt 27194283 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194259 tatgtatgtatgtatgtatgt 27194279 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194255 tatgtatgtatgtatgtatgt 27194275 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194251 tatgtatgtatgtatgtatgt 27194271 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194247 tatgtatgtatgtatgtatgt 27194267 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194243 tatgtatgtatgtatgtatgt 27194263 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194239 tatgtatgtatgtatgtatgt 27194259 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194235 tatgtatgtatgtatgtatgt 27194255 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194231 tatgtatgtatgtatgtatgt 27194251 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194227 tatgtatgtatgtatgtatgt 27194247 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194223 tatgtatgtatgtatgtatgt 27194243 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194219 tatgtatgtatgtatgtatgt 27194239 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194215 tatgtatgtatgtatgtatgt 27194235 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194211 tatgtatgtatgtatgtatgt 27194231 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27194207 tatgtatgtatgtatgtatgt 27194227 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25952760 tatgtatgtatgtatgtatgt 25952740 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040873 tatgtatgtatgtatgtatgt 25040853 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040869 tatgtatgtatgtatgtatgt 25040849 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040865 tatgtatgtatgtatgtatgt 25040845 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040861 tatgtatgtatgtatgtatgt 25040841 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040857 tatgtatgtatgtatgtatgt 25040837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040853 tatgtatgtatgtatgtatgt 25040833 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040849 tatgtatgtatgtatgtatgt 25040829 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25040845 tatgtatgtatgtatgtatgt 25040825 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23626852 tatgtatgtatgtatgtatgt 23626872 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23626848 tatgtatgtatgtatgtatgt 23626868 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23626844 tatgtatgtatgtatgtatgt 23626864 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23626840 tatgtatgtatgtatgtatgt 23626860 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23626836 tatgtatgtatgtatgtatgt 23626856 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 20582516 tatgtatgtatgtatgtatgt 20582536 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16372713 tatgtatgtatgtatgtatgt 16372733 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16233817 tatgtatgtatgtatgtatgt 16233837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16233813 tatgtatgtatgtatgtatgt 16233833 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16233809 tatgtatgtatgtatgtatgt 16233829 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15058564 tatgtatgtatgtatgtatgt 15058584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15058560 tatgtatgtatgtatgtatgt 15058580 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14662657 tatgtatgtatgtatgtatgt 14662677 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14662653 tatgtatgtatgtatgtatgt 14662673 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14662649 tatgtatgtatgtatgtatgt 14662669 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11240584 tatgtatgtatgtatgtatgt 11240604 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11158186 tatgtatgtatgtatgtatgt 11158206 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11158182 tatgtatgtatgtatgtatgt 11158202 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791170 tatgtatgtatgtatgtatgt 5791190 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791166 tatgtatgtatgtatgtatgt 5791186 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791162 tatgtatgtatgtatgtatgt 5791182 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791158 tatgtatgtatgtatgtatgt 5791178 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791154 tatgtatgtatgtatgtatgt 5791174 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791150 tatgtatgtatgtatgtatgt 5791170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791146 tatgtatgtatgtatgtatgt 5791166 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791142 tatgtatgtatgtatgtatgt 5791162 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791138 tatgtatgtatgtatgtatgt 5791158 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5791134 tatgtatgtatgtatgtatgt 5791154 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5467053 tatgtatgtatgtatgtatgt 5467073 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319104 tatgtatgtatgtatgtatgt 4319124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319100 tatgtatgtatgtatgtatgt 4319120 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319096 tatgtatgtatgtatgtatgt 4319116 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319092 tatgtatgtatgtatgtatgt 4319112 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319088 tatgtatgtatgtatgtatgt 4319108 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319084 tatgtatgtatgtatgtatgt 4319104 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319080 tatgtatgtatgtatgtatgt 4319100 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319076 tatgtatgtatgtatgtatgt 4319096 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319072 tatgtatgtatgtatgtatgt 4319092 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319068 tatgtatgtatgtatgtatgt 4319088 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319064 tatgtatgtatgtatgtatgt 4319084 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319060 tatgtatgtatgtatgtatgt 4319080 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319056 tatgtatgtatgtatgtatgt 4319076 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319052 tatgtatgtatgtatgtatgt 4319072 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319048 tatgtatgtatgtatgtatgt 4319068 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319044 tatgtatgtatgtatgtatgt 4319064 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319040 tatgtatgtatgtatgtatgt 4319060 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319036 tatgtatgtatgtatgtatgt 4319056 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319032 tatgtatgtatgtatgtatgt 4319052 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319028 tatgtatgtatgtatgtatgt 4319048 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319024 tatgtatgtatgtatgtatgt 4319044 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319020 tatgtatgtatgtatgtatgt 4319040 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319016 tatgtatgtatgtatgtatgt 4319036 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319012 tatgtatgtatgtatgtatgt 4319032 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319008 tatgtatgtatgtatgtatgt 4319028 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319004 tatgtatgtatgtatgtatgt 4319024 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4319000 tatgtatgtatgtatgtatgt 4319020 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318996 tatgtatgtatgtatgtatgt 4319016 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318992 tatgtatgtatgtatgtatgt 4319012 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318988 tatgtatgtatgtatgtatgt 4319008 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318984 tatgtatgtatgtatgtatgt 4319004 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318980 tatgtatgtatgtatgtatgt 4319000 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318976 tatgtatgtatgtatgtatgt 4318996 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318972 tatgtatgtatgtatgtatgt 4318992 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318968 tatgtatgtatgtatgtatgt 4318988 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318964 tatgtatgtatgtatgtatgt 4318984 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318960 tatgtatgtatgtatgtatgt 4318980 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318956 tatgtatgtatgtatgtatgt 4318976 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318952 tatgtatgtatgtatgtatgt 4318972 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318948 tatgtatgtatgtatgtatgt 4318968 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318944 tatgtatgtatgtatgtatgt 4318964 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4318940 tatgtatgtatgtatgtatgt 4318960 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495121 tatgtatgtatgtatgtatgt 3495141 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495117 tatgtatgtatgtatgtatgt 3495137 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495113 tatgtatgtatgtatgtatgt 3495133 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495109 tatgtatgtatgtatgtatgt 3495129 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495105 tatgtatgtatgtatgtatgt 3495125 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495101 tatgtatgtatgtatgtatgt 3495121 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495097 tatgtatgtatgtatgtatgt 3495117 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495093 tatgtatgtatgtatgtatgt 3495113 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495089 tatgtatgtatgtatgtatgt 3495109 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495085 tatgtatgtatgtatgtatgt 3495105 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 3495081 tatgtatgtatgtatgtatgt 3495101 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2875576 tatgtatgtatgtatgtatgt 2875556 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2875550 tatgtatgtatgtatgtatgt 2875530 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2875546 tatgtatgtatgtatgtatgt 2875526 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666557 tatgtatgtatgtatgtatgt 2666537 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666553 tatgtatgtatgtatgtatgt 2666533 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666549 tatgtatgtatgtatgtatgt 2666529 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666545 tatgtatgtatgtatgtatgt 2666525 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666541 tatgtatgtatgtatgtatgt 2666521 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666537 tatgtatgtatgtatgtatgt 2666517 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666533 tatgtatgtatgtatgtatgt 2666513 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666529 tatgtatgtatgtatgtatgt 2666509 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666525 tatgtatgtatgtatgtatgt 2666505 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666521 tatgtatgtatgtatgtatgt 2666501 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666517 tatgtatgtatgtatgtatgt 2666497 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 2666513 tatgtatgtatgtatgtatgt 2666493 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1023212 tatgtatgtatgtatgtatgt 1023192 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1023208 tatgtatgtatgtatgtatgt 1023188 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1023204 tatgtatgtatgtatgtatgt 1023184 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 1023200 tatgtatgtatgtatgtatgt 1023180 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89546 tatgtatgtatgtatgtatgt 89526 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89542 tatgtatgtatgtatgtatgt 89522 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89538 tatgtatgtatgtatgtatgt 89518 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89534 tatgtatgtatgtatgtatgt 89514 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89530 tatgtatgtatgtatgtatgt 89510 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89526 tatgtatgtatgtatgtatgt 89506 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89522 tatgtatgtatgtatgtatgt 89502 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 17258669 tatgtatgtatgtatgtatg 17258688 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 17258666 atgtatgtatgtatgtatgt 17258685 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 14662661 tatgtatgtatgtatgtatg 14662680 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 9950640 tatgtatgtatgtatgtatg 9950621 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 5791174 tatgtatgtatgtatgtatg 5791193 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 5467057 tatgtatgtatgtatgtatg 5467076 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 89518 tatgtatgtatgtatgtatg 89499
>gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone rp23-362c8, complete sequence Length = 238658 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 84810 aatctatgtatgtatgtatgtatgt 84834 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84850 tatgtatgtatgtatgtatgt 84870 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84846 tatgtatgtatgtatgtatgt 84866 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84842 tatgtatgtatgtatgtatgt 84862 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84838 tatgtatgtatgtatgtatgt 84858 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84834 tatgtatgtatgtatgtatgt 84854 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84830 tatgtatgtatgtatgtatgt 84850 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84826 tatgtatgtatgtatgtatgt 84846 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84822 tatgtatgtatgtatgtatgt 84842 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84818 tatgtatgtatgtatgtatgt 84838 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61588 tatgtatgtatgtatgtatgt 61608 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61584 tatgtatgtatgtatgtatgt 61604 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61580 tatgtatgtatgtatgtatgt 61600 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61576 tatgtatgtatgtatgtatgt 61596 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61572 tatgtatgtatgtatgtatgt 61592 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61568 tatgtatgtatgtatgtatgt 61588 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61564 tatgtatgtatgtatgtatgt 61584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61560 tatgtatgtatgtatgtatgt 61580 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61556 tatgtatgtatgtatgtatgt 61576 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 84854 tatgtatgtatgtatgtatg 84873 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 61592 tatgtatgtatgtatgtatg 61611
>gb|AC156286.8| Mus musculus 6 BAC RP24-285N17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 180204 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 145760 atctatgtatgtatgtatgtatgtg 145784 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 145752 atctatgtatctatgtatgtatgt 145775
>gb|AC154524.2| Mus musculus BAC clone RP24-68D23 from chromosome 16, complete sequence Length = 252926 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 105499 atctatgtatgtatgtatgtatgtg 105475 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 208008 tgtatgtatgtatgtatgtg 208027
>gb|AC158497.2| Medicago truncatula chromosome 2 BAC clone mth2-48e18, complete sequence Length = 146321 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 60504 atctatgtatgtatgtatgtatgtg 60480
>gb|AC129951.9| Mus musculus chromosome 15, clone RP23-127B14, complete sequence Length = 211987 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 96091 tatgtatgtatgtatgtatgtggct 96115 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 203759 tatgtatgtatgtatgtatgt 203739 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 203755 tatgtatgtatgtatgtatgt 203735 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 80850 tatgtatgtatgtatgtatgt 80830 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 80846 tatgtatgtatgtatgtatgt 80826 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 80842 tatgtatgtatgtatgtatgt 80822 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 80838 tatgtatgtatgtatgtatgt 80818 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 80834 tatgtatgtatgtatgtatgt 80814 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 203751 tatgtatgtatgtatgtatg 203732
>gb|AC132145.3| Mus musculus BAC clone RP23-44H21 from chromosome 7, complete sequence Length = 162513 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 9182 acaaaacctatgtatgtatgtatgtatgt 9154
>gb|AC158671.3| Mus musculus 6 BAC RP23-62E15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 218969 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 33276 aatctatgtatgtatgtatgtatgt 33300 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129742 tatgtatgtatgtatgtatgt 129722 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129738 tatgtatgtatgtatgtatgt 129718 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129734 tatgtatgtatgtatgtatgt 129714 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129730 tatgtatgtatgtatgtatgt 129710 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129726 tatgtatgtatgtatgtatgt 129706 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129722 tatgtatgtatgtatgtatgt 129702 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129718 tatgtatgtatgtatgtatgt 129698 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33292 tatgtatgtatgtatgtatgt 33312 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33288 tatgtatgtatgtatgtatgt 33308 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33284 tatgtatgtatgtatgtatgt 33304 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 33296 tatgtatgtatgtatgtatg 33315
>gb|AC116118.16| Mus musculus chromosome 16, clone RP23-73P19, complete sequence Length = 128851 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 26670 aatctatgtatgtatgtatgtatgt 26694 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 102999 tatgtatgtatgtatgtatgtg 102978 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103011 tatgtatgtatgtatgtatgt 102991 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103007 tatgtatgtatgtatgtatgt 102987 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103003 tatgtatgtatgtatgtatgt 102983 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86034 tatgtatgtatgtatgtatgt 86014 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86030 tatgtatgtatgtatgtatgt 86010 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86026 tatgtatgtatgtatgtatgt 86006 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26710 tatgtatgtatgtatgtatgt 26730 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26706 tatgtatgtatgtatgtatgt 26726 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26702 tatgtatgtatgtatgtatgt 26722 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 26699 atgtatgtatgtatgtatgt 26718
>dbj|AP004654.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0015C07 Length = 149079 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 111374 tatgtatgtatgtatgtatgtggct 111350 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 146 ctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||| Sbjct: 4886 ctatgtatgtatgtatgtatgt 4865 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4881 tatgtatgtatgtatgtatgt 4861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4877 tatgtatgtatgtatgtatgt 4857 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4873 tatgtatgtatgtatgtatgt 4853 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4869 tatgtatgtatgtatgtatgt 4849 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4865 tatgtatgtatgtatgtatgt 4845 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4861 tatgtatgtatgtatgtatgt 4841 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4857 tatgtatgtatgtatgtatgt 4837 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 4853 tatgtatgtatgtatgtatg 4834
>emb|BX294661.14| Zebrafish DNA sequence from clone CH211-199I18 in linkage group 20, complete sequence Length = 197237 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 108278 aatctatgtatgtatgtatgtatgt 108302 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 108290 tatgtatgtatgtatgtatgtg 108311 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 108286 tatgtatgtatgtatgtatgt 108306
>emb|BX005304.8| Mouse DNA sequence from clone RP23-328P5 on chromosome 2, complete sequence Length = 200574 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 58942 aatctatgtatgtatgtatgtatgt 58918 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 152747 tatgtatgtatgtatgtatgtg 152726
>emb|BX537252.4| Mouse DNA sequence from clone RP23-268L10 on chromosome 2, complete sequence Length = 18108 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 13200 aatctatgtatgtatgtatgtatgt 13176 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 13176 tatgtatgtatgtatgtatgtg 13155 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13192 tatgtatgtatgtatgtatgt 13172 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13188 tatgtatgtatgtatgtatgt 13168 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13184 tatgtatgtatgtatgtatgt 13164 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 13180 tatgtatgtatgtatgtatgt 13160
>gb|AC154771.2| Mus musculus BAC clone RP24-448F8 from 13, complete sequence Length = 165376 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 139 acaaaatctatgtatgtatgtatgtatgt 167 |||||| |||||||||||||||||||||| Sbjct: 142233 acaaaaactatgtatgtatgtatgtatgt 142205 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 86166 tatgtatgtatgtatgtatgtg 86187 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 36156 tatgtatgtatgtatgtatgtg 36135 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142221 tatgtatgtatgtatgtatgt 142201 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142217 tatgtatgtatgtatgtatgt 142197 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142213 tatgtatgtatgtatgtatgt 142193 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124109 tatgtatgtatgtatgtatgt 124089 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86162 tatgtatgtatgtatgtatgt 86182 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86158 tatgtatgtatgtatgtatgt 86178 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86154 tatgtatgtatgtatgtatgt 86174 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86150 tatgtatgtatgtatgtatgt 86170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86146 tatgtatgtatgtatgtatgt 86166 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86142 tatgtatgtatgtatgtatgt 86162 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86138 tatgtatgtatgtatgtatgt 86158 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36168 tatgtatgtatgtatgtatgt 36148 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36164 tatgtatgtatgtatgtatgt 36144 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36160 tatgtatgtatgtatgtatgt 36140 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 124112 atgtatgtatgtatgtatgt 124093 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 124085 tatgtatgtatgtatgtatg 124066 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 90772 tatgtatgtatgtatgtatg 90753 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 36171 atgtatgtatgtatgtatgt 36152
>emb|CR394522.8| Zebrafish DNA sequence from clone DKEY-159D6 in linkage group 22, complete sequence Length = 91897 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 52260 aatctatgtatgtatgtatgtatgt 52236 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52252 tatgtatgtatgtatgtatgt 52232 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52248 tatgtatgtatgtatgtatgt 52228 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52244 tatgtatgtatgtatgtatgt 52224 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52240 tatgtatgtatgtatgtatgt 52220 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52236 tatgtatgtatgtatgtatgt 52216 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52232 tatgtatgtatgtatgtatgt 52212 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52228 tatgtatgtatgtatgtatgt 52208 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52224 tatgtatgtatgtatgtatgt 52204 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52220 tatgtatgtatgtatgtatgt 52200 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52216 tatgtatgtatgtatgtatgt 52196 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52212 tatgtatgtatgtatgtatgt 52192 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52024 tatgtatgtatgtatgtatgt 52004 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52020 tatgtatgtatgtatgtatgt 52000 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52016 tatgtatgtatgtatgtatgt 51996 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52012 tatgtatgtatgtatgtatgt 51992 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52008 tatgtatgtatgtatgtatgt 51988 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51848 tatgtatgtatgtatgtatgt 51828 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51844 tatgtatgtatgtatgtatgt 51824 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51840 tatgtatgtatgtatgtatgt 51820 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51836 tatgtatgtatgtatgtatgt 51816 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 52031 atctatatatgtatgtatgtatgt 52008 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 51855 atctatatatgtatgtatgtatgt 51832
>gb|AC104894.14| Mus musculus chromosome 1, clone RP23-290I22, complete sequence Length = 185038 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 162999 tatgtatgtatgtatgtatgtggct 163023 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162995 tatgtatgtatgtatgtatgt 163015 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162991 tatgtatgtatgtatgtatgt 163011 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162987 tatgtatgtatgtatgtatgt 163007 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162983 tatgtatgtatgtatgtatgt 163003 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162979 tatgtatgtatgtatgtatgt 162999
>gb|AC153816.4| Mus musculus BAC RP23-8N6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 217283 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Plus Query: 135 catcacaaaatctatgtatgtatgtatgtatgt 167 |||||||| || ||||||||||||||||||||| Sbjct: 94762 catcacaagatgtatgtatgtatgtatgtatgt 94794 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159959 tatgtatgtatgtatgtatgt 159939 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159955 tatgtatgtatgtatgtatgt 159935 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159951 tatgtatgtatgtatgtatgt 159931 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159947 tatgtatgtatgtatgtatgt 159927 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159943 tatgtatgtatgtatgtatgt 159923 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159939 tatgtatgtatgtatgtatgt 159919 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159935 tatgtatgtatgtatgtatgt 159915 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 94786 tatgtatgtatgtatgtatgt 94806 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 94782 tatgtatgtatgtatgtatgt 94802 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 94778 tatgtatgtatgtatgtatgt 94798 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 94790 tatgtatgtatgtatgtatg 94809
>gb|AC115071.9| Mus musculus chromosome 3, clone RP24-408F11, complete sequence Length = 139925 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 60698 aatctatgtatgtatgtatgtatgt 60674 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 60690 tatgtatgtatgtatgtatgt 60670 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 60686 tatgtatgtatgtatgtatgt 60666 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 60682 tatgtatgtatgtatgtatgt 60662
>gb|AC091326.8| Mus musculus chromosome 8, clone RP23-135P2, complete sequence Length = 180929 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 129905 aatctatgtatgtatgtatgtatgt 129881 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129897 tatgtatgtatgtatgtatgt 129877 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129893 tatgtatgtatgtatgtatgt 129873 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129889 tatgtatgtatgtatgtatgt 129869 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 129885 tatgtatgtatgtatgtatgt 129865
>gb|AC116688.14| Mus musculus chromosome 17, clone RP24-169A20, complete sequence Length = 150860 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 130635 tatgtatgtatgtatgtatgtggct 130611 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130655 tatgtatgtatgtatgtatgt 130635 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130651 tatgtatgtatgtatgtatgt 130631 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130647 tatgtatgtatgtatgtatgt 130627 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130643 tatgtatgtatgtatgtatgt 130623 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130639 tatgtatgtatgtatgtatgt 130619 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26628 tatgtatgtatgtatgtatgt 26648 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26624 tatgtatgtatgtatgtatgt 26644 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26620 tatgtatgtatgtatgtatgt 26640 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 26616 tatgtatgtatgtatgtatgt 26636 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 106 caagccagcaaacaaacaaaaaat 129 ||||| |||||||||||||||||| Sbjct: 80656 caagcaagcaaacaaacaaaaaat 80633
>dbj|AP002765.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-634B22, complete sequence Length = 178169 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 159875 atctatgtatgtatgtatgtatgtg 159899
>dbj|AP000868.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-688B18, complete sequence Length = 181589 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 857 atctatgtatgtatgtatgtatgtg 881
>gb|AC079082.39| Mus musculus strain C57BL/6J chromosome 10 clone rp23-161b11, complete sequence Length = 205621 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 17742 aatctatgtatgtatgtatgtatgt 17718 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40996 tatgtatgtatgtatgtatgt 40976 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40992 tatgtatgtatgtatgtatgt 40972 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40988 tatgtatgtatgtatgtatgt 40968 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40984 tatgtatgtatgtatgtatgt 40964 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40980 tatgtatgtatgtatgtatgt 40960 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40976 tatgtatgtatgtatgtatgt 40956 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40972 tatgtatgtatgtatgtatgt 40952 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40968 tatgtatgtatgtatgtatgt 40948 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 40964 tatgtatgtatgtatgtatgt 40944 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17734 tatgtatgtatgtatgtatgt 17714 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17730 tatgtatgtatgtatgtatgt 17710 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17726 tatgtatgtatgtatgtatgt 17706 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17722 tatgtatgtatgtatgtatgt 17702 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17718 tatgtatgtatgtatgtatgt 17698 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17714 tatgtatgtatgtatgtatgt 17694 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17710 tatgtatgtatgtatgtatgt 17690 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17706 tatgtatgtatgtatgtatgt 17686 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17702 tatgtatgtatgtatgtatgt 17682 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 40960 tatgtatgtatgtatgtatg 40941 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 17698 tatgtatgtatgtatgtatg 17679
>emb|AL592188.60| Human DNA sequence from clone RP11-337M7 on chromosome 22, complete sequence Length = 161802 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 121288 atctatgtatgtatgtatgtatgtg 121312 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 131054 tatgtatgtatgtatgtatgtg 131033 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 126603 tatgtatgtatgtatgtatgtg 126582 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 145193 tatgtatgtatgtatgtatgt 145173 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 145189 tatgtatgtatgtatgtatgt 145169 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 145185 tatgtatgtatgtatgtatgt 145165 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131074 tatgtatgtatgtatgtatgt 131054 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131070 tatgtatgtatgtatgtatgt 131050 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131066 tatgtatgtatgtatgtatgt 131046 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131062 tatgtatgtatgtatgtatgt 131042 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131058 tatgtatgtatgtatgtatgt 131038 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126623 tatgtatgtatgtatgtatgt 126603 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126619 tatgtatgtatgtatgtatgt 126599 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126615 tatgtatgtatgtatgtatgt 126595 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126611 tatgtatgtatgtatgtatgt 126591 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126607 tatgtatgtatgtatgtatgt 126587 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 126626 atgtatgtatgtatgtatgt 126607
>emb|CT010490.10| Mouse DNA sequence from clone RP23-148P12 on chromosome 16, complete sequence Length = 206348 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 103954 aatctatgtatgtatgtatgtatgt 103978 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 180280 tatgtatgtatgtatgtatgtg 180259 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180292 tatgtatgtatgtatgtatgt 180272 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180288 tatgtatgtatgtatgtatgt 180268 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180284 tatgtatgtatgtatgtatgt 180264 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163315 tatgtatgtatgtatgtatgt 163295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163311 tatgtatgtatgtatgtatgt 163291 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 163307 tatgtatgtatgtatgtatgt 163287 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103994 tatgtatgtatgtatgtatgt 104014 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103990 tatgtatgtatgtatgtatgt 104010 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103986 tatgtatgtatgtatgtatgt 104006 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 103983 atgtatgtatgtatgtatgt 104002
>gb|AC154672.2| Mus musculus BAC clone RP24-297H12 from 14, complete sequence Length = 163733 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 638 cgatgaacatacaacggttcatttc 662 ||||||||||||||||||||||||| Sbjct: 147055 cgatgaacatacaacggttcatttc 147031 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33282 tatgtatgtatgtatgtatgt 33262 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33278 tatgtatgtatgtatgtatgt 33258 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 33274 tatgtatgtatgtatgtatgt 33254
>gb|AC122346.4| Mus musculus BAC clone RP23-368L6 from 13, complete sequence Length = 198130 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 185936 tatgtatgtatgtatgtatgtggct 185912 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 185044 tatgtatgtatgtatgtatgtggct 185020 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatg 166 ||||||||||||||||||||||| Sbjct: 157583 atctatgtatgtatgtatgtatg 157561 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185952 tatgtatgtatgtatgtatgt 185932 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185948 tatgtatgtatgtatgtatgt 185928 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185944 tatgtatgtatgtatgtatgt 185924 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185940 tatgtatgtatgtatgtatgt 185920 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185056 tatgtatgtatgtatgtatgt 185036 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185052 tatgtatgtatgtatgtatgt 185032 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 185048 tatgtatgtatgtatgtatgt 185028
>gb|AC153498.17| Mus musculus 10 BAC RP23-353P23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192394 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 85611 aatctatgtatgtatgtatgtatgt 85587 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 85582 atctatgtatgtatgtatgtatgt 85559 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 72102 tatgtatgtatgtatgtatgtg 72081 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 85575 tatgtatgtatgtatgtatgt 85555 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 85571 tatgtatgtatgtatgtatgt 85551 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53357 tatgtatgtatgtatgtatgt 53377 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53353 tatgtatgtatgtatgtatgt 53373 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53349 tatgtatgtatgtatgtatgt 53369 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53345 tatgtatgtatgtatgtatgt 53365 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 85567 tatgtatgtatgtatgtatg 85548 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 53342 atgtatgtatgtatgtatgt 53361
>emb|AL844150.6| Zebrafish DNA sequence from clone DKEY-246K2, complete sequence Length = 203058 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 79007 atctatgtatgtatgtatgtatgtg 78983 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 141175 tatgtatgtatgtatgtatgt 141195 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 141171 tatgtatgtatgtatgtatgt 141191
>gb|AC171502.2| Mus musculus BAC clone RP23-242G4 from chromosome 6, complete sequence Length = 209147 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgtg 168 ||||||||||||||||||||||||| Sbjct: 126666 atctatgtatgtatgtatgtatgtg 126690 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 92606 tatgtatgtatgtatgtatgtg 92627 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126645 tatgtatgtatgtatgtatgt 126665 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126641 tatgtatgtatgtatgtatgt 126661 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126637 tatgtatgtatgtatgtatgt 126657 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126633 tatgtatgtatgtatgtatgt 126653 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92602 tatgtatgtatgtatgtatgt 92622 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92598 tatgtatgtatgtatgtatgt 92618 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92594 tatgtatgtatgtatgtatgt 92614 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92590 tatgtatgtatgtatgtatgt 92610 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92586 tatgtatgtatgtatgtatgt 92606 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 126630 atgtatgtatgtatgtatgt 126649 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 64794 tgtatgtatgtatgtatgtg 64775
>gb|AC153885.2| Mus musculus 6 BAC RP23-477L5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190785 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 115886 aatctatgtatgtatgtatgtatgt 115910 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115902 tatgtatgtatgtatgtatgt 115922 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115898 tatgtatgtatgtatgtatgt 115918 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115894 tatgtatgtatgtatgtatgt 115914 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 115906 tatgtatgtatgtatgtatg 115925
>emb|AL591586.8| Mouse DNA sequence from clone RP23-126L18 on chromosome 2, complete sequence Length = 187043 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 161242 aatctatgtatgtatgtatgtatgt 161218 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161234 tatgtatgtatgtatgtatgt 161214 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161230 tatgtatgtatgtatgtatgt 161210 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161226 tatgtatgtatgtatgtatgt 161206 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161222 tatgtatgtatgtatgtatgt 161202 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161218 tatgtatgtatgtatgtatgt 161198 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161214 tatgtatgtatgtatgtatgt 161194 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 161210 tatgtatgtatgtatgtatg 161191
>emb|AL606916.4| Mouse DNA sequence from clone RP23-144L24 on chromosome 4, complete sequence Length = 190214 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 143 aatctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||||| Sbjct: 98631 aatctatgtatgtatgtatgtatgt 98655 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 89490 atctatgtatgtatgtatgtatgt 89513 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98655 tatgtatgtatgtatgtatgt 98675 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98651 tatgtatgtatgtatgtatgt 98671 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98647 tatgtatgtatgtatgtatgt 98667 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98643 tatgtatgtatgtatgtatgt 98663 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98639 tatgtatgtatgtatgtatgt 98659 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89509 tatgtatgtatgtatgtatgt 89529 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89505 tatgtatgtatgtatgtatgt 89525 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89501 tatgtatgtatgtatgtatgt 89521 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89497 tatgtatgtatgtatgtatgt 89517 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69920 tatgtatgtatgtatgtatgt 69940 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69916 tatgtatgtatgtatgtatgt 69936 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69912 tatgtatgtatgtatgtatgt 69932 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31580 tatgtatgtatgtatgtatgt 31600
>emb|AL672066.10| Mouse DNA sequence from clone RP23-311G7 on chromosome X, complete sequence Length = 152281 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggct 171 ||||||||||||||||||||||||| Sbjct: 79666 tatgtatgtatgtatgtatgtggct 79642 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79727 tatgtatgtatgtatgtatgt 79707 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79674 tatgtatgtatgtatgtatgt 79654 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79670 tatgtatgtatgtatgtatgt 79650 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 79723 tatgtatgtatgtatgtatg 79704 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 79677 atgtatgtatgtatgtatgt 79658
>gb|AC113289.12| Mus musculus chromosome 15, clone RP23-414M11, complete sequence Length = 211054 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||||| Sbjct: 201066 tctatgtatgtatgtatgtatgtg 201043 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 201040 tatgtatgtatgtatgtatgt 201020 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 201036 tatgtatgtatgtatgtatgt 201016 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 201032 tatgtatgtatgtatgtatgt 201012 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 201028 tatgtatgtatgtatgtatgt 201008 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 201024 tatgtatgtatgtatgtatgt 201004
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 38449 atctatgtatgtatgtatgtatgt 38472 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38464 tatgtatgtatgtatgtatgt 38484 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38460 tatgtatgtatgtatgtatgt 38480 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38456 tatgtatgtatgtatgtatgt 38476
>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence Length = 206094 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 197175 atctatgtatgtatgtatgtatgt 197198 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 201336 tatgtatgtatgtatgtatgtg 201315 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 197182 tatgtatgtatgtatgtatgt 197202 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 154869 tatgtatgtatgtatgtatgt 154889 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 154865 tatgtatgtatgtatgtatgt 154885 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 154861 tatgtatgtatgtatgtatgt 154881 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 154873 tatgtatgtatgtatgtatg 154892
>gb|AC114554.8| Mus musculus chromosome 5, clone RP23-414E14, complete sequence Length = 204467 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 137476 atctatgtatgtatgtatgtatgt 137453 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 137469 tatgtatgtatgtatgtatgtg 137448 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137549 tatgtatgtatgtatgtatgt 137529 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137545 tatgtatgtatgtatgtatgt 137525 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137541 tatgtatgtatgtatgtatgt 137521 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 137537 tatgtatgtatgtatgtatg 137518
>gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, complete sequence Length = 209808 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 135106 atctatgtatgtatgtatgtatgt 135083 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135099 tatgtatgtatgtatgtatgt 135079 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135095 tatgtatgtatgtatgtatgt 135075 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135091 tatgtatgtatgtatgtatgt 135071 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135087 tatgtatgtatgtatgtatgt 135067 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135083 tatgtatgtatgtatgtatgt 135063 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 135114 atctatgtatctatgtatgtatgt 135091
>gb|AC102501.9| Mus musculus chromosome 5, clone RP24-315J23, complete sequence Length = 207791 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 160912 atctatgtatgtatgtatgtatgt 160935 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160931 tatgtatgtatgtatgtatgt 160951 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160927 tatgtatgtatgtatgtatgt 160947 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160923 tatgtatgtatgtatgtatgt 160943 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160919 tatgtatgtatgtatgtatgt 160939 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 114340 tatgtatgtatgtatgtatgt 114320
>gb|AC116727.9| Mus musculus chromosome 3, clone RP23-290J2, complete sequence Length = 163945 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 69746 atctatgtatgtatgtatgtatgt 69769 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtat 165 |||||||||||||||||||||| Sbjct: 20793 atctatgtatgtatgtatgtat 20814 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111059 tatgtatgtatgtatgtatgt 111079 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111055 tatgtatgtatgtatgtatgt 111075 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111051 tatgtatgtatgtatgtatgt 111071 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111047 tatgtatgtatgtatgtatgt 111067 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111043 tatgtatgtatgtatgtatgt 111063 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111039 tatgtatgtatgtatgtatgt 111059 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111035 tatgtatgtatgtatgtatgt 111055 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69757 tatgtatgtatgtatgtatgt 69777 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69753 tatgtatgtatgtatgtatgt 69773 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69587 tatgtatgtatgtatgtatgt 69607 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 20816 tatgtatgtatgtatgtatgt 20836 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 111032 atgtatgtatgtatgtatgt 111051 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 69761 tatgtatgtatgtatgtatg 69780 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 69584 atgtatgtatgtatgtatgt 69603
>gb|AC101661.7| Mus musculus chromosome 1, clone RP23-26A10, complete sequence Length = 228933 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 139470 atctatgtatgtatgtatgtatgt 139447 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 197351 tatgtatgtatgtatgtatgt 197331 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 197347 tatgtatgtatgtatgtatgt 197327 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 197343 tatgtatgtatgtatgtatgt 197323 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 197339 tatgtatgtatgtatgtatgt 197319 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139463 tatgtatgtatgtatgtatgt 139443 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139459 tatgtatgtatgtatgtatgt 139439 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139455 tatgtatgtatgtatgtatgt 139435 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139451 tatgtatgtatgtatgtatgt 139431 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119169 tatgtatgtatgtatgtatgt 119189 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119165 tatgtatgtatgtatgtatgt 119185
>gb|AC156036.4| Mus musculus BAC clone RP23-341B16 from chromosome 12, complete sequence Length = 211424 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 101080 atctatgtatgtatgtatgtatgt 101057 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101073 tatgtatgtatgtatgtatgt 101053 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101069 tatgtatgtatgtatgtatgt 101049 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101065 tatgtatgtatgtatgtatgt 101045 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101061 tatgtatgtatgtatgtatgt 101041 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101057 tatgtatgtatgtatgtatgt 101037 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101053 tatgtatgtatgtatgtatgt 101033 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101049 tatgtatgtatgtatgtatgt 101029 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101045 tatgtatgtatgtatgtatgt 101025
>gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome 8, complete sequence Length = 212711 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 57949 atctatgtatgtatgtatgtatgt 57926 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 58160 tctatgtatgtatgtatgtatgt 58138 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 173093 tatgtatgtatgtatgtatgtg 173114 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173089 tatgtatgtatgtatgtatgt 173109 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58154 tatgtatgtatgtatgtatgt 58134 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58150 tatgtatgtatgtatgtatgt 58130 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58146 tatgtatgtatgtatgtatgt 58126 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58142 tatgtatgtatgtatgtatgt 58122 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58138 tatgtatgtatgtatgtatgt 58118 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58134 tatgtatgtatgtatgtatgt 58114 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58130 tatgtatgtatgtatgtatgt 58110 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58126 tatgtatgtatgtatgtatgt 58106 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58122 tatgtatgtatgtatgtatgt 58102 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58082 tatgtatgtatgtatgtatgt 58062 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58078 tatgtatgtatgtatgtatgt 58058 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58074 tatgtatgtatgtatgtatgt 58054 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 58070 tatgtatgtatgtatgtatgt 58050 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57942 tatgtatgtatgtatgtatgt 57922 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57938 tatgtatgtatgtatgtatgt 57918 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57934 tatgtatgtatgtatgtatgt 57914 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57930 tatgtatgtatgtatgtatgt 57910 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57926 tatgtatgtatgtatgtatgt 57906 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57922 tatgtatgtatgtatgtatgt 57902 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 173086 atgtatgtatgtatgtatgt 173105
>gb|AC132617.4| Mus musculus BAC clone RP23-230A6 from chromosome 12, complete sequence Length = 239046 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 29136 atctatgtatgtatgtatgtatgt 29159 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 145 tctatgtatgtatgtatgtatgt 167 ||||||||||||||||||||||| Sbjct: 180007 tctatgtatgtatgtatgtatgt 180029 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 232050 tatgtatgtatgtatgtatgt 232030 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 232046 tatgtatgtatgtatgtatgt 232026 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 232042 tatgtatgtatgtatgtatgt 232022 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 232038 tatgtatgtatgtatgtatgt 232018 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 229255 tatgtatgtatgtatgtatgt 229235 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 229251 tatgtatgtatgtatgtatgt 229231 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 229247 tatgtatgtatgtatgtatgt 229227 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 229243 tatgtatgtatgtatgtatgt 229223 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 229239 tatgtatgtatgtatgtatgt 229219 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 194503 tatgtatgtatgtatgtatgt 194483 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 194499 tatgtatgtatgtatgtatgt 194479 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 194495 tatgtatgtatgtatgtatgt 194475 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180025 tatgtatgtatgtatgtatgt 180045 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180021 tatgtatgtatgtatgtatgt 180041 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180017 tatgtatgtatgtatgtatgt 180037 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 180013 tatgtatgtatgtatgtatgt 180033 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161040 tatgtatgtatgtatgtatgt 161060 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161036 tatgtatgtatgtatgtatgt 161056 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161032 tatgtatgtatgtatgtatgt 161052 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161028 tatgtatgtatgtatgtatgt 161048 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161024 tatgtatgtatgtatgtatgt 161044 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29159 tatgtatgtatgtatgtatgt 29179 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29155 tatgtatgtatgtatgtatgt 29175 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29151 tatgtatgtatgtatgtatgt 29171 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29147 tatgtatgtatgtatgtatgt 29167 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 29143 tatgtatgtatgtatgtatgt 29163 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 232053 atgtatgtatgtatgtatgt 232034 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 229235 tatgtatgtatgtatgtatg 229216 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 189977 tatgtatgtatgtatgtatg 189996 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 183164 tgtatgtatgtatgtatgtg 183183
>gb|AC115065.11| Mus musculus chromosome 3, clone RP24-401H12, complete sequence Length = 157225 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 107020 atctatgtatgtatgtatgtatgt 106997 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107013 tatgtatgtatgtatgtatgt 106993 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107009 tatgtatgtatgtatgtatgt 106989 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107005 tatgtatgtatgtatgtatgt 106985 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107001 tatgtatgtatgtatgtatgt 106981 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106997 tatgtatgtatgtatgtatgt 106977
>gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, complete sequence Length = 154578 Score = 48.1 bits (24), Expect = 0.040 Identities = 27/28 (96%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggctaca 174 |||||||||||||||||||||| ||||| Sbjct: 137436 tatgtatgtatgtatgtatgtgactaca 137409 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137456 tatgtatgtatgtatgtatgt 137436 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137452 tatgtatgtatgtatgtatgt 137432 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137448 tatgtatgtatgtatgtatgt 137428 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137444 tatgtatgtatgtatgtatgt 137424 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137440 tatgtatgtatgtatgtatgt 137420 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134754 tatgtatgtatgtatgtatgt 134734 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134750 tatgtatgtatgtatgtatgt 134730 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134746 tatgtatgtatgtatgtatgt 134726 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134742 tatgtatgtatgtatgtatgt 134722 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120009 tatgtatgtatgtatgtatgt 120029 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120005 tatgtatgtatgtatgtatgt 120025 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120001 tatgtatgtatgtatgtatgt 120021 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119997 tatgtatgtatgtatgtatgt 120017 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119993 tatgtatgtatgtatgtatgt 120013 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119989 tatgtatgtatgtatgtatgt 120009 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 119985 tatgtatgtatgtatgtatgt 120005 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 120013 tatgtatgtatgtatgtatg 120032
>gb|AC113444.9| Mus musculus chromosome 15, clone RP23-268C9, complete sequence Length = 189539 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 123641 atctatgtatgtatgtatgtatgt 123618 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 121853 tatgtatgtatgtatgtatgtg 121874 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137574 tatgtatgtatgtatgtatgt 137554 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137570 tatgtatgtatgtatgtatgt 137550 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137566 tatgtatgtatgtatgtatgt 137546 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137562 tatgtatgtatgtatgtatgt 137542 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137558 tatgtatgtatgtatgtatgt 137538 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123634 tatgtatgtatgtatgtatgt 123614 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123630 tatgtatgtatgtatgtatgt 123610 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123626 tatgtatgtatgtatgtatgt 123606 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123622 tatgtatgtatgtatgtatgt 123602 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123618 tatgtatgtatgtatgtatgt 123598 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123614 tatgtatgtatgtatgtatgt 123594 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123610 tatgtatgtatgtatgtatgt 123590 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121849 tatgtatgtatgtatgtatgt 121869 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121845 tatgtatgtatgtatgtatgt 121865 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121841 tatgtatgtatgtatgtatgt 121861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121837 tatgtatgtatgtatgtatgt 121857 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 137577 atgtatgtatgtatgtatgt 137558
>gb|AC112997.10| Mus musculus chromosome 8, clone RP24-484I6, complete sequence Length = 191413 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 27351 atctatgtatgtatgtatgtatgt 27374 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27390 tatgtatgtatgtatgtatgt 27410 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27386 tatgtatgtatgtatgtatgt 27406 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27382 tatgtatgtatgtatgtatgt 27402 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27378 tatgtatgtatgtatgtatgt 27398 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27374 tatgtatgtatgtatgtatgt 27394 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27370 tatgtatgtatgtatgtatgt 27390 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27366 tatgtatgtatgtatgtatgt 27386 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27362 tatgtatgtatgtatgtatgt 27382 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27358 tatgtatgtatgtatgtatgt 27378 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 1162 tgtatgtatgtatgtatgtg 1181
>gb|AC152400.9| Mus musculus chromosome 3, clone RP23-277L18, complete sequence Length = 190913 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 140846 atctatgtatgtatgtatgtatgt 140823 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 146 ctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||| Sbjct: 140968 ctatgtatgtatgtatgtatgt 140947
>gb|AC102866.5| Mus musculus chromosome 7, clone RP24-576L9, complete sequence Length = 157163 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 84950 atctatgtatgtatgtatgtatgt 84927 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 37274 tatgtatgtatgtatgtatgtg 37253 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84943 tatgtatgtatgtatgtatgt 84923 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84939 tatgtatgtatgtatgtatgt 84919 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84935 tatgtatgtatgtatgtatgt 84915 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84931 tatgtatgtatgtatgtatgt 84911 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84927 tatgtatgtatgtatgtatgt 84907 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84923 tatgtatgtatgtatgtatgt 84903 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79643 tatgtatgtatgtatgtatgt 79623 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79639 tatgtatgtatgtatgtatgt 79619 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79635 tatgtatgtatgtatgtatgt 79615 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79631 tatgtatgtatgtatgtatgt 79611 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79627 tatgtatgtatgtatgtatgt 79607 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79623 tatgtatgtatgtatgtatgt 79603 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 79619 tatgtatgtatgtatgtatgt 79599 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37294 tatgtatgtatgtatgtatgt 37274 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37290 tatgtatgtatgtatgtatgt 37270 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37286 tatgtatgtatgtatgtatgt 37266 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37282 tatgtatgtatgtatgtatgt 37262 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37278 tatgtatgtatgtatgtatgt 37258 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 84919 tatgtatgtatgtatgtatg 84900 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 37297 atgtatgtatgtatgtatgt 37278
>gb|AC158793.4| Mus musculus chromosome 1, clone RP23-269P13, complete sequence Length = 183447 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 21689 atctatgtatgtatgtatgtatgt 21666 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21682 tatgtatgtatgtatgtatgt 21662
>gb|AC163998.2| Mus musculus chromosome 15, clone RP24-326H11, complete sequence Length = 153996 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 31259 atctatgtatgtatgtatgtatgt 31236 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31252 tatgtatgtatgtatgtatgt 31232 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31248 tatgtatgtatgtatgtatgt 31228 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31244 tatgtatgtatgtatgtatgt 31224 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14247 tatgtatgtatgtatgtatgt 14227 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14243 tatgtatgtatgtatgtatgt 14223 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 31240 tatgtatgtatgtatgtatg 31221
>gb|AF517939.1| Labeo dyocheilus microsatellite LdychG1 sequence Length = 120 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 112 atctatgtatgtatgtatgtatgt 89 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105 tatgtatgtatgtatgtatgt 85 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 101 tatgtatgtatgtatgtatgt 81 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 97 tatgtatgtatgtatgtatgt 77 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 93 tatgtatgtatgtatgtatgt 73 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89 tatgtatgtatgtatgtatgt 69 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 85 tatgtatgtatgtatgtatgt 65 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81 tatgtatgtatgtatgtatgt 61
>gb|AF517938.1| Labeo dero microsatellite LderG1 sequence Length = 96 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 88 atctatgtatgtatgtatgtatgt 65 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81 tatgtatgtatgtatgtatgt 61
>gb|AY024202.1| Oryza sativa microsatellite MRG6527 containing (TATG)X7, genomic sequence Length = 228 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 98 atctatgtatgtatgtatgtatgt 121 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 109 tatgtatgtatgtatgtatgt 129 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 105 tatgtatgtatgtatgtatgt 125
>gb|AC154871.13| Mus musculus chromosome 1, clone RP23-354B17, complete sequence Length = 211644 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 66532 atctatgtatgtatgtatgtatgt 66555 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 72208 tatgtatgtatgtatgtatgt 72228 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66559 tatgtatgtatgtatgtatgt 66579 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66555 tatgtatgtatgtatgtatgt 66575 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66551 tatgtatgtatgtatgtatgt 66571 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66547 tatgtatgtatgtatgtatgt 66567 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66543 tatgtatgtatgtatgtatgt 66563 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66539 tatgtatgtatgtatgtatgt 66559 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 66528 atctatctatgtatgtatgtatgt 66551
>gb|AC156020.2| Mus musculus BAC clone RP23-343A9 from chromosome 16, complete sequence Length = 215559 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 88291 atctatgtatgtatgtatgtatgt 88268 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88284 tatgtatgtatgtatgtatgt 88264 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88280 tatgtatgtatgtatgtatgt 88260 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88276 tatgtatgtatgtatgtatgt 88256 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 88299 atctatgtatctatgtatgtatgt 88276
>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence Length = 212447 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtggcta 172 |||||||||||||||||||||||| Sbjct: 79896 tgtatgtatgtatgtatgtggcta 79873 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 51014 tgtatgtatgtatgtatgtg 51033
>gb|AC159817.2| Mus musculus BAC clone RP23-228E8 from chromosome 9, complete sequence Length = 193445 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 8225 atctatgtatgtatgtatgtatgt 8248 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||| ||||||||||||||||||||| Sbjct: 21346 aaatgtatgtatgtatgtatgtatgt 21371 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21367 tatgtatgtatgtatgtatgt 21387 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21363 tatgtatgtatgtatgtatgt 21383 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21359 tatgtatgtatgtatgtatgt 21379 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 21355 tatgtatgtatgtatgtatgt 21375 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8248 tatgtatgtatgtatgtatgt 8268 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8244 tatgtatgtatgtatgtatgt 8264 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8240 tatgtatgtatgtatgtatgt 8260 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8236 tatgtatgtatgtatgtatgt 8256 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8232 tatgtatgtatgtatgtatgt 8252 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 21371 tatgtatgtatgtatgtatg 21390
>gb|AC154278.2| Mus musculus BAC clone RP24-269E24 from chromosome 16, complete sequence Length = 153579 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 140252 atctatgtatgtatgtatgtatgt 140275 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 140275 tatgtatgtatgtatgtatgt 140295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 140271 tatgtatgtatgtatgtatgt 140291 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 140267 tatgtatgtatgtatgtatgt 140287 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 140263 tatgtatgtatgtatgtatgt 140283 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 140259 tatgtatgtatgtatgtatgt 140279 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 140244 atctatgtatctatgtatgtatgt 140267
>gb|AC161754.4| Mus musculus BAC clone RP24-446K8 from chromosome 1, complete sequence Length = 158536 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtggcta 172 |||||||||||||||||||||||| Sbjct: 109035 tgtatgtatgtatgtatgtggcta 109012 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 80153 tgtatgtatgtatgtatgtg 80172
>gb|AC161587.2| Mus musculus BAC clone RP24-492G17 from chromosome 9, complete sequence Length = 176237 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 142204 atctatgtatgtatgtatgtatgt 142227 Score = 44.1 bits (22), Expect = 0.63 Identities = 25/26 (96%) Strand = Plus / Plus Query: 142 aaatctatgtatgtatgtatgtatgt 167 |||| ||||||||||||||||||||| Sbjct: 155325 aaatgtatgtatgtatgtatgtatgt 155350 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155346 tatgtatgtatgtatgtatgt 155366 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155342 tatgtatgtatgtatgtatgt 155362 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155338 tatgtatgtatgtatgtatgt 155358 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 155334 tatgtatgtatgtatgtatgt 155354 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142227 tatgtatgtatgtatgtatgt 142247 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142223 tatgtatgtatgtatgtatgt 142243 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142219 tatgtatgtatgtatgtatgt 142239 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142215 tatgtatgtatgtatgtatgt 142235 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 142211 tatgtatgtatgtatgtatgt 142231 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9512 tatgtatgtatgtatgtatgt 9532 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9508 tatgtatgtatgtatgtatgt 9528 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 155350 tatgtatgtatgtatgtatg 155369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 9516 tatgtatgtatgtatgtatg 9535
>gb|AC102440.12| Mus musculus chromosome 1, clone RP24-146C18, complete sequence Length = 144770 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 78975 atctatgtatgtatgtatgtatgt 78952 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 78996 tatgtatgtatgtatgtatgt 78976
>gb|AC135357.3| Mus musculus chromosome 8 clone RP24-84L15, complete sequence Length = 175089 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 37030 atctatgtatgtatgtatgtatgt 37053 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167676 tatgtatgtatgtatgtatgt 167696 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 167680 tatgtatgtatgtatgtatg 167699 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 37026 atctatctatgtatgtatgtatgt 37049
>gb|AC102784.8| Mus musculus chromosome 1, clone RP23-408B17, complete sequence Length = 195644 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 124826 atctatgtatgtatgtatgtatgt 124849 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124841 tatgtatgtatgtatgtatgt 124861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124837 tatgtatgtatgtatgtatgt 124857 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124833 tatgtatgtatgtatgtatgt 124853 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 124845 tatgtatgtatgtatgtatg 124864
>gb|AC119190.7| Mus musculus chromosome 8, clone RP24-178B9, complete sequence Length = 139843 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 127529 atctatgtatgtatgtatgtatgt 127552 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127568 tatgtatgtatgtatgtatgt 127588 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127564 tatgtatgtatgtatgtatgt 127584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127560 tatgtatgtatgtatgtatgt 127580 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127556 tatgtatgtatgtatgtatgt 127576 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127552 tatgtatgtatgtatgtatgt 127572 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127548 tatgtatgtatgtatgtatgt 127568 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127544 tatgtatgtatgtatgtatgt 127564 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127540 tatgtatgtatgtatgtatgt 127560 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 127536 tatgtatgtatgtatgtatgt 127556 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 101340 tgtatgtatgtatgtatgtg 101359
>gb|AC107692.7| Mus musculus chromosome 3, clone RP24-387H23, complete sequence Length = 148965 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 107362 atctatgtatgtatgtatgtatgt 107339 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107355 tatgtatgtatgtatgtatgt 107335 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107351 tatgtatgtatgtatgtatgt 107331 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107347 tatgtatgtatgtatgtatgt 107327 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107343 tatgtatgtatgtatgtatgt 107323 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107339 tatgtatgtatgtatgtatgt 107319 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107335 tatgtatgtatgtatgtatgt 107315 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 107331 tatgtatgtatgtatgtatgt 107311
>gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, complete sequence Length = 199229 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 77285 atctatgtatgtatgtatgtatgt 77308 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 153270 tatgtatgtatgtatgtatgt 153290 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 75720 tatgtatgtatgtatgtatgt 75740 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 100324 tgtatgtatgtatgtatgtg 100343 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 75745 tgtatgtatgtatgtatgtg 75764 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 75670 tgtatgtatgtatgtatgtg 75689
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtggc 170 |||||||||||||||||||||||| Sbjct: 28101 tatgtatgtatgtatgtatgtggc 28124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28097 tatgtatgtatgtatgtatgt 28117 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28093 tatgtatgtatgtatgtatgt 28113 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28089 tatgtatgtatgtatgtatgt 28109 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28065 tatgtatgtatgtatgtatgt 28085 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28061 tatgtatgtatgtatgtatgt 28081
>gb|AC115033.9| Mus musculus chromosome 15, clone RP24-269A7, complete sequence Length = 147113 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 111887 atctatgtatgtatgtatgtatgt 111910 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111902 tatgtatgtatgtatgtatgt 111922 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111898 tatgtatgtatgtatgtatgt 111918 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 111894 tatgtatgtatgtatgtatgt 111914 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 111879 atctatgtatctatgtatgtatgt 111902
>gb|AC091478.6| Mus musculus chromosome 3, clone RP23-469J3, complete sequence Length = 253738 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 134253 atctatgtatgtatgtatgtatgt 134230 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 91305 tatgtatgtatgtatgtatgtg 91284 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134246 tatgtatgtatgtatgtatgt 134226 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134242 tatgtatgtatgtatgtatgt 134222 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134238 tatgtatgtatgtatgtatgt 134218 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106503 tatgtatgtatgtatgtatgt 106483 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106499 tatgtatgtatgtatgtatgt 106479 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106495 tatgtatgtatgtatgtatgt 106475 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106491 tatgtatgtatgtatgtatgt 106471 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 106487 tatgtatgtatgtatgtatgt 106467 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 91317 tatgtatgtatgtatgtatgt 91297 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 91313 tatgtatgtatgtatgtatgt 91293 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 91309 tatgtatgtatgtatgtatgt 91289 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 ||||||||||||||| |||||||| Sbjct: 106522 atctatgtatgtatgaatgtatgt 106499 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 106506 atgtatgtatgtatgtatgt 106487 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 91388 tgtatgtatgtatgtatgtg 91369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 91320 atgtatgtatgtatgtatgt 91301
>gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, complete sequence Length = 247484 Score = 48.1 bits (24), Expect = 0.040 Identities = 27/28 (96%) Strand = Plus / Minus Query: 141 aaaatctatgtatgtatgtatgtatgtg 168 ||||| |||||||||||||||||||||| Sbjct: 163766 aaaatgtatgtatgtatgtatgtatgtg 163739 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 42898 tatgtatgtatgtatgtatgtg 42919 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42894 tatgtatgtatgtatgtatgt 42914 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42890 tatgtatgtatgtatgtatgt 42910 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42886 tatgtatgtatgtatgtatgt 42906 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42882 tatgtatgtatgtatgtatgt 42902 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10397 tatgtatgtatgtatgtatgt 10377 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10393 tatgtatgtatgtatgtatgt 10373 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 10389 tatgtatgtatgtatgtatgt 10369
>gb|AC136378.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0047D03, complete sequence Length = 126165 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 93921 atctatgtatgtatgtatgtatgt 93944 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 93900 tatgtatgtatgtatgtatgt 93920
>gb|AC146270.3| Pan troglodytes BAC clone RP43-30F23 from 7, complete sequence Length = 159288 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 48128 atctatgtatgtatgtatgtatgt 48151 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48143 tatgtatgtatgtatgtatgt 48163 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48139 tatgtatgtatgtatgtatgt 48159 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48135 tatgtatgtatgtatgtatgt 48155
>gb|AF133093.2| Mus musculus chromosome X clones CT7-116D19, CT7-309B4, CT7-567G9, MGSPI-15528, MGSPI-15530 complete sequence Length = 235497 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 22201 atctatgtatgtatgtatgtatgt 22178 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4369 tatgtatgtatgtatgtatgt 4349 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4365 tatgtatgtatgtatgtatgt 4345 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4361 tatgtatgtatgtatgtatgt 4341 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4357 tatgtatgtatgtatgtatgt 4337 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4353 tatgtatgtatgtatgtatgt 4333 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4349 tatgtatgtatgtatgtatgt 4329 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4345 tatgtatgtatgtatgtatgt 4325
>gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, complete sequence Length = 173479 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 112119 atctatgtatgtatgtatgtatgt 112096 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 98201 tatgtatgtatgtatgtatgtg 98222 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112112 tatgtatgtatgtatgtatgt 112092 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112108 tatgtatgtatgtatgtatgt 112088 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112104 tatgtatgtatgtatgtatgt 112084 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112100 tatgtatgtatgtatgtatgt 112080 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112096 tatgtatgtatgtatgtatgt 112076 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98197 tatgtatgtatgtatgtatgt 98217 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98193 tatgtatgtatgtatgtatgt 98213 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98189 tatgtatgtatgtatgtatgt 98209 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98185 tatgtatgtatgtatgtatgt 98205 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98181 tatgtatgtatgtatgtatgt 98201 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 98177 tatgtatgtatgtatgtatgt 98197 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 112123 atctatctatgtatgtatgtatgt 112100 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 49586 tgtatgtatgtatgtatgtg 49567
>gb|AC108806.10| Mus musculus chromosome 14, clone RP23-246G7, complete sequence Length = 189619 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 139251 atctatgtatgtatgtatgtatgt 139274 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 104173 tatgtatgtatgtatgtatgtg 104152 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165636 tatgtatgtatgtatgtatgt 165616 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165632 tatgtatgtatgtatgtatgt 165612 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165628 tatgtatgtatgtatgtatgt 165608 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165624 tatgtatgtatgtatgtatgt 165604 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165620 tatgtatgtatgtatgtatgt 165600 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165616 tatgtatgtatgtatgtatgt 165596 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165612 tatgtatgtatgtatgtatgt 165592 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165608 tatgtatgtatgtatgtatgt 165588 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165604 tatgtatgtatgtatgtatgt 165584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160006 tatgtatgtatgtatgtatgt 159986 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 160002 tatgtatgtatgtatgtatgt 159982 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 159998 tatgtatgtatgtatgtatgt 159978 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 104181 tatgtatgtatgtatgtatgt 104161 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 104177 tatgtatgtatgtatgtatgt 104157 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48398 tatgtatgtatgtatgtatgt 48418 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48394 tatgtatgtatgtatgtatgt 48414 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48390 tatgtatgtatgtatgtatgt 48410 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48386 tatgtatgtatgtatgtatgt 48406 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48382 tatgtatgtatgtatgtatgt 48402 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48378 tatgtatgtatgtatgtatgt 48398 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48374 tatgtatgtatgtatgtatgt 48394 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48370 tatgtatgtatgtatgtatgt 48390 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48366 tatgtatgtatgtatgtatgt 48386 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 165639 atgtatgtatgtatgtatgt 165620
>gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, complete sequence Length = 166860 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 130372 atctatgtatgtatgtatgtatgt 130349 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 126211 tatgtatgtatgtatgtatgtg 126232 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130365 tatgtatgtatgtatgtatgt 130345
>gb|AC129332.6| Mus musculus BAC clone RP23-91I19 from chromosome 9, complete sequence Length = 219117 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 69769 atctatgtatgtatgtatgtatgt 69792 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162121 tatgtatgtatgtatgtatgt 162101 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162117 tatgtatgtatgtatgtatgt 162097 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162113 tatgtatgtatgtatgtatgt 162093 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162109 tatgtatgtatgtatgtatgt 162089 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99832 tatgtatgtatgtatgtatgt 99852 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99828 tatgtatgtatgtatgtatgt 99848 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99824 tatgtatgtatgtatgtatgt 99844 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99820 tatgtatgtatgtatgtatgt 99840 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99816 tatgtatgtatgtatgtatgt 99836 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99812 tatgtatgtatgtatgtatgt 99832 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 99808 tatgtatgtatgtatgtatgt 99828 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69784 tatgtatgtatgtatgtatgt 69804 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69780 tatgtatgtatgtatgtatgt 69800 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69776 tatgtatgtatgtatgtatgt 69796 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 162124 atgtatgtatgtatgtatgt 162105 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 162105 tatgtatgtatgtatgtatg 162086 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 14941 atgtatgtatgtatgtatgt 14960
>gb|AC134468.4| Mus musculus BAC clone RP23-97J21 from chromosome 12, complete sequence Length = 234400 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 68892 atctatgtatgtatgtatgtatgt 68915 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 132721 tatgtatgtatgtatgtatgt 132701 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 108808 tatgtatgtatgtatgtatgt 108828 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 108804 tatgtatgtatgtatgtatgt 108824 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 108800 tatgtatgtatgtatgtatgt 108820 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggc 170 ||||||||||||||||||| |||| Sbjct: 132717 tatgtatgtatgtatgtatatggc 132694 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 108797 atgtatgtatgtatgtatgt 108816 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 68884 atctatgtatctatgtatgtatgt 68907
>gb|AC147991.4| Mus musculus BAC clone RP24-362D11 from chromosome Y, complete sequence Length = 180675 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 69935 atctatgtatgtatgtatgtatgt 69958 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69954 tatgtatgtatgtatgtatgt 69974 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69950 tatgtatgtatgtatgtatgt 69970 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69946 tatgtatgtatgtatgtatgt 69966 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69942 tatgtatgtatgtatgtatgt 69962 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 69958 tatgtatgtatgtatgtatg 69977
>gb|AC132276.4| Mus musculus BAC clone RP24-344B8 from chromosome Y, complete sequence Length = 168601 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 126554 atctatgtatgtatgtatgtatgt 126531 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126547 tatgtatgtatgtatgtatgt 126527 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126543 tatgtatgtatgtatgtatgt 126523 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 126539 tatgtatgtatgtatgtatg 126520
>gb|AC147377.4| Mus musculus BAC clone RP23-156K23 from chromosome 5, complete sequence Length = 236084 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 13410 atctatgtatgtatgtatgtatgt 13387 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182204 tatgtatgtatgtatgtatgt 182184 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182200 tatgtatgtatgtatgtatgt 182180 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 182196 tatgtatgtatgtatgtatgt 182176 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 14975 tatgtatgtatgtatgtatgt 14955 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 182192 tatgtatgtatgtatgtatg 182173 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 182171 atgtatgtatgtatgtatgt 182152 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 15025 tgtatgtatgtatgtatgtg 15006 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 tgtatgtatgtatgtatgtg 168 |||||||||||||||||||| Sbjct: 14950 tgtatgtatgtatgtatgtg 14931
>gb|AC110224.7| Mus musculus chromosome 18, clone RP24-286H12, complete sequence Length = 167379 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 68605 atctatgtatgtatgtatgtatgt 68582 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139334 tatgtatgtatgtatgtatgt 139314 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139330 tatgtatgtatgtatgtatgt 139310 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139326 tatgtatgtatgtatgtatgt 139306 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139322 tatgtatgtatgtatgtatgt 139302 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 139318 tatgtatgtatgtatgtatgt 139298 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 139314 tatgtatgtatgtatgtatg 139295 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 68613 atctatgtatctatgtatgtatgt 68590
>gb|AC137128.17| Mus musculus chromosome 3, clone RP24-271G16, complete sequence Length = 182140 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 96425 atctatgtatgtatgtatgtatgt 96402 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 96398 tatgtatgtatgtatgtatgtg 96377 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 96418 tatgtatgtatgtatgtatgt 96398 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 96414 tatgtatgtatgtatgtatgt 96394 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 96410 tatgtatgtatgtatgtatgt 96390 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 96406 tatgtatgtatgtatgtatgt 96386 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 96402 tatgtatgtatgtatgtatgt 96382 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59922 tatgtatgtatgtatgtatgt 59902 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59918 tatgtatgtatgtatgtatgt 59898 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59914 tatgtatgtatgtatgtatgt 59894 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59910 tatgtatgtatgtatgtatgt 59890 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 59906 tatgtatgtatgtatgtatgt 59886 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 59925 atgtatgtatgtatgtatgt 59906 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 59902 tatgtatgtatgtatgtatg 59883
>gb|AC119943.12| Mus musculus chromosome 10, clone RP24-271F24, complete sequence Length = 174009 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 69853 atctatgtatgtatgtatgtatgt 69876 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 164940 tatgtatgtatgtatgtatgt 164960 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 164936 tatgtatgtatgtatgtatgt 164956 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 164932 tatgtatgtatgtatgtatgt 164952 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 164928 tatgtatgtatgtatgtatgt 164948 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 164924 tatgtatgtatgtatgtatgt 164944 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69872 tatgtatgtatgtatgtatgt 69892 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69868 tatgtatgtatgtatgtatgt 69888 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69864 tatgtatgtatgtatgtatgt 69884 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69860 tatgtatgtatgtatgtatgt 69880
>gb|AC147257.5| Mus musculus BAC clone RP24-169I1 from chromosome Y, complete sequence Length = 170420 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 89607 atctatgtatgtatgtatgtatgt 89584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 89600 tatgtatgtatgtatgtatgt 89580 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 89596 tatgtatgtatgtatgtatg 89577
>gb|AC125221.4| Mus musculus BAC clone RP23-74N13 from chromosome 7, complete sequence Length = 215384 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 126211 atctatgtatgtatgtatgtatgt 126234 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126218 tatgtatgtatgtatgtatgt 126238 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 126203 atctatgtatctatgtatgtatgt 126226
>gb|AC147098.2| Mus musculus BAC clone RP23-452E7 from chromosome 9, complete sequence Length = 199612 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 35861 atctatgtatgtatgtatgtatgt 35838 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 115497 tatgtatgtatgtatgtatgtg 115476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115509 tatgtatgtatgtatgtatgt 115489 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115505 tatgtatgtatgtatgtatgt 115485 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 115501 tatgtatgtatgtatgtatgt 115481 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 115512 atgtatgtatgtatgtatgt 115493
>gb|AC123928.3| Mus musculus BAC clone RP24-390L8 from chromosome Y, complete sequence Length = 154303 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 64115 atctatgtatgtatgtatgtatgt 64092 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 149234 tatgtatgtatgtatgtatgt 149254 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64108 tatgtatgtatgtatgtatgt 64088 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64104 tatgtatgtatgtatgtatgt 64084 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 64100 tatgtatgtatgtatgtatgt 64080 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 149238 tatgtatgtatgtatgtatg 149257
>gb|AC131783.4| Mus musculus BAC clone RP24-377P12 from chromosome Y, complete sequence Length = 223801 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 112106 atctatgtatgtatgtatgtatgt 112083 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112099 tatgtatgtatgtatgtatgt 112079 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112095 tatgtatgtatgtatgtatgt 112075 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112091 tatgtatgtatgtatgtatgt 112071 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112087 tatgtatgtatgtatgtatgt 112067 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112083 tatgtatgtatgtatgtatgt 112063 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 112079 tatgtatgtatgtatgtatgt 112059 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 49470 tatgtatgtatgtatgtatgt 49450 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 49466 tatgtatgtatgtatgtatgt 49446 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 49462 tatgtatgtatgtatgtatgt 49442 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 49458 tatgtatgtatgtatgtatgt 49438 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 49454 tatgtatgtatgtatgtatgt 49434 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 112110 atctatctatgtatgtatgtatgt 112087 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 112075 tatgtatgtatgtatgtatg 112056 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 49477 atctatatatgtatgtatgtatgt 49454 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 49450 tatgtatgtatgtatgtatg 49431
>gb|AC145582.4| Mus musculus BAC clone RP24-357M16 from chromosome Y, complete sequence Length = 165663 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 11992 atctatgtatgtatgtatgtatgt 11969 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81009 tatgtatgtatgtatgtatgt 81029 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 81005 tatgtatgtatgtatgtatgt 81025 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11985 tatgtatgtatgtatgtatgt 11965 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11981 tatgtatgtatgtatgtatgt 11961 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11977 tatgtatgtatgtatgtatgt 11957 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11973 tatgtatgtatgtatgtatgt 11953 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11969 tatgtatgtatgtatgtatgt 11949 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11965 tatgtatgtatgtatgtatgt 11945 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11961 tatgtatgtatgtatgtatgt 11941 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11957 tatgtatgtatgtatgtatgt 11937 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 11953 tatgtatgtatgtatgtatgt 11933 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 80998 atctatatatgtatgtatgtatgt 81021 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 11949 tatgtatgtatgtatgtatg 11930
>gb|AC147996.3| Mus musculus BAC clone RP24-253L14 from chromosome Y, complete sequence Length = 149579 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 67062 atctatgtatgtatgtatgtatgt 67085 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67085 tatgtatgtatgtatgtatgt 67105 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67081 tatgtatgtatgtatgtatgt 67101 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67077 tatgtatgtatgtatgtatgt 67097 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67073 tatgtatgtatgtatgtatgt 67093 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67069 tatgtatgtatgtatgtatgt 67089 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 67089 tatgtatgtatgtatgtatg 67108
>gb|AC147058.3| Pan troglodytes BAC clone RP43-154B16 from 7, complete sequence Length = 161951 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 110511 atctatgtatgtatgtatgtatgt 110488 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 110475 atctatgtatgtatgtatgtatgt 110452 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110504 tatgtatgtatgtatgtatgt 110484 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110500 tatgtatgtatgtatgtatgt 110480 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110496 tatgtatgtatgtatgtatgt 110476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110468 tatgtatgtatgtatgtatgt 110448 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110464 tatgtatgtatgtatgtatgt 110444 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110460 tatgtatgtatgtatgtatgt 110440
>gb|AC146084.2| Pan troglodytes BAC clone RP43-56L21 from 7, complete sequence Length = 152170 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 92865 atctatgtatgtatgtatgtatgt 92842 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 92858 tatgtatgtatgtatgtatgt 92838
>gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome y, complete sequence Length = 207355 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 36879 atctatgtatgtatgtatgtatgt 36902 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 36886 tatgtatgtatgtatgtatgt 36906 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 36890 tatgtatgtatgtatgtatg 36909
>gb|AC129330.4| Mus musculus BAC clone RP23-61B8 from chromosome 8, complete sequence Length = 218698 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 184516 atctatgtatgtatgtatgtatgt 184539 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 184527 tatgtatgtatgtatgtatgt 184547 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 184523 tatgtatgtatgtatgtatgt 184543
>gb|AC147109.2| Mus musculus BAC clone RP24-75P8 from chromosome Y, complete sequence Length = 216878 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 66162 atctatgtatgtatgtatgtatgt 66185 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66181 tatgtatgtatgtatgtatgt 66201 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66177 tatgtatgtatgtatgtatgt 66197 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66173 tatgtatgtatgtatgtatgt 66193 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 66169 tatgtatgtatgtatgtatgt 66189 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 66185 tatgtatgtatgtatgtatg 66204
>gb|AC147107.2| Mus musculus BAC clone RP24-69F17 from chromosome Y, complete sequence Length = 202338 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 147837 atctatgtatgtatgtatgtatgt 147814 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 147830 tatgtatgtatgtatgtatgt 147810 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 147826 tatgtatgtatgtatgtatgt 147806 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 147822 tatgtatgtatgtatgtatg 147803
>gb|AC139943.3| Mus musculus BAC clone RP23-472M3 from chromosome 7, complete sequence Length = 183421 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 20116 atctatgtatgtatgtatgtatgt 20093 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 20109 tatgtatgtatgtatgtatgt 20089 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 20105 tatgtatgtatgtatgtatgt 20085
>gb|AC147253.3| Mus musculus BAC clone RP24-134K1 from chromosome Y, complete sequence Length = 183653 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 123020 atctatgtatgtatgtatgtatgt 122997 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123013 tatgtatgtatgtatgtatgt 122993 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 123009 tatgtatgtatgtatgtatg 122990
>gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome Y, complete sequence Length = 197602 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 130544 atctatgtatgtatgtatgtatgt 130521 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 130537 tatgtatgtatgtatgtatgt 130517 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 130533 tatgtatgtatgtatgtatg 130514
>gb|AC147372.3| Mus musculus BAC clone RP24-212L10 from chromosome Y, complete sequence Length = 187032 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 117353 atctatgtatgtatgtatgtatgt 117330 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 117346 tatgtatgtatgtatgtatgt 117326 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 117342 tatgtatgtatgtatgtatgt 117322 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 117338 tatgtatgtatgtatgtatgt 117318 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 117334 tatgtatgtatgtatgtatgt 117314 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 117330 tatgtatgtatgtatgtatg 117311
>gb|AC147265.2| Mus musculus BAC clone RP24-233K2 from chromosome Y, complete sequence Length = 171430 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 47617 atctatgtatgtatgtatgtatgt 47594 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47610 tatgtatgtatgtatgtatgt 47590 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47606 tatgtatgtatgtatgtatgt 47586 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47602 tatgtatgtatgtatgtatgt 47582 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47598 tatgtatgtatgtatgtatgt 47578 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47594 tatgtatgtatgtatgtatgt 47574 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47590 tatgtatgtatgtatgtatgt 47570 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 47621 atctatctatgtatgtatgtatgt 47598 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 47586 tatgtatgtatgtatgtatg 47567
>gb|AC147461.2| Mus musculus BAC clone RP24-304I19 from chromosome Y, complete sequence Length = 171934 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 75795 atctatgtatgtatgtatgtatgt 75772 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 75788 tatgtatgtatgtatgtatgt 75768 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 75784 tatgtatgtatgtatgtatg 75765
>gb|AC147626.3| Mus musculus BAC clone RP24-361F8 from chromosome Y, complete sequence Length = 132381 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 123307 atctatgtatgtatgtatgtatgt 123330 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123330 tatgtatgtatgtatgtatgt 123350 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123326 tatgtatgtatgtatgtatgt 123346 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123322 tatgtatgtatgtatgtatgt 123342 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123318 tatgtatgtatgtatgtatgt 123338 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 123314 tatgtatgtatgtatgtatgt 123334 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37728 tatgtatgtatgtatgtatgt 37708 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37724 tatgtatgtatgtatgtatgt 37704 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37720 tatgtatgtatgtatgtatgt 37700 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37716 tatgtatgtatgtatgtatgt 37696 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37712 tatgtatgtatgtatgtatgt 37692 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37708 tatgtatgtatgtatgtatgt 37688 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37704 tatgtatgtatgtatgtatgt 37684 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37700 tatgtatgtatgtatgtatgt 37680 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37696 tatgtatgtatgtatgtatgt 37676 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37692 tatgtatgtatgtatgtatgt 37672 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37688 tatgtatgtatgtatgtatgt 37668 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37684 tatgtatgtatgtatgtatgt 37664 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 123334 tatgtatgtatgtatgtatg 123353 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 37735 atctatatatgtatgtatgtatgt 37712 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 37680 tatgtatgtatgtatgtatg 37661
>gb|AC147149.2| Mus musculus BAC clone RP24-248P15 from chromosome Y, complete sequence Length = 144382 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 54855 atctatgtatgtatgtatgtatgt 54878 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 54862 tatgtatgtatgtatgtatgt 54882 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 54866 tatgtatgtatgtatgtatg 54885
>gb|AC147503.2| Mus musculus BAC clone RP24-321E10 from chromosome Y, complete sequence Length = 191256 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 17341 atctatgtatgtatgtatgtatgt 17318 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 169495 tatgtatgtatgtatgtatgt 169475 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103715 tatgtatgtatgtatgtatgt 103735 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103711 tatgtatgtatgtatgtatgt 103731 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 103707 tatgtatgtatgtatgtatgt 103727 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17334 tatgtatgtatgtatgtatgt 17314 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17330 tatgtatgtatgtatgtatgt 17310 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 103719 tatgtatgtatgtatgtatg 103738 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 103700 atctatatatgtatgtatgtatgt 103723 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 17326 tatgtatgtatgtatgtatg 17307
>gb|AC147623.3| Mus musculus BAC clone RP24-320G12 from chromosome Y, complete sequence Length = 127987 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 67468 atctatgtatgtatgtatgtatgt 67445 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67461 tatgtatgtatgtatgtatgt 67441 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 67457 tatgtatgtatgtatgtatg 67438
>gb|AC147621.3| Mus musculus BAC clone RP24-315M14 from chromosome Y, complete sequence Length = 166529 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 88537 atctatgtatgtatgtatgtatgt 88560 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88584 tatgtatgtatgtatgtatgt 88604 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88580 tatgtatgtatgtatgtatgt 88600 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88576 tatgtatgtatgtatgtatgt 88596 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88572 tatgtatgtatgtatgtatgt 88592 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88568 tatgtatgtatgtatgtatgt 88588 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88564 tatgtatgtatgtatgtatgt 88584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88560 tatgtatgtatgtatgtatgt 88580 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88556 tatgtatgtatgtatgtatgt 88576 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88552 tatgtatgtatgtatgtatgt 88572 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88548 tatgtatgtatgtatgtatgt 88568 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 88544 tatgtatgtatgtatgtatgt 88564 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 88588 tatgtatgtatgtatgtatg 88607
>gb|AC144934.3| Mus musculus BAC clone RP24-327C7 from chromosome Y, complete sequence Length = 194335 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 61732 atctatgtatgtatgtatgtatgt 61755 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61759 tatgtatgtatgtatgtatgt 61779 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61755 tatgtatgtatgtatgtatgt 61775 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61751 tatgtatgtatgtatgtatgt 61771 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61747 tatgtatgtatgtatgtatgt 61767 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61743 tatgtatgtatgtatgtatgt 61763 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61739 tatgtatgtatgtatgtatgt 61759 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 61763 tatgtatgtatgtatgtatg 61782
>gb|AC147150.2| Mus musculus BAC clone RP24-386L15 from chromosome Y, complete sequence Length = 171912 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 102391 atctatgtatgtatgtatgtatgt 102368 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 102384 tatgtatgtatgtatgtatgt 102364 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 102380 tatgtatgtatgtatgtatgt 102360 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 102376 tatgtatgtatgtatgtatgt 102356 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 102372 tatgtatgtatgtatgtatg 102353
>gb|AC132254.3| Mus musculus BAC clone RP24-469M1 from chromosome Y, complete sequence Length = 163018 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 35480 atctatgtatgtatgtatgtatgt 35503 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35503 tatgtatgtatgtatgtatgt 35523 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35499 tatgtatgtatgtatgtatgt 35519 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35495 tatgtatgtatgtatgtatgt 35515 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35491 tatgtatgtatgtatgtatgt 35511 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35487 tatgtatgtatgtatgtatgt 35507 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 35507 tatgtatgtatgtatgtatg 35526
>gb|AC134859.4| Mus musculus BAC clone RP23-363G20 from chromosome 9, complete sequence Length = 182883 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 35849 atctatgtatgtatgtatgtatgt 35872 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 35769 atctatgtatgtatgtatgtatgt 35792 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtgg 169 ||||||||||||||||||||||| Sbjct: 560 tatgtatgtatgtatgtatgtgg 582 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 15988 tatgtatgtatgtatgtatgtg 16009 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35868 tatgtatgtatgtatgtatgt 35888 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35864 tatgtatgtatgtatgtatgt 35884 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35860 tatgtatgtatgtatgtatgt 35880 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35856 tatgtatgtatgtatgtatgt 35876 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35788 tatgtatgtatgtatgtatgt 35808 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35784 tatgtatgtatgtatgtatgt 35804 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35780 tatgtatgtatgtatgtatgt 35800 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 35776 tatgtatgtatgtatgtatgt 35796 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15984 tatgtatgtatgtatgtatgt 16004 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15980 tatgtatgtatgtatgtatgt 16000 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 35841 atctatgtatctatgtatgtatgt 35864 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 35765 atctatctatgtatgtatgtatgt 35788 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 23371 atgtatgtatgtatgtatgt 23390 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 15977 atgtatgtatgtatgtatgt 15996
>gb|AC175743.2| Mus musculus BAC clone RP24-44F3 from chromosome y, complete sequence Length = 176317 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 137369 atctatgtatgtatgtatgtatgt 137346 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137362 tatgtatgtatgtatgtatgt 137342 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137358 tatgtatgtatgtatgtatgt 137338 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137354 tatgtatgtatgtatgtatgt 137334 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137350 tatgtatgtatgtatgtatgt 137330 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137346 tatgtatgtatgtatgtatgt 137326 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 137342 tatgtatgtatgtatgtatgt 137322 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 137338 tatgtatgtatgtatgtatg 137319
>gb|AC183415.1| Mus musculus BAC clone RP24-121M4 from chromosome y, complete sequence Length = 188947 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 124568 atctatgtatgtatgtatgtatgt 124545 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124561 tatgtatgtatgtatgtatgt 124541 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124557 tatgtatgtatgtatgtatgt 124537 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124553 tatgtatgtatgtatgtatgt 124533 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 124549 tatgtatgtatgtatgtatgt 124529 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 124545 tatgtatgtatgtatgtatg 124526
>gb|AC161206.10| Mus musculus chromosome 15, clone RP24-299A13, complete sequence Length = 165791 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 145 tctatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||||| Sbjct: 37166 tctatgtatgtatgtatgtatgtg 37189
>gb|AC164536.5| Mus musculus chromosome 18, clone RP23-425H1, complete sequence Length = 188835 Score = 48.1 bits (24), Expect = 0.040 Identities = 27/28 (96%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggctaca 174 ||||||||||||||||||||| |||||| Sbjct: 65834 tatgtatgtatgtatgtatgtagctaca 65807 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 65838 tatgtatgtatgtatgtatgt 65818
>gb|AY491856.1| Euphydryas aurinia clone EA92 microsatellite sequence Length = 285 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 136 atctatgtatgtatgtatgtatgt 113 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 177 tatgtatgtatgtatgtatgt 157 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173 tatgtatgtatgtatgtatgt 153 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 169 tatgtatgtatgtatgtatgt 149 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165 tatgtatgtatgtatgtatgt 145 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 140 atctatctatgtatgtatgtatgt 117
>gb|AC120147.8| Mus musculus chromosome 19, clone RP24-223N20, complete sequence Length = 172853 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 98719 atctatgtatgtatgtatgtatgt 98696 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165158 tatgtatgtatgtatgtatgt 165178 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165154 tatgtatgtatgtatgtatgt 165174 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165150 tatgtatgtatgtatgtatgt 165170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165146 tatgtatgtatgtatgtatgt 165166 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165142 tatgtatgtatgtatgtatgt 165162 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165138 tatgtatgtatgtatgtatgt 165158 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 165134 tatgtatgtatgtatgtatgt 165154 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120046 tatgtatgtatgtatgtatgt 120066 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120042 tatgtatgtatgtatgtatgt 120062 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120038 tatgtatgtatgtatgtatgt 120058 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120034 tatgtatgtatgtatgtatgt 120054 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120030 tatgtatgtatgtatgtatgt 120050 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52236 tatgtatgtatgtatgtatgt 52216 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52232 tatgtatgtatgtatgtatgt 52212 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38863 tatgtatgtatgtatgtatgt 38883 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38859 tatgtatgtatgtatgtatgt 38879 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38855 tatgtatgtatgtatgtatgt 38875 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38851 tatgtatgtatgtatgtatgt 38871 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 38847 tatgtatgtatgtatgtatgt 38867 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 120027 atgtatgtatgtatgtatgt 120046 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 98712 tatgtatgtatgtatgtatg 98693 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 52239 atgtatgtatgtatgtatgt 52220 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 52228 tatgtatgtatgtatgtatg 52209 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 38867 tatgtatgtatgtatgtatg 38886 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 38844 atgtatgtatgtatgtatgt 38863
>gb|AC091458.5| Mus musculus chromosome 12, clone RP23-68M8, complete sequence Length = 289751 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 170251 atctatgtatgtatgtatgtatgt 170228 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173245 tatgtatgtatgtatgtatgt 173265 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173241 tatgtatgtatgtatgtatgt 173261 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173237 tatgtatgtatgtatgtatgt 173257 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173233 tatgtatgtatgtatgtatgt 173253 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 170244 tatgtatgtatgtatgtatgt 170224 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 170240 tatgtatgtatgtatgtatgt 170220
>gb|AC151982.4| Mus musculus BAC clone RP23-445J16 from chromosome 12, complete sequence Length = 183898 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 31186 atctatgtatgtatgtatgtatgt 31163 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 113407 tatgtatgtatgtatgtatgtg 113428 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 113403 tatgtatgtatgtatgtatgt 113423 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 83181 tatgtatgtatgtatgtatgt 83201 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7920 tatgtatgtatgtatgtatgt 7940 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 7892 tatgtatgtatgtatgtatgt 7912 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 83178 atgtatgtatgtatgtatgt 83197 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 7917 atgtatgtatgtatgtatgt 7936 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 7896 tatgtatgtatgtatgtatg 7915 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 7889 atgtatgtatgtatgtatgt 7908 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 ||||||||||||||| |||||||| Sbjct: 7873 atctatgtatgtatgaatgtatgt 7896
>gb|AC137123.7| Mus musculus chromosome 15, clone RP23-401L15, complete sequence Length = 232054 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 145 tctatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||||| Sbjct: 187966 tctatgtatgtatgtatgtatgtg 187989 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 188008 tatgtatgtatgtatgtatgt 188028 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 188004 tatgtatgtatgtatgtatgt 188024 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 188000 tatgtatgtatgtatgtatgt 188020 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187996 tatgtatgtatgtatgtatgt 188016 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 187992 tatgtatgtatgtatgtatgt 188012 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52638 tatgtatgtatgtatgtatgt 52658
>gb|AC163491.2| Mus musculus chromosome 7, clone RP24-176N8, complete sequence Length = 164417 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 56030 atctatgtatgtatgtatgtatgt 56007 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 8354 tatgtatgtatgtatgtatgtg 8333 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56023 tatgtatgtatgtatgtatgt 56003 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56019 tatgtatgtatgtatgtatgt 55999 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56015 tatgtatgtatgtatgtatgt 55995 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56011 tatgtatgtatgtatgtatgt 55991 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56007 tatgtatgtatgtatgtatgt 55987 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 56003 tatgtatgtatgtatgtatgt 55983 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50723 tatgtatgtatgtatgtatgt 50703 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50719 tatgtatgtatgtatgtatgt 50699 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50715 tatgtatgtatgtatgtatgt 50695 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50711 tatgtatgtatgtatgtatgt 50691 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50707 tatgtatgtatgtatgtatgt 50687 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50703 tatgtatgtatgtatgtatgt 50683 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 50699 tatgtatgtatgtatgtatgt 50679 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8374 tatgtatgtatgtatgtatgt 8354 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8370 tatgtatgtatgtatgtatgt 8350 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8366 tatgtatgtatgtatgtatgt 8346 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8362 tatgtatgtatgtatgtatgt 8342 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 8358 tatgtatgtatgtatgtatgt 8338 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 55999 tatgtatgtatgtatgtatg 55980 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 8377 atgtatgtatgtatgtatgt 8358
>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence Length = 230097 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 24648 atctatgtatgtatgtatgtatgt 24671 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 161771 tatgtatgtatgtatgtatgtg 161750 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161787 tatgtatgtatgtatgtatgt 161767 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161783 tatgtatgtatgtatgtatgt 161763 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161779 tatgtatgtatgtatgtatgt 161759 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161775 tatgtatgtatgtatgtatgt 161755 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24671 tatgtatgtatgtatgtatgt 24691 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24667 tatgtatgtatgtatgtatgt 24687 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24663 tatgtatgtatgtatgtatgt 24683 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24659 tatgtatgtatgtatgtatgt 24679 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 24655 tatgtatgtatgtatgtatgt 24675 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||| ||||||||| Sbjct: 24636 atctatgtatgtatctatgtatgt 24659
>gb|AC115880.11| Mus musculus chromosome 9, clone RP24-365N15, complete sequence Length = 202851 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 5609 atctatgtatgtatgtatgtatgt 5586 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 5576 tatgtatgtatgtatgtatgtg 5555 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52395 tatgtatgtatgtatgtatgt 52415 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52391 tatgtatgtatgtatgtatgt 52411 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52387 tatgtatgtatgtatgtatgt 52407 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52383 tatgtatgtatgtatgtatgt 52403 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52379 tatgtatgtatgtatgtatgt 52399 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5602 tatgtatgtatgtatgtatgt 5582 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5598 tatgtatgtatgtatgtatgt 5578 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 167341 atgtatgtatgtatgtatgt 167360 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 5613 atctatctatgtatgtatgtatgt 5590
>gb|AC136787.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0052B22, complete sequence Length = 156725 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 28370 atctatgtatgtatgtatgtatgt 28393 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28349 tatgtatgtatgtatgtatgt 28369
>gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome 3, complete sequence Length = 190937 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 175462 atctatgtatgtatgtatgtatgt 175439 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 175455 tatgtatgtatgtatgtatgt 175435 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 175451 tatgtatgtatgtatgtatgt 175431 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 175447 tatgtatgtatgtatgtatgt 175427 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167597 tatgtatgtatgtatgtatgt 167617 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167593 tatgtatgtatgtatgtatgt 167613 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167589 tatgtatgtatgtatgtatgt 167609 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167585 tatgtatgtatgtatgtatgt 167605 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167581 tatgtatgtatgtatgtatgt 167601 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167577 tatgtatgtatgtatgtatgt 167597 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 167573 tatgtatgtatgtatgtatgt 167593 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42037 tatgtatgtatgtatgtatgt 42017 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42033 tatgtatgtatgtatgtatgt 42013 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42029 tatgtatgtatgtatgtatgt 42009 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42025 tatgtatgtatgtatgtatgt 42005 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 42021 tatgtatgtatgtatgtatgt 42001 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41869 tatgtatgtatgtatgtatgt 41849 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41865 tatgtatgtatgtatgtatgt 41845 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41861 tatgtatgtatgtatgtatgt 41841 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41857 tatgtatgtatgtatgtatgt 41837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41853 tatgtatgtatgtatgtatgt 41833 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 41849 tatgtatgtatgtatgtatgt 41829
>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence Length = 236510 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 16957 atctatgtatgtatgtatgtatgt 16934 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17014 tatgtatgtatgtatgtatgt 16994 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17010 tatgtatgtatgtatgtatgt 16990 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17006 tatgtatgtatgtatgtatgt 16986 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17002 tatgtatgtatgtatgtatgt 16982 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16998 tatgtatgtatgtatgtatgt 16978 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16994 tatgtatgtatgtatgtatgt 16974 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16990 tatgtatgtatgtatgtatgt 16970 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16986 tatgtatgtatgtatgtatgt 16966 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16982 tatgtatgtatgtatgtatgt 16962 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 16978 tatgtatgtatgtatgtatgt 16958
>gb|AC124343.3| Mus musculus BAC clone RP24-445C12 from chromosome 3, complete sequence Length = 139786 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 121611 atctatgtatgtatgtatgtatgt 121588 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 121580 tatgtatgtatgtatgtatgtg 121559 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 143 aatctatgtatgtatgtatgtatgt 167 |||| |||||||||||||||||||| Sbjct: 134164 aatccatgtatgtatgtatgtatgt 134140 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134156 tatgtatgtatgtatgtatgt 134136 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134152 tatgtatgtatgtatgtatgt 134132 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134148 tatgtatgtatgtatgtatgt 134128 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134144 tatgtatgtatgtatgtatgt 134124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134140 tatgtatgtatgtatgtatgt 134120 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134136 tatgtatgtatgtatgtatgt 134116 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134132 tatgtatgtatgtatgtatgt 134112 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121604 tatgtatgtatgtatgtatgt 121584 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121600 tatgtatgtatgtatgtatgt 121580 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121596 tatgtatgtatgtatgtatgt 121576 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121592 tatgtatgtatgtatgtatgt 121572 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121588 tatgtatgtatgtatgtatgt 121568 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 121584 tatgtatgtatgtatgtatgt 121564 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23071 tatgtatgtatgtatgtatgt 23091 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23067 tatgtatgtatgtatgtatgt 23087 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23063 tatgtatgtatgtatgtatgt 23083 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23059 tatgtatgtatgtatgtatgt 23079 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 23055 tatgtatgtatgtatgtatgt 23075 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 134128 tatgtatgtatgtatgtatg 134109 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 23052 atgtatgtatgtatgtatgt 23071
>gb|AC166040.3| Mus musculus 6 BAC RP24-538P5 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 200847 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 73758 atctatgtatgtatgtatgtatgt 73781 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtgg 169 ||||||||||||||||||||||| Sbjct: 135760 tatgtatgtatgtatgtatgtgg 135782 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 77246 tatgtatgtatgtatgtatgtg 77225 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135756 tatgtatgtatgtatgtatgt 135776 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135752 tatgtatgtatgtatgtatgt 135772 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135748 tatgtatgtatgtatgtatgt 135768 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 135744 tatgtatgtatgtatgtatgt 135764 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118516 tatgtatgtatgtatgtatgt 118536 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 118512 tatgtatgtatgtatgtatgt 118532 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 77250 tatgtatgtatgtatgtatgt 77230 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 73781 tatgtatgtatgtatgtatgt 73801 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 73777 tatgtatgtatgtatgtatgt 73797 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 73773 tatgtatgtatgtatgtatgt 73793 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 73769 tatgtatgtatgtatgtatgt 73789 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 73765 tatgtatgtatgtatgtatgt 73785 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 118509 atgtatgtatgtatgtatgt 118528 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 73750 atctatgtatctatgtatgtatgt 73773
>gb|AC154746.2| Mus musculus BAC clone RP24-396N7 from chromosome 14, complete sequence Length = 184783 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 153384 atctatgtatgtatgtatgtatgt 153361 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 152881 atctatgtatgtatgtatgtatgt 152858 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 152822 atctatgtatgtatgtatgtatgt 152799 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152874 tatgtatgtatgtatgtatgt 152854 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152870 tatgtatgtatgtatgtatgt 152850 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152866 tatgtatgtatgtatgtatgt 152846 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152815 tatgtatgtatgtatgtatgt 152795 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152811 tatgtatgtatgtatgtatgt 152791 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152807 tatgtatgtatgtatgtatgt 152787 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152803 tatgtatgtatgtatgtatgt 152783 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152799 tatgtatgtatgtatgtatgt 152779 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 153392 atctatgtatctatgtatgtatgt 153369
>gb|AC153597.13| Mus musculus 6 BAC RP23-18K9 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 197694 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 5606 atctatgtatgtatgtatgtatgt 5583 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5599 tatgtatgtatgtatgtatgt 5579 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5595 tatgtatgtatgtatgtatgt 5575 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 5591 tatgtatgtatgtatgtatgt 5571 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 5614 atctatgtatctatgtatgtatgt 5591
>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence Length = 191014 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 172625 atctatgtatgtatgtatgtatgt 172648 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172648 tatgtatgtatgtatgtatgt 172668 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172644 tatgtatgtatgtatgtatgt 172664 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172640 tatgtatgtatgtatgtatgt 172660 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172636 tatgtatgtatgtatgtatgt 172656 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172632 tatgtatgtatgtatgtatgt 172652
>gb|AC140477.2| Mus musculus BAC clone RP24-132G6 from chromosome 12, complete sequence Length = 185642 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 126157 atctatgtatgtatgtatgtatgt 126134 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126150 tatgtatgtatgtatgtatgt 126130 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126146 tatgtatgtatgtatgtatgt 126126 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126142 tatgtatgtatgtatgtatgt 126122 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126138 tatgtatgtatgtatgtatgt 126118 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||| ||||||||||||| Sbjct: 126165 atctatgtatctatgtatgtatgt 126142
>gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, complete sequence Length = 212604 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 209653 atctatgtatgtatgtatgtatgt 209630 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 209646 tatgtatgtatgtatgtatgt 209626 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 209642 tatgtatgtatgtatgtatgt 209622 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 209638 tatgtatgtatgtatgtatgt 209618 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 209634 tatgtatgtatgtatgtatgt 209614 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 209630 tatgtatgtatgtatgtatgt 209610 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161207 tatgtatgtatgtatgtatgt 161187 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161203 tatgtatgtatgtatgtatgt 161183 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161199 tatgtatgtatgtatgtatgt 161179 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161195 tatgtatgtatgtatgtatgt 161175 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 161191 tatgtatgtatgtatgtatgt 161171 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 161210 atgtatgtatgtatgtatgt 161191
>gb|AC183524.2| Mus musculus BAC clone RP24-242J6 from chromosome y, complete sequence Length = 173073 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 110832 atctatgtatgtatgtatgtatgt 110855 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110851 tatgtatgtatgtatgtatgt 110871 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110847 tatgtatgtatgtatgtatgt 110867 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110843 tatgtatgtatgtatgtatgt 110863 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110839 tatgtatgtatgtatgtatgt 110859 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27966 tatgtatgtatgtatgtatgt 27946 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27962 tatgtatgtatgtatgtatgt 27942 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27958 tatgtatgtatgtatgtatgt 27938 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 27954 tatgtatgtatgtatgtatgt 27934 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 110855 tatgtatgtatgtatgtatg 110874 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 27973 atctatatatgtatgtatgtatgt 27950 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 27950 tatgtatgtatgtatgtatg 27931
>gb|AC185964.1| Mus musculus chromosome UNK clone CH33-204D11, complete sequence Length = 209635 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 153911 atctatgtatgtatgtatgtatgt 153934 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 153930 tatgtatgtatgtatgtatgt 153950 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 153926 tatgtatgtatgtatgtatgt 153946 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 153922 tatgtatgtatgtatgtatgt 153942 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 153918 tatgtatgtatgtatgtatgt 153938
>gb|AC185963.1| Mus musculus chromosome UNK clone CH26-87M2, complete sequence Length = 196014 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 84132 atctatgtatgtatgtatgtatgt 84155 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84143 tatgtatgtatgtatgtatgt 84163 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84139 tatgtatgtatgtatgtatgt 84159 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 84147 tatgtatgtatgtatgtatg 84166
>gb|AC117224.3| Mus musculus BAC clone RP23-356N8 from chromosome 16, complete sequence Length = 197831 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 120220 atctatgtatgtatgtatgtatgt 120243 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 108336 tatgtatgtatgtatgtatgtg 108315 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 168493 tatgtatgtatgtatgtatgt 168513 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 168489 tatgtatgtatgtatgtatgt 168509 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 168485 tatgtatgtatgtatgtatgt 168505 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 168481 tatgtatgtatgtatgtatgt 168501 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 168477 tatgtatgtatgtatgtatgt 168497 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120243 tatgtatgtatgtatgtatgt 120263 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120239 tatgtatgtatgtatgtatgt 120259 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120235 tatgtatgtatgtatgtatgt 120255 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120231 tatgtatgtatgtatgtatgt 120251 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 120227 tatgtatgtatgtatgtatgt 120247 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 168474 atgtatgtatgtatgtatgt 168493
>gb|AC140203.2| Mus musculus BAC clone RP24-334J15 from chromosome Y, complete sequence Length = 159604 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 43252 atctatgtatgtatgtatgtatgt 43275 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 146126 tatgtatgtatgtatgtatgtg 146147 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146122 tatgtatgtatgtatgtatgt 146142 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146118 tatgtatgtatgtatgtatgt 146138 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146114 tatgtatgtatgtatgtatgt 146134 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146110 tatgtatgtatgtatgtatgt 146130 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146106 tatgtatgtatgtatgtatgt 146126 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146102 tatgtatgtatgtatgtatgt 146122 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146098 tatgtatgtatgtatgtatgt 146118 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 146094 tatgtatgtatgtatgtatgt 146114 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43291 tatgtatgtatgtatgtatgt 43311 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43287 tatgtatgtatgtatgtatgt 43307 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43283 tatgtatgtatgtatgtatgt 43303 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43279 tatgtatgtatgtatgtatgt 43299 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43275 tatgtatgtatgtatgtatgt 43295 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43271 tatgtatgtatgtatgtatgt 43291 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43267 tatgtatgtatgtatgtatgt 43287 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43263 tatgtatgtatgtatgtatgt 43283 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 43259 tatgtatgtatgtatgtatgt 43279 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 146087 atctatatatgtatgtatgtatgt 146110 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 43295 tatgtatgtatgtatgtatg 43314
>gb|AC140188.3| Mus musculus BAC clone RP24-365F13 from chromosome Y, complete sequence Length = 191466 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 172584 atctatgtatgtatgtatgtatgt 172607 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172611 tatgtatgtatgtatgtatgt 172631 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172607 tatgtatgtatgtatgtatgt 172627 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172603 tatgtatgtatgtatgtatgt 172623 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172599 tatgtatgtatgtatgtatgt 172619 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172595 tatgtatgtatgtatgtatgt 172615 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 172591 tatgtatgtatgtatgtatgt 172611 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 172615 tatgtatgtatgtatgtatg 172634
>gb|AC144758.2| Danio rerio, complete sequence Length = 177787 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 48306 atctatgtatgtatgtatgtatgt 48329 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48329 tatgtatgtatgtatgtatgt 48349 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48325 tatgtatgtatgtatgtatgt 48345 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48321 tatgtatgtatgtatgtatgt 48341 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48317 tatgtatgtatgtatgtatgt 48337 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 48313 tatgtatgtatgtatgtatgt 48333
>gb|AC121097.6| Mus musculus chromosome 13, clone RP24-449F13, complete sequence Length = 217251 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 188246 atctatgtatgtatgtatgtatgt 188223 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 205861 tatgtatgtatgtatgtatgtg 205882 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtg 168 |||||||||||||||||||||| Sbjct: 74709 tatgtatgtatgtatgtatgtg 74688 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205857 tatgtatgtatgtatgtatgt 205877 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205853 tatgtatgtatgtatgtatgt 205873 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205849 tatgtatgtatgtatgtatgt 205869 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205845 tatgtatgtatgtatgtatgt 205865 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205841 tatgtatgtatgtatgtatgt 205861 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 205837 tatgtatgtatgtatgtatgt 205857 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 188239 tatgtatgtatgtatgtatgt 188219 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 188235 tatgtatgtatgtatgtatgt 188215 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 74713 tatgtatgtatgtatgtatgt 74693 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 74716 atgtatgtatgtatgtatgt 74697
>gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, complete sequence Length = 229313 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 30453 atctatgtatgtatgtatgtatgt 30430 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 30446 tatgtatgtatgtatgtatgt 30426
>gb|AC145076.8| Mus musculus chromosome 10, clone RP24-528G5, complete sequence Length = 224534 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 82575 atctatgtatgtatgtatgtatgt 82598 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 82598 tatgtatgtatgtatgtatgt 82618 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 82594 tatgtatgtatgtatgtatgt 82614 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 82590 tatgtatgtatgtatgtatgt 82610 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 82586 tatgtatgtatgtatgtatgt 82606 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 82582 tatgtatgtatgtatgtatgt 82602
>gb|AC113265.25| Mus musculus strain C57BL/6J clone rp23-46k8 map 17, complete sequence Length = 143758 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 117920 atctatgtatgtatgtatgtatgt 117943 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 117927 tatgtatgtatgtatgtatgt 117947 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 86777 tatgtatgtatgtatgtatgt 86757
>gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 map 17, complete sequence Length = 236365 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgtggc 170 |||||||||||||||||||||||| Sbjct: 126831 tatgtatgtatgtatgtatgtggc 126808 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126847 tatgtatgtatgtatgtatgt 126827 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126843 tatgtatgtatgtatgtatgt 126823 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126839 tatgtatgtatgtatgtatgt 126819 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126835 tatgtatgtatgtatgtatgt 126815 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 126850 atgtatgtatgtatgtatgt 126831
>gb|AC140784.3| Mus musculus BAC clone RP24-239O15 from chromosome Y, complete sequence Length = 166550 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 37300 atctatgtatgtatgtatgtatgt 37277 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122460 tatgtatgtatgtatgtatgt 122480 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122456 tatgtatgtatgtatgtatgt 122476 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122452 tatgtatgtatgtatgtatgt 122472 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122448 tatgtatgtatgtatgtatgt 122468 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122444 tatgtatgtatgtatgtatgt 122464 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37293 tatgtatgtatgtatgtatgt 37273 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37289 tatgtatgtatgtatgtatgt 37269 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37285 tatgtatgtatgtatgtatgt 37265 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 37281 tatgtatgtatgtatgtatgt 37261 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 122464 tatgtatgtatgtatgtatg 122483 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 122437 atctatatatgtatgtatgtatgt 122460 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 37277 tatgtatgtatgtatgtatg 37258
>gb|AC132283.4| Mus musculus BAC clone RP24-351L16 from chromosome Y, complete sequence Length = 165828 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 31503 atctatgtatgtatgtatgtatgt 31526 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31514 tatgtatgtatgtatgtatgt 31534 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 31510 tatgtatgtatgtatgtatgt 31530 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 31518 tatgtatgtatgtatgtatg 31537
>gb|AC145552.3| Mus musculus BAC clone RP24-573I22 from chromosome Y, complete sequence Length = 146775 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 102533 atctatgtatgtatgtatgtatgt 102556 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53027 tatgtatgtatgtatgtatgt 53007 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53023 tatgtatgtatgtatgtatgt 53003 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53019 tatgtatgtatgtatgtatgt 52999 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 53015 tatgtatgtatgtatgtatgt 52995 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 102540 tatgtatgtatgtatgtatg 102559 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 53034 atctatatatgtatgtatgtatgt 53011 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 53011 tatgtatgtatgtatgtatg 52992
>gb|AC139297.4| Mus musculus BAC clone RP24-62H18 from chromosome Y, complete sequence Length = 206783 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 67544 atctatgtatgtatgtatgtatgt 67567 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67555 tatgtatgtatgtatgtatgt 67575 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 67551 tatgtatgtatgtatgtatgt 67571 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 67559 tatgtatgtatgtatgtatg 67578
>gb|AC140348.4| Mus musculus BAC clone RP24-66K20 from chromosome Y, complete sequence Length = 214393 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 28178 atctatgtatgtatgtatgtatgt 28201 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173375 tatgtatgtatgtatgtatgt 173395 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173371 tatgtatgtatgtatgtatgt 173391 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 173367 tatgtatgtatgtatgtatgt 173387 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 90768 tatgtatgtatgtatgtatgt 90748 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 90764 tatgtatgtatgtatgtatgt 90744 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28213 tatgtatgtatgtatgtatgt 28233 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28209 tatgtatgtatgtatgtatgt 28229 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28205 tatgtatgtatgtatgtatgt 28225 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28201 tatgtatgtatgtatgtatgt 28221 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28197 tatgtatgtatgtatgtatgt 28217 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28193 tatgtatgtatgtatgtatgt 28213 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28189 tatgtatgtatgtatgtatgt 28209 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 28185 tatgtatgtatgtatgtatgt 28205 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 173379 tatgtatgtatgtatgtatg 173398 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 148 atgtatgtatgtatgtatgt 167 |||||||||||||||||||| Sbjct: 173364 atgtatgtatgtatgtatgt 173383 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 90775 atctatatatgtatgtatgtatgt 90752 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 90760 tatgtatgtatgtatgtatg 90741 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 28217 tatgtatgtatgtatgtatg 28236
>gb|AC145563.2| Mus musculus BAC clone RP24-75L3 from chromosome Y, complete sequence Length = 204641 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 17402 atctatgtatgtatgtatgtatgt 17379 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 102989 tatgtatgtatgtatgtatgt 103009 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17395 tatgtatgtatgtatgtatgt 17375 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17391 tatgtatgtatgtatgtatgt 17371 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17387 tatgtatgtatgtatgtatgt 17367 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17383 tatgtatgtatgtatgtatgt 17363 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17379 tatgtatgtatgtatgtatgt 17359 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 17375 tatgtatgtatgtatgtatgt 17355 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 102993 tatgtatgtatgtatgtatg 103012 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 17371 tatgtatgtatgtatgtatg 17352
>gb|AC134579.5| Mus musculus BAC clone RP24-82I10 from chromosome Y, complete sequence Length = 233924 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 147434 atctatgtatgtatgtatgtatgt 147457 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 147445 tatgtatgtatgtatgtatgt 147465 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 147441 tatgtatgtatgtatgtatgt 147461 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61918 tatgtatgtatgtatgtatgt 61898 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61914 tatgtatgtatgtatgtatgt 61894 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61910 tatgtatgtatgtatgtatgt 61890 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 61906 tatgtatgtatgtatgtatgt 61886 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 147449 tatgtatgtatgtatgtatg 147468 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 61925 atctatatatgtatgtatgtatgt 61902 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 61902 tatgtatgtatgtatgtatg 61883
>gb|AC145270.3| Mus musculus BAC clone RP24-97H23 from chromosome Y, complete sequence Length = 165410 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 47313 atctatgtatgtatgtatgtatgt 47290 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47306 tatgtatgtatgtatgtatgt 47286 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47302 tatgtatgtatgtatgtatgt 47282 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47298 tatgtatgtatgtatgtatgt 47278 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47294 tatgtatgtatgtatgtatgt 47274 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47290 tatgtatgtatgtatgtatgt 47270 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47286 tatgtatgtatgtatgtatgt 47266 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47282 tatgtatgtatgtatgtatgt 47262 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 47278 tatgtatgtatgtatgtatgt 47258 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 47274 tatgtatgtatgtatgtatg 47255
>gb|AC147113.2| Mus musculus BAC clone RP24-120I13 from chromosome Y, complete sequence Length = 196099 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 126209 atctatgtatgtatgtatgtatgt 126186 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126202 tatgtatgtatgtatgtatgt 126182 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126198 tatgtatgtatgtatgtatgt 126178 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126194 tatgtatgtatgtatgtatgt 126174 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126190 tatgtatgtatgtatgtatgt 126170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126186 tatgtatgtatgtatgtatgt 126166 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126182 tatgtatgtatgtatgtatgt 126162 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 126178 tatgtatgtatgtatgtatgt 126158 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 126174 tatgtatgtatgtatgtatg 126155
>gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosome Y, complete sequence Length = 158872 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 152825 atctatgtatgtatgtatgtatgt 152802 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 152818 tatgtatgtatgtatgtatgt 152798 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 152814 tatgtatgtatgtatgtatg 152795
>gb|AC140493.3| Mus musculus BAC clone RP24-137I9 from chromosome Y, complete sequence Length = 150186 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 4615 atctatgtatgtatgtatgtatgt 4638 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4646 tatgtatgtatgtatgtatgt 4666 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4642 tatgtatgtatgtatgtatgt 4662 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4638 tatgtatgtatgtatgtatgt 4658 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4634 tatgtatgtatgtatgtatgt 4654 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4630 tatgtatgtatgtatgtatgt 4650 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4626 tatgtatgtatgtatgtatgt 4646 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 4622 tatgtatgtatgtatgtatgt 4642 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 4650 tatgtatgtatgtatgtatg 4669
>gb|AC140405.4| Mus musculus BAC clone RP24-176I18 from chromosome Y, complete sequence Length = 197287 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 162079 atctatgtatgtatgtatgtatgt 162056 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 162072 tatgtatgtatgtatgtatgt 162052 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 18297 tatgtatgtatgtatgtatgt 18317 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 18293 tatgtatgtatgtatgtatgt 18313 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 18289 tatgtatgtatgtatgtatgt 18309 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 18285 tatgtatgtatgtatgtatgt 18305 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 18281 tatgtatgtatgtatgtatgt 18301 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 162068 tatgtatgtatgtatgtatg 162049 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 18301 tatgtatgtatgtatgtatg 18320 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 18274 atctatatatgtatgtatgtatgt 18297
>gb|AC144626.3| Mus musculus BAC clone RP24-187E8 from chromosome Y, complete sequence Length = 175009 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 57814 atctatgtatgtatgtatgtatgt 57837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 57821 tatgtatgtatgtatgtatgt 57841 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 57825 tatgtatgtatgtatgtatg 57844
>gb|AC144624.3| Mus musculus BAC clone RP24-190P7 from chromosome Y, complete sequence Length = 166431 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 1803 atctatgtatgtatgtatgtatgt 1780 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51307 tatgtatgtatgtatgtatgt 51327 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51303 tatgtatgtatgtatgtatgt 51323 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51299 tatgtatgtatgtatgtatgt 51319 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 51295 tatgtatgtatgtatgtatgt 51315 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 51311 tatgtatgtatgtatgtatg 51330 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 51288 atctatatatgtatgtatgtatgt 51311 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 1796 tatgtatgtatgtatgtatg 1777
>gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosome Y, complete sequence Length = 163892 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 32180 atctatgtatgtatgtatgtatgt 32203 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 32187 tatgtatgtatgtatgtatgt 32207 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 32191 tatgtatgtatgtatgtatg 32210
>gb|AC136452.4| Mus musculus BAC clone RP24-274L23 from chromosome Y, complete sequence Length = 155057 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 15820 atctatgtatgtatgtatgtatgt 15843 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131195 tatgtatgtatgtatgtatgt 131175 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131191 tatgtatgtatgtatgtatgt 131171 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131187 tatgtatgtatgtatgtatgt 131167 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131183 tatgtatgtatgtatgtatgt 131163 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131179 tatgtatgtatgtatgtatgt 131159 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131175 tatgtatgtatgtatgtatgt 131155 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 131171 tatgtatgtatgtatgtatgt 131151 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 15827 tatgtatgtatgtatgtatgt 15847 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 131202 atctatatatgtatgtatgtatgt 131179 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 131167 tatgtatgtatgtatgtatg 131148 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 15831 tatgtatgtatgtatgtatg 15850
>gb|AC131188.4| Mus musculus BAC clone RP24-272N18 from chromosome Y, complete sequence Length = 161415 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 134171 atctatgtatgtatgtatgtatgt 134148 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134164 tatgtatgtatgtatgtatgt 134144 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134160 tatgtatgtatgtatgtatgt 134140 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134156 tatgtatgtatgtatgtatgt 134136 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134152 tatgtatgtatgtatgtatgt 134132 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134148 tatgtatgtatgtatgtatgt 134128 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 134144 tatgtatgtatgtatgtatgt 134124 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 134140 tatgtatgtatgtatgtatg 134121
>gb|AC147166.2| Mus musculus BAC clone RP24-277F21 from chromosome Y, complete sequence Length = 130964 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 70804 atctatgtatgtatgtatgtatgt 70781 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 70797 tatgtatgtatgtatgtatgt 70777 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 70793 tatgtatgtatgtatgtatgt 70773 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 70789 tatgtatgtatgtatgtatgt 70769 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 70785 tatgtatgtatgtatgtatg 70766
>gb|AC140473.3| Mus musculus BAC clone RP24-405H7 from chromosome Y, complete sequence Length = 133519 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 9795 atctatgtatgtatgtatgtatgt 9818 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9814 tatgtatgtatgtatgtatgt 9834 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9810 tatgtatgtatgtatgtatgt 9830 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9806 tatgtatgtatgtatgtatgt 9826 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 9802 tatgtatgtatgtatgtatgt 9822 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 9818 tatgtatgtatgtatgtatg 9837
>gb|AC144580.3| Mus musculus BAC clone RP24-393I12 from chromosome Y, complete sequence Length = 152944 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 70260 atctatgtatgtatgtatgtatgt 70283 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 70267 tatgtatgtatgtatgtatgt 70287 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 70271 tatgtatgtatgtatgtatg 70290
>gb|AC136639.3| Mus musculus BAC clone RP24-392N7 from chromosome Y, complete sequence Length = 149567 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 25070 atctatgtatgtatgtatgtatgt 25047 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110832 tatgtatgtatgtatgtatgt 110852 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110828 tatgtatgtatgtatgtatgt 110848 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 110824 tatgtatgtatgtatgtatgt 110844 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 25063 tatgtatgtatgtatgtatgt 25043 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 110836 tatgtatgtatgtatgtatg 110855 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 110817 atctatatatgtatgtatgtatgt 110840 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 25059 tatgtatgtatgtatgtatg 25040
>gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome Y, complete sequence Length = 162132 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 69744 atctatgtatgtatgtatgtatgt 69767 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69763 tatgtatgtatgtatgtatgt 69783 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69759 tatgtatgtatgtatgtatgt 69779 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69755 tatgtatgtatgtatgtatgt 69775 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 69751 tatgtatgtatgtatgtatgt 69771 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 69767 tatgtatgtatgtatgtatg 69786
>gb|AC142214.3| Mus musculus BAC clone RP24-375O5 from chromosome Y, complete sequence Length = 171742 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 122000 atctatgtatgtatgtatgtatgt 122023 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122023 tatgtatgtatgtatgtatgt 122043 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122019 tatgtatgtatgtatgtatgt 122039 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122015 tatgtatgtatgtatgtatgt 122035 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122011 tatgtatgtatgtatgtatgt 122031 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 122007 tatgtatgtatgtatgtatgt 122027 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52956 tatgtatgtatgtatgtatgt 52936 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52952 tatgtatgtatgtatgtatgt 52932 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 52948 tatgtatgtatgtatgtatgt 52928 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 122027 tatgtatgtatgtatgtatg 122046 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||| ||||||||||||||||| Sbjct: 52963 atctatatatgtatgtatgtatgt 52940
>gb|AC136638.4| Mus musculus BAC clone RP24-369F2 from chromosome Y, complete sequence Length = 165290 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 144 atctatgtatgtatgtatgtatgt 167 |||||||||||||||||||||||| Sbjct: 84635 atctatgtatgtatgtatgtatgt 84658 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatgt 167 ||||||||||||||||||||| Sbjct: 84642 tatgtatgtatgtatgtatgt 84662 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 tatgtatgtatgtatgtatg 166 |||||||||||||||||||| Sbjct: 84646 tatgtatgtatgtatgtatg 84665 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 10,052,489 Number of Sequences: 3902068 Number of extensions: 10052489 Number of successful extensions: 795346 Number of sequences better than 10.0: 19550 Number of HSP's better than 10.0 without gapping: 19641 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 369849 Number of HSP's gapped (non-prelim): 367614 length of query: 716 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 693 effective length of database: 17,143,297,704 effective search space: 11880305308872 effective search space used: 11880305308872 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
