ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd20l23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_475770.1| Oryza sativa (japonica cultivar-group), predic... 88 4e-14
2gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome... 88 4e-14
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
4dbj|AK101555.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
5dbj|AK101539.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
6gb|AY110461.1| Zea mays CL187_5 mRNA sequence 64 5e-07
7gb|BT016747.1| Zea mays clone Contig580 mRNA sequence 62 2e-06
8gb|AC125348.3| Mus musculus BAC clone RP23-377H20 from chromosom... 46 0.12
9gb|AF372979.1| Mus musculus P locus fat-associated ATPase (Atp10... 46 0.12
10gb|AC110090.6| Mus musculus BAC clone RP23-27L4 from chromosome ... 44 0.48
11gb|AC157769.3| Mus musculus chromosome 1, clone RP24-314L7, comp... 44 0.48
12gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, com... 44 0.48
13gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, com... 44 0.48
14gb|AC018445.21| Homo sapiens chromosome 18, clone RP11-196B3, co... 44 0.48
15gb|AC110042.12| Mus musculus chromosome 1, clone RP23-278C6, com... 44 0.48
16emb|CT030233.6| Mouse DNA sequence from clone RP24-103C16 on chr... 44 0.48
17gb|AC166061.2| Mus musculus BAC clone RP23-177N16 from chromosom... 44 0.48
18gb|AC165085.3| Mus musculus BAC clone RP23-222G22 from chromosom... 42 1.9
19gb|AC132293.3| Mus musculus BAC clone RP24-322H1 from chromosome... 42 1.9
20gb|L23982.1|HUMCOL7A1X Homo sapiens collagen type VII (COL7A1) g... 42 1.9
21gb|AC126459.3| Mus musculus BAC clone RP23-181A8 from chromosome... 42 1.9
22emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, com... 42 1.9
23gb|AC117623.7| Mus musculus chromosome 1, clone RP23-114L12, com... 42 1.9
24emb|AL365267.11| Human DNA sequence from clone RP11-789A7 on chr... 42 1.9
25gb|AC023891.28| Homo sapiens 3 BAC RP13-81O8 (Roswell Park Cance... 42 1.9
26gb|AC121252.4| Homo sapiens chromosome 3 clone RP11-148G20, comp... 42 1.9
27emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chro... 42 1.9
28emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 i... 42 1.9
29gb|AC005903.5| Homo sapiens 3 PAC RP5-1034C16 (Roswell Park Canc... 42 1.9
30gb|AC144921.12| Mus musculus chromosome 1, clone RP24-214P19, co... 42 1.9
31gb|AC149216.5| Mus musculus BAC clone RP24-194H8 from 18, comple... 42 1.9
32emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in... 42 1.9
33gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 7.5
34gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome ... 40 7.5
35gb|AC167017.4| Mus musculus BAC clone RP24-86L13 from chromosome... 40 7.5
36gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome... 40 7.5
37gb|AC091331.14| Mus musculus chromosome 1, clone RP23-293F4, com... 40 7.5
38gb|AC149610.1| Mus musculus BAC clone RP23-263D11 from chromosom... 40 7.5
39gb|AC147988.3| Mus musculus BAC clone RP24-459A9 from chromosome... 40 7.5
40gb|AC154442.3| Mus musculus BAC clone RP24-178L2 from chromosome... 40 7.5
41gb|AC166167.2| Mus musculus BAC clone RP23-211D22 from chromosom... 40 7.5
42gb|AC146897.5| Gorilla gorilla, clone XX-413A16, complete sequence 40 7.5
43gb|AC125536.3| Mus musculus BAC clone RP24-142N21 from chromosom... 40 7.5
44gb|AC115117.5| Mus musculus BAC clone RP23-76J12 from chromosome... 40 7.5
45gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosom... 40 7.5
46gb|AC125040.4| Mus musculus BAC clone RP23-335C9 from chromosome... 40 7.5
47gb|AC098716.2| Mus musculus BAC clone RP23-2F19 from 9, complete... 40 7.5
48emb|BX005422.5| Human DNA sequence from clone DASS-32K24 on chro... 40 7.5
49emb|AL805913.4| Human DNA sequence from clone DAQB-22D21 on chro... 40 7.5
50emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chr... 40 7.5
51emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on ch... 40 7.5
52emb|AL662889.5| Human DNA sequence from clone RP11-370K11 on chr... 40 7.5
53emb|AL603824.4| Human DNA sequence from clone RP11-235G8 on chro... 40 7.5
54emb|AL590553.8| Human DNA sequence from clone RP11-272G1 on chro... 40 7.5
55emb|AL139187.19| Human DNA sequence from clone RP11-81F11 on chr... 40 7.5
56emb|Z84483.1|HS46H23 Human DNA sequence from clone RP1-46H23 on ... 40 7.5
57gb|AC164250.4| Mus musculus BAC RP24-327O15 (Roswell Park Cance... 40 7.5
58emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 40 7.5
59emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chro... 40 7.5
60emb|AL590629.16| Mouse DNA sequence from clone RP23-202F23 on ch... 40 7.5
61emb|CR759829.6| Human DNA sequence from clone DADB-17J1 on chrom... 40 7.5
62emb|CR847849.5| Human DNA sequence from clone DAMA-245O6 on chro... 40 7.5
63emb|CR759904.5| Human DNA sequence from clone DAAP-277G18 on chr... 40 7.5
64gb|AC073548.5| Homo sapiens chromosome 19 clone RP11-43N16, comp... 40 7.5
65emb|CR385029.5| Opossum DNA sequence from clone XX-191G11, compl... 40 7.5
66gb|AC151665.26| Medicago truncatula clone mth2-7k4, complete seq... 40 7.5
67gb|AC174354.6| Medicago truncatula clone mth2-8m12, complete seq... 40 7.5
68gb|AC009729.14| Homo sapiens 12 BAC RP11-1K3 (Roswell Park Cance... 40 7.5
69dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 40 7.5
70gb|AC090083.3| Homo sapiens chromosome 15, clone CTD-2311K11, co... 40 7.5
71gb|AC098850.2| Homo sapiens chromosome 17, clone RP11-92B11, com... 40 7.5
72gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 40 7.5
73emb|BX548025.9| Zebrafish DNA sequence from clone DKEY-237J22 in... 40 7.5
74gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 40 7.5
75gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 40 7.5
76gb|AC008536.7| Homo sapiens chromosome 5 clone CTC-487M23, compl... 40 7.5
77dbj|AK044281.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 7.5
78gb|AC148676.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.5
79emb|CR378092.1| Pinus pinaster SSR, clone PPB2E01 40 7.5
80gb|U33915.1|CPU33915 Craterostigma plantagineum myb-related tran... 40 7.5
81gb|AC131009.7| Homo sapiens 12 BAC RP11-417L19 (Roswell Park Can... 40 7.5
82gb|AF271715.1|AF271715 Staphylococcus aureus serine protease spl... 40 7.5
83gb|AC011901.4| Homo sapiens BAC clone RP11-547P13 from 2, comple... 40 7.5
84gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosom... 40 7.5
85gb|AC126352.6| Homo sapiens chromosome 17, clone CTD-2509K7, com... 40 7.5
86gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, com... 40 7.5
87gb|AC005036.1| Homo sapiens BAC clone RP11-364H22 from 2, comple... 40 7.5
88gb|AC139714.1| Homo sapiens BAC clone RP11-484I7 from 2, complet... 40 7.5
89gb|AC087738.13| Homo sapiens chromosome 15, clone RP11-365F16, c... 40 7.5
90dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 40 7.5
91dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 40 7.5
92gb|AC117735.8| Mus musculus chromosome 5, clone RP24-132L16, com... 40 7.5
93gb|AC154780.2| Mus musculus BAC clone RP24-462E4 from 13, comple... 40 7.5
94emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 40 7.5
95emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 40 7.5
96gb|AF098950.1|AF098950 Homo sapiens COQ7 protein gene, promoter ... 40 7.5
97dbj|AP001979.7| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.5
98gb|AC164973.4| Ornithorhynchus anatinus BAC clone OABb-265H16 fr... 40 7.5
99emb|AL929117.7| Mouse DNA sequence from clone RP23-442K5 on chro... 40 7.5
100gb|AC140231.3| Mus musculus BAC clone RP24-493L15 from 6, comple... 40 7.5
101emb|CT033749.8| Mouse DNA sequence from clone RP23-14N10 on chro... 40 7.5
102gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, comple... 40 7.5
103emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 40 7.5
104gb|U60589.1|SAU60589 Staphylococcus aureus novel antigen gene, c... 40 7.5
105emb|Z95437.1|HSA1 Human DNA sequence from clone XX-A1 on chromos... 40 7.5
106dbj|AB034443.1| Human immunodeficiency virus type 1 proviral gen... 40 7.5
107dbj|AB034436.1| Human immunodeficiency virus type 1 proviral gen... 40 7.5
108dbj|AB034387.1| Human immunodeficiency virus type 1 proviral gen... 40 7.5
109dbj|AB034383.1| Human immunodeficiency virus type 1 proviral gen... 40 7.5

>ref|XM_475770.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1725

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 110/130 (84%), Gaps = 4/130 (3%)
 Strand = Plus / Minus

                                                                        
Query: 415  tgcgtctcttgatgacagcatagacttgtcgactttcgctgcctctttagtaccaggatg 474
            ||||||||||||||| ||||||||||||||  | ||| || |||||||   ||||| |||
Sbjct: 1689 tgcgtctcttgatgatagcatagacttgtcagccttcactccctctttgccaccagcatg 1630

                                                                        
Query: 475  gattggccttttgtgtacgcggcgagtgcgaattctgcttaccattggcaggggaaggga 534
            | |||||| |||||||||||||||||||||| |||  |||||||||   || ||| ||||
Sbjct: 1629 ggttggcc-tttgtgtacgcggcgagtgcgagttcaacttaccatt---agaggatggga 1574

                      
Query: 535  gggaatggcg 544
            ||||||||||
Sbjct: 1573 gggaatggcg 1564



to top

>gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01,
             complete sequence
          Length = 147704

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 110/130 (84%), Gaps = 4/130 (3%)
 Strand = Plus / Minus

                                                                         
Query: 415   tgcgtctcttgatgacagcatagacttgtcgactttcgctgcctctttagtaccaggatg 474
             ||||||||||||||| ||||||||||||||  | ||| || |||||||   ||||| |||
Sbjct: 57602 tgcgtctcttgatgatagcatagacttgtcagccttcactccctctttgccaccagcatg 57543

                                                                         
Query: 475   gattggccttttgtgtacgcggcgagtgcgaattctgcttaccattggcaggggaaggga 534
             | |||||| |||||||||||||||||||||| |||  |||||||||   || ||| ||||
Sbjct: 57542 ggttggcc-tttgtgtacgcggcgagtgcgagttcaacttaccatt---agaggatggga 57487

                       
Query: 535   gggaatggcg 544
             ||||||||||
Sbjct: 57486 gggaatggcg 57477



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 283   tttttacatcagaagcaaaacaat 306
             |||||||||| |||||||||||||
Sbjct: 58464 tttttacatcggaagcaaaacaat 58441



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 110/130 (84%), Gaps = 4/130 (3%)
 Strand = Plus / Minus

                                                                            
Query: 415      tgcgtctcttgatgacagcatagacttgtcgactttcgctgcctctttagtaccaggatg 474
                ||||||||||||||| ||||||||||||||  | ||| || |||||||   ||||| |||
Sbjct: 26412911 tgcgtctcttgatgatagcatagacttgtcagccttcactccctctttgccaccagcatg 26412852

                                                                            
Query: 475      gattggccttttgtgtacgcggcgagtgcgaattctgcttaccattggcaggggaaggga 534
                | |||||| |||||||||||||||||||||| |||  |||||||||   || ||| ||||
Sbjct: 26412851 ggttggcc-tttgtgtacgcggcgagtgcgagttcaacttaccatt---agaggatggga 26412796

                          
Query: 535      gggaatggcg 544
                ||||||||||
Sbjct: 26412795 gggaatggcg 26412786



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 283      tttttacatcagaagcaaaacaat 306
                |||||||||| |||||||||||||
Sbjct: 26413773 tttttacatcggaagcaaaacaat 26413750



to top

>dbj|AK101555.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050A17, full
            insert sequence
          Length = 2348

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 110/130 (84%), Gaps = 4/130 (3%)
 Strand = Plus / Minus

                                                                        
Query: 415  tgcgtctcttgatgacagcatagacttgtcgactttcgctgcctctttagtaccaggatg 474
            ||||||||||||||| ||||||||||||||  | ||| || |||||||   ||||| |||
Sbjct: 1906 tgcgtctcttgatgatagcatagacttgtcagccttcactccctctttgccaccagcatg 1847

                                                                        
Query: 475  gattggccttttgtgtacgcggcgagtgcgaattctgcttaccattggcaggggaaggga 534
            | |||||| |||||||||||||||||||||| |||  |||||||||   || ||| ||||
Sbjct: 1846 ggttggcc-tttgtgtacgcggcgagtgcgagttcaacttaccatt---agaggatggga 1791

                      
Query: 535  gggaatggcg 544
            ||||||||||
Sbjct: 1790 gggaatggcg 1781



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 283  tttttacatcagaagcaaaacaat 306
            |||||||||| |||||||||||||
Sbjct: 2056 tttttacatcggaagcaaaacaat 2033



to top

>dbj|AK101539.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048G06, full
            insert sequence
          Length = 2259

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 110/130 (84%), Gaps = 4/130 (3%)
 Strand = Plus / Minus

                                                                        
Query: 415  tgcgtctcttgatgacagcatagacttgtcgactttcgctgcctctttagtaccaggatg 474
            ||||||||||||||| ||||||||||||||  | ||| || |||||||   ||||| |||
Sbjct: 1863 tgcgtctcttgatgatagcatagacttgtcagccttcactccctctttgccaccagcatg 1804

                                                                        
Query: 475  gattggccttttgtgtacgcggcgagtgcgaattctgcttaccattggcaggggaaggga 534
            | |||||| |||||||||||||||||||||| |||  |||||||||   || ||| ||||
Sbjct: 1803 ggttggcc-tttgtgtacgcggcgagtgcgagttcaacttaccatt---agaggatggga 1748

                      
Query: 535  gggaatggcg 544
            ||||||||||
Sbjct: 1747 gggaatggcg 1738



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 283  tttttacatcagaagcaaaacaat 306
            |||||||||| |||||||||||||
Sbjct: 2013 tttttacatcggaagcaaaacaat 1990



to top

>gb|AY110461.1| Zea mays CL187_5 mRNA sequence
          Length = 1071

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 383 cgtctccattcggctttcatcggtctctcggctgcgtctcttgatgacagcatagacttg 442
           |||||||| || |||||||  |||||||||  ||| ||||||||||||||||||| ||||
Sbjct: 477 cgtctccactcagctttcagtggtctctcgcttgcatctcttgatgacagcatagccttg 418

                       
Query: 443 tcgactttcgct 454
           ||  ||||||||
Sbjct: 417 tcacctttcgct 406



to top

>gb|BT016747.1| Zea mays clone Contig580 mRNA sequence
          Length = 1705

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 383  cgtctccattcggctttcatcggtctctcggctgcgtctcttgatgacagcatagacttg 442
            |||||||| || ||||||| ||||||||||   || ||||||||||||||||||| ||||
Sbjct: 1293 cgtctccactcagctttcagcggtctctcgctcgcatctcttgatgacagcatagccttg 1234

               
Query: 443  tcg 445
            |||
Sbjct: 1233 tcg 1231



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 36/40 (90%), Gaps = 3/40 (7%)
 Strand = Plus / Minus

                                                    
Query: 283  tttttacatcagaagcaaaacaatcagaggagcaaactgc 322
            ||||||||||| |||||||||||||   ||||||||||||
Sbjct: 1402 tttttacatcacaagcaaaacaatc---ggagcaaactgc 1366



to top

>gb|AC125348.3| Mus musculus BAC clone RP23-377H20 from chromosome 7, complete sequence
          Length = 188610

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 64     atctctgtctgtctctccatctc 86
              |||||||||||||||||||||||
Sbjct: 147629 atctctgtctgtctctccatctc 147607



to top

>gb|AF372979.1| Mus musculus P locus fat-associated ATPase (Atp10a) gene, exons 2
             through 21 and partial cds
          Length = 129459

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 64    atctctgtctgtctctccatctc 86
             |||||||||||||||||||||||
Sbjct: 43009 atctctgtctgtctctccatctc 43031



to top

>gb|AC110090.6| Mus musculus BAC clone RP23-27L4 from chromosome 1, complete sequence
          Length = 218518

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 65     tctctgtctgtctctccatctc 86
              ||||||||||||||||||||||
Sbjct: 178502 tctctgtctgtctctccatctc 178481



to top

>gb|AC157769.3| Mus musculus chromosome 1, clone RP24-314L7, complete sequence
          Length = 131045

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 65    tctctgtctgtctctccatctc 86
             ||||||||||||||||||||||
Sbjct: 49233 tctctgtctgtctctccatctc 49212



to top

>gb|AC105009.13| Homo sapiens chromosome 8, clone RP11-188K5, complete sequence
          Length = 175936

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 293    agaagcaaaacaatcagaggag 314
              ||||||||||||||||||||||
Sbjct: 156654 agaagcaaaacaatcagaggag 156675



to top

>gb|AC105235.7| Homo sapiens chromosome 8, clone CTD-2014D20, complete sequence
          Length = 121660

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 293   agaagcaaaacaatcagaggag 314
             ||||||||||||||||||||||
Sbjct: 53120 agaagcaaaacaatcagaggag 53099



to top

>gb|AC018445.21| Homo sapiens chromosome 18, clone RP11-196B3, complete sequence
          Length = 162265

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 65     tctctgtctgtctctccatctc 86
              ||||||||||||||||||||||
Sbjct: 138616 tctctgtctgtctctccatctc 138595



to top

>gb|AC110042.12| Mus musculus chromosome 1, clone RP23-278C6, complete sequence
          Length = 170602

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 65    tctctgtctgtctctccatctc 86
             ||||||||||||||||||||||
Sbjct: 47388 tctctgtctgtctctccatctc 47409



to top

>emb|CT030233.6| Mouse DNA sequence from clone RP24-103C16 on chromosome 14, complete
            sequence
          Length = 216332

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 65   tctctgtctgtctctccatctc 86
            ||||||||||||||||||||||
Sbjct: 7636 tctctgtctgtctctccatctc 7615



to top

>gb|AC166061.2| Mus musculus BAC clone RP23-177N16 from chromosome 14, complete sequence
          Length = 213071

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 65     tctctgtctgtctctccatctc 86
              ||||||||||||||||||||||
Sbjct: 138080 tctctgtctgtctctccatctc 138059



to top

>gb|AC165085.3| Mus musculus BAC clone RP23-222G22 from chromosome 6, complete sequence
          Length = 201337

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 281   catttttacatcagaagcaaaacaa 305
             |||||||||||||||| ||||||||
Sbjct: 81738 catttttacatcagaaacaaaacaa 81762



to top

>gb|AC132293.3| Mus musculus BAC clone RP24-322H1 from chromosome 1, complete sequence
          Length = 158294

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 65     tctctgtctgtctctccatctcact 89
              ||||||||| |||||||||||||||
Sbjct: 105847 tctctgtctctctctccatctcact 105871



to top

>gb|L23982.1|HUMCOL7A1X Homo sapiens collagen type VII (COL7A1) gene, promoter region and
             complete cds
          Length = 36631

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 65    tctctgtctgtctctccatct 85
             |||||||||||||||||||||
Sbjct: 33236 tctctgtctgtctctccatct 33256



to top

>gb|AC126459.3| Mus musculus BAC clone RP23-181A8 from chromosome 9, complete sequence
          Length = 217068

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 66     ctctgtctgtctctccatctc 86
              |||||||||||||||||||||
Sbjct: 100825 ctctgtctgtctctccatctc 100805



to top

>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence
          Length = 146757

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 65    tctctgtctgtctctccatct 85
             |||||||||||||||||||||
Sbjct: 38541 tctctgtctgtctctccatct 38561



to top

>gb|AC117623.7| Mus musculus chromosome 1, clone RP23-114L12, complete sequence
          Length = 211821

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 65     tctctgtctgtctctccatctcact 89
              ||||||||| |||||||||||||||
Sbjct: 198014 tctctgtctctctctccatctcact 198038



to top

>emb|AL365267.11| Human DNA sequence from clone RP11-789A7 on chromosome 6 Contains a
             LYPLA1 (lysophospholipase I) pseudogene, complete sequence
          Length = 49616

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 21    taaaccaccaccagcaacagc 41
             |||||||||||||||||||||
Sbjct: 11041 taaaccaccaccagcaacagc 11061



to top

>gb|AC023891.28| Homo sapiens 3 BAC RP13-81O8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 144189

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 16    gataataaaccaccaccagca 36
             |||||||||||||||||||||
Sbjct: 63530 gataataaaccaccaccagca 63550



to top

>gb|AC121252.4| Homo sapiens chromosome 3 clone RP11-148G20, complete sequence
          Length = 105166

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 65   tctctgtctgtctctccatct 85
            |||||||||||||||||||||
Sbjct: 4188 tctctgtctgtctctccatct 4168



to top

>emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chromosome 11 Contains two
             novel genes and the 3' end of the Accn1 gene for neuronal
             amiloride-sensitive cation channel 1 (degenerin), complete
             sequence
          Length = 114190

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 65    tctctgtctgtctctccatct 85
             |||||||||||||||||||||
Sbjct: 28551 tctctgtctgtctctccatct 28531



to top

>emb|BX927292.6| Zebrafish DNA sequence from clone CH211-197O22 in linkage group 19,
             complete sequence
          Length = 195006

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    tcagcatctctgtctgtctct 79
             |||||||||||||||||||||
Sbjct: 19350 tcagcatctctgtctgtctct 19370



to top

>gb|AC005903.5| Homo sapiens 3 PAC RP5-1034C16 (Roswell Park Cancer Institute Human PAC
             Library) complete sequence
          Length = 63949

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 65    tctctgtctgtctctccatct 85
             |||||||||||||||||||||
Sbjct: 47531 tctctgtctgtctctccatct 47511



to top

>gb|AC144921.12| Mus musculus chromosome 1, clone RP24-214P19, complete sequence
          Length = 188960

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 65    tctctgtctgtctctccatctcact 89
             ||||||||| |||||||||||||||
Sbjct: 19457 tctctgtctctctctccatctcact 19481



to top

>gb|AC149216.5| Mus musculus BAC clone RP24-194H8 from 18, complete sequence
          Length = 193186

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 65     tctctgtctgtctctccatct 85
              |||||||||||||||||||||
Sbjct: 110318 tctctgtctgtctctccatct 110298



to top

>emb|AL935196.10| Zebrafish DNA sequence from clone DKEYP-79F4 in linkage group 18,
             complete sequence
          Length = 105612

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 59    tcagcatctctgtctgtctct 79
             |||||||||||||||||||||
Sbjct: 77218 tcagcatctctgtctgtctct 77198



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     cggtccgttgttgtcgcggc 264
               ||||||||||||||||||||
Sbjct: 2914683 cggtccgttgttgtcgcggc 2914702



to top

>gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome 16, complete sequence
          Length = 207953

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 55966 tctgtctgtctctccatctc 55947



to top

>gb|AC167017.4| Mus musculus BAC clone RP24-86L13 from chromosome 9, complete sequence
          Length = 183068

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 65     tctctgtctgtctctccatc 84
              ||||||||||||||||||||
Sbjct: 165888 tctctgtctgtctctccatc 165907



to top

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 184980 tctgtctgtctctccatctc 184999



to top

>gb|AC091331.14| Mus musculus chromosome 1, clone RP23-293F4, complete sequence
          Length = 236163

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 524   aggggaagggagggaatggc 543
             ||||||||||||||||||||
Sbjct: 59462 aggggaagggagggaatggc 59443



to top

>gb|AC149610.1| Mus musculus BAC clone RP23-263D11 from chromosome 9, complete sequence
          Length = 187063

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 110533 tctgtctgtctctccatctc 110552



to top

>gb|AC147988.3| Mus musculus BAC clone RP24-459A9 from chromosome 18, complete sequence
          Length = 155208

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 126647 tctgtctgtctctccatctc 126628



to top

>gb|AC154442.3| Mus musculus BAC clone RP24-178L2 from chromosome 17, complete sequence
          Length = 177231

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 519   ttggcaggggaagggaggga 538
             ||||||||||||||||||||
Sbjct: 59431 ttggcaggggaagggaggga 59412



to top

>gb|AC166167.2| Mus musculus BAC clone RP23-211D22 from chromosome 13, complete sequence
          Length = 200448

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 188796 tctgtctgtctctccatctc 188777



to top

>gb|AC146897.5| Gorilla gorilla, clone XX-413A16, complete sequence
          Length = 188750

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 65     tctctgtctgtctctccatctcac 88
              ||||| ||||||||||||||||||
Sbjct: 182590 tctctctctgtctctccatctcac 182613



to top

>gb|AC125536.3| Mus musculus BAC clone RP24-142N21 from chromosome 8, complete sequence
          Length = 199356

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 140660 tctgtctgtctctccatctc 140679



to top

>gb|AC115117.5| Mus musculus BAC clone RP23-76J12 from chromosome 18, complete sequence
          Length = 197626

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 27026 tctgtctgtctctccatctc 27007



to top

>gb|AC117219.2| Mus musculus BAC clone RP23-344D18 from chromosome 9, complete
            sequence
          Length = 216199

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 67   tctgtctgtctctccatctc 86
            ||||||||||||||||||||
Sbjct: 6261 tctgtctgtctctccatctc 6280



to top

>gb|AC125040.4| Mus musculus BAC clone RP23-335C9 from chromosome 3, complete sequence
          Length = 203863

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 112908 tctgtctgtctctccatctc 112927



to top

>gb|AC098716.2| Mus musculus BAC clone RP23-2F19 from 9, complete sequence
          Length = 214654

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     tctctgtctgtctctccatc 84
              ||||||||||||||||||||
Sbjct: 178286 tctctgtctgtctctccatc 178267



to top

>emb|BX005422.5| Human DNA sequence from clone DASS-32K24 on chromosome 6, complete
             sequence
          Length = 97466

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 86241 ctgtctctccatctcactta 86222



to top

>emb|AL805913.4| Human DNA sequence from clone DAQB-22D21 on chromosome 6 Contains the
             3' end of the BRD2 gene for bromodomain containing 2, the
             HLA-DOA gene for the major histocompatibility complex,
             class II, DO alpha, the HLA-DPA1 gene for the major
             histocompatibility complex, class II, DP alpha 1, the
             RPL32P1 pseudogene for ribosomal protein L32 pseudogene 1,
             the 3' end of the HLA-DPB1 gene for the major
             histocompatibility complex, class II, DP beta 1 and 1 CpG
             isalnd, complete sequence
          Length = 106728

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 83392 ctgtctctccatctcactta 83373



to top

>emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chromosome 6 contains the
             HLA-DPA1 gene for major histocompatibility complex, class
             II, DP alpha 1, the HLA-DPB1 gene for major
             histocompatibility complex, class II, DP beta 1, a
             ribosomal protein L32 (RPL32) pseudogene, the HLA-DPA2
             pseudogene for major histocompatibility complex, class II,
             DP alpha 2, a pseudogene similar to part of collagens, a
             novel protein similar to major histocompatibility complex,
             class II, DP beta 2 (pseudogene), a major
             histocompatibility complex, class II, DP beta 1
             pseudogene, two putative novel transcripts, the COL11A2
             gene for collagen, type XI, alpha 2, the RXRB gene for
             retinoid X receptor, beta, the HKE4 gene for HLA-class II
             region expressed gene KE4, the 5' end of the HSD17B8 gene
             for hydroxysteroid (17-beta) dehydrogenase 8 and four CpG
             islands, complete sequence
          Length = 187964

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 40715 ctgtctctccatctcactta 40696



to top

>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains the
             HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major
             histocompatibility complex class II proteins DO alpha, DP
             alpha 1 and DP beta 1, the HLA-DPA2 major
             histocompatibility complex class II DP alpha 2 pseudogene,
             ribosomal protein L32 pseudogene RPL32P1, a pseudogene
             similar to part of collagens, the 5' end of an HLA class
             II histocompatibility antigen D or S beta pseudogene, the
             5' end of a novel protein similar to major
             histocompatibility complex class II DP beta 1 precursor
             and a CpG island, complete sequence
          Length = 124899

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 66425 ctgtctctccatctcactta 66406



to top

>emb|AL662889.5| Human DNA sequence from clone RP11-370K11 on chromosome 1 Contains a
              fatty acid binding protein, muscle and heart
              (mammary-derived growth inhibitor) pseudogene and part of
              the AKT3 gene for  v-akt murine thymoma viral oncogene
              homolog 3 (protein kinase B, gamma), complete sequence
          Length = 127036

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 103    tatttcaaaggcgaaccaaaacaa 126
              |||||||||||| |||||||||||
Sbjct: 114762 tatttcaaaggcaaaccaaaacaa 114785



to top

>emb|AL603824.4| Human DNA sequence from clone RP11-235G8 on chromosome 10 Contains part
             of the gene for cyclin fold protein 1 (CFP1) (CBCP1),
             complete sequence
          Length = 89871

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 74057 tctgtctgtctctccatctc 74038



to top

>emb|AL590553.8| Human DNA sequence from clone RP11-272G1 on chromosome 6, complete
             sequence
          Length = 171882

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   aaacttcagctatacaagac 156
             ||||||||||||||||||||
Sbjct: 98393 aaacttcagctatacaagac 98412



to top

>emb|AL139187.19| Human DNA sequence from clone RP11-81F11 on chromosome 13 Contains a gene
              for a novel protein similar to RhoGAP, complete sequence
          Length = 166329

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 65     tctctgtctgtctctccatc 84
              ||||||||||||||||||||
Sbjct: 138970 tctctgtctgtctctccatc 138989



to top

>emb|Z84483.1|HS46H23 Human DNA sequence from clone RP1-46H23 on chromosome 13. Contains the
             3' end of the KL gene for klotho, the 3' end of the gene
             for a novel RhoGAP domain protein, ESTs, STSs and GSSs,
             complete sequence
          Length = 129098

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    tctctgtctgtctctccatc 84
             ||||||||||||||||||||
Sbjct: 95257 tctctgtctgtctctccatc 95238



to top

>gb|AC164250.4| Mus musculus  BAC RP24-327O15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 221612

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 150050 tctgtctgtctctccatctc 150069



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1884690 tttttacatcagaagcaaaa 1884709



to top

>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete
             sequence
          Length = 119898

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 60862 ctgtctctccatctcactta 60843



to top

>emb|AL590629.16| Mouse DNA sequence from clone RP23-202F23 on chromosome X, complete
              sequence
          Length = 171883

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     cagcatctctgtctgtctct 79
              ||||||||||||||||||||
Sbjct: 155945 cagcatctctgtctgtctct 155926



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     cagcatctctgtctgtctct 79
              ||||||||||||||||||||
Sbjct: 146269 cagcatctctgtctgtctct 146250



to top

>emb|CR759829.6| Human DNA sequence from clone DADB-17J1 on chromosome 6, complete
             sequence
          Length = 93292

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 80641 ctgtctctccatctcactta 80622



to top

>emb|CR847849.5| Human DNA sequence from clone DAMA-245O6 on chromosome 6, complete
            sequence
          Length = 88163

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 72   ctgtctctccatctcactta 91
            ||||||||||||||||||||
Sbjct: 2513 ctgtctctccatctcactta 2494



to top

>emb|CR759904.5| Human DNA sequence from clone DAAP-277G18 on chromosome 6, complete
             sequence
          Length = 86480

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    ctgtctctccatctcactta 91
             ||||||||||||||||||||
Sbjct: 38906 ctgtctctccatctcactta 38887



to top

>gb|AC073548.5| Homo sapiens chromosome 19 clone RP11-43N16, complete sequence
          Length = 167722

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 63    catctctgtctgtctctccatctc 86
             ||||||| ||||||||||||||||
Sbjct: 68650 catctctctctgtctctccatctc 68673



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 63    catctctgtctgtctctccatctc 86
             ||||||| ||||||||||||||||
Sbjct: 68200 catctctctctgtctctccatctc 68223



to top

>emb|CR385029.5| Opossum DNA sequence from clone XX-191G11, complete sequence
          Length = 123110

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 63     catctctgtctgtctctccatctc 86
              ||||||||||| ||||||||||||
Sbjct: 119100 catctctgtctctctctccatctc 119077



to top

>gb|AC151665.26| Medicago truncatula clone mth2-7k4, complete sequence
          Length = 135880

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 64    atctctgtctgtctctccatctcactta 91
             |||||| ||| |||||||||||||||||
Sbjct: 52413 atctctctctctctctccatctcactta 52440



to top

>gb|AC174354.6| Medicago truncatula clone mth2-8m12, complete sequence
          Length = 122859

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 64    atctctgtctgtctctccatctcactta 91
             |||||| ||| |||||||||||||||||
Sbjct: 43744 atctctctctctctctccatctcactta 43771



to top

>gb|AC009729.14| Homo sapiens 12 BAC RP11-1K3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 167234

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 518   attggcaggggaagggaggg 537
             ||||||||||||||||||||
Sbjct: 23146 attggcaggggaagggaggg 23165



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1941436 tttttacatcagaagcaaaa 1941455



to top

>gb|AC090083.3| Homo sapiens chromosome 15, clone CTD-2311K11, complete sequence
          Length = 96253

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 75240 tctgtctgtctctccatctc 75259



to top

>gb|AC098850.2| Homo sapiens chromosome 17, clone RP11-92B11, complete sequence
          Length = 178965

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 65    tctctgtctgtctctccatctcac 88
             ||||| ||||||||||||||||||
Sbjct: 58519 tctctctctgtctctccatctcac 58496



to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1920018 tttttacatcagaagcaaaa 1920037



to top

>emb|BX548025.9| Zebrafish DNA sequence from clone DKEY-237J22 in linkage group 9,
             complete sequence
          Length = 134425

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   aacaaacttcagctatacaa 153
             ||||||||||||||||||||
Sbjct: 63243 aacaaacttcagctatacaa 63224



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1845887 tttttacatcagaagcaaaa 1845906



to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1942196 tttttacatcagaagcaaaa 1942215



to top

>gb|AC008536.7| Homo sapiens chromosome 5 clone CTC-487M23, complete sequence
          Length = 178056

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     ataataaaccaccaccagca 36
              ||||||||||||||||||||
Sbjct: 135379 ataataaaccaccaccagca 135360



to top

>dbj|AK044281.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930005G22 product:unclassifiable, full insert
           sequence
          Length = 1901

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 65  tctctgtctgtctctccatc 84
           ||||||||||||||||||||
Sbjct: 187 tctctgtctgtctctccatc 206



to top

>gb|AC148676.1| Macaca mulatta Major Histocompatibility Complex BAC MMU118H05, complete
              sequence
          Length = 155090

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     ctgtctctccatctcactta 91
              ||||||||||||||||||||
Sbjct: 117958 ctgtctctccatctcactta 117939



to top

>emb|CR378092.1| Pinus pinaster SSR, clone PPB2E01
          Length = 589

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  tctgtctctccatctcactt 90
           ||||||||||||||||||||
Sbjct: 216 tctgtctctccatctcactt 235



to top

>gb|U33915.1|CPU33915 Craterostigma plantagineum myb-related transcription factor Cpm10
            (cpm10) gene, complete cds
          Length = 3305

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 63   catctctgtctgtctctccatctc 86
            ||||||||||| ||||||||||||
Sbjct: 1327 catctctgtctctctctccatctc 1350



to top

>gb|AC131009.7| Homo sapiens 12 BAC RP11-417L19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 170327

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 64    atctctgtctgtctctccatctca 87
             ||||||||||||||||||| ||||
Sbjct: 73922 atctctgtctgtctctccaactca 73945



to top

>gb|AF271715.1|AF271715 Staphylococcus aureus serine protease spl operon, complete sequence
          Length = 6120

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 283  tttttacatcagaagcaaaa 302
            ||||||||||||||||||||
Sbjct: 2475 tttttacatcagaagcaaaa 2456



to top

>gb|AC011901.4| Homo sapiens BAC clone RP11-547P13 from 2, complete sequence
          Length = 201567

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 418    gtctcttgatgacagcatag 437
              ||||||||||||||||||||
Sbjct: 200967 gtctcttgatgacagcatag 200986



to top

>gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosome 16, complete sequence
          Length = 197884

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 123018 tctgtctgtctctccatctc 122999



to top

>gb|AC126352.6| Homo sapiens chromosome 17, clone CTD-2509K7, complete sequence
          Length = 211403

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 65     tctctgtctgtctctccatctcac 88
              ||||| ||||||||||||||||||
Sbjct: 184631 tctctctctgtctctccatctcac 184654



to top

>gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, complete sequence
          Length = 216264

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 89     ttaacaaggcacggtatttc 108
              ||||||||||||||||||||
Sbjct: 135490 ttaacaaggcacggtatttc 135471



to top

>gb|AC005036.1| Homo sapiens BAC clone RP11-364H22 from 2, complete sequence
          Length = 199684

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   tggcaggggaagggagggaa 539
             ||||||||||||||||||||
Sbjct: 37281 tggcaggggaagggagggaa 37300



to top

>gb|AC139714.1| Homo sapiens BAC clone RP11-484I7 from 2, complete sequence
          Length = 4170

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 418  gtctcttgatgacagcatag 437
            ||||||||||||||||||||
Sbjct: 1400 gtctcttgatgacagcatag 1419



to top

>gb|AC087738.13| Homo sapiens chromosome 15, clone RP11-365F16, complete sequence
          Length = 181511

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 41663 tctgtctgtctctccatctc 41682



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1905356 tttttacatcagaagcaaaa 1905375



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1863643 tttttacatcagaagcaaaa 1863662



to top

>gb|AC117735.8| Mus musculus chromosome 5, clone RP24-132L16, complete sequence
          Length = 183861

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 65    tctctgtctgtctctccatc 84
             ||||||||||||||||||||
Sbjct: 57931 tctctgtctgtctctccatc 57950



to top

>gb|AC154780.2| Mus musculus BAC clone RP24-462E4 from 13, complete sequence
          Length = 161998

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 84956 tctgtctgtctctccatctc 84975



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 63      catctctgtctgtctctccatctc 86
               ||||||| ||||||||||||||||
Sbjct: 1843648 catctctctctgtctctccatctc 1843671



to top

>emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ia
          Length = 1923819

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     tctctgtctgtctctccatc 84
              ||||||||||||||||||||
Sbjct: 993810 tctctgtctgtctctccatc 993791



to top

>gb|AF098950.1|AF098950 Homo sapiens COQ7 protein gene, promoter and partial cds
          Length = 1133

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 89  ttaacaaggcacggtatttc 108
           ||||||||||||||||||||
Sbjct: 792 ttaacaaggcacggtatttc 773



to top

>dbj|AP001979.7| Homo sapiens genomic DNA, chromosome 11 clone:RP11-259P6, complete
             sequence
          Length = 147533

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    catctctgtctgtctctccatctc 86
             ||||||||||| ||||||||||||
Sbjct: 31158 catctctgtctctctctccatctc 31135



to top

>gb|AC164973.4| Ornithorhynchus anatinus BAC clone OABb-265H16 from chromosome unknown,
             complete sequence
          Length = 129291

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    gcatctctgtctgtctctcc 81
             ||||||||||||||||||||
Sbjct: 48569 gcatctctgtctgtctctcc 48550



to top

>emb|AL929117.7| Mouse DNA sequence from clone RP23-442K5 on chromosome 2, complete
             sequence
          Length = 161940

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 54423 tctgtctgtctctccatctc 54404



to top

>gb|AC140231.3| Mus musculus BAC clone RP24-493L15 from 6, complete sequence
          Length = 185517

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     tctgtctgtctctccatctc 86
              ||||||||||||||||||||
Sbjct: 158311 tctgtctgtctctccatctc 158292



to top

>emb|CT033749.8| Mouse DNA sequence from clone RP23-14N10 on chromosome 17, complete
            sequence
          Length = 212052

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 519  ttggcaggggaagggaggga 538
            ||||||||||||||||||||
Sbjct: 1275 ttggcaggggaagggaggga 1256



to top

>gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, complete sequence
          Length = 225031

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    tctgtctgtctctccatctc 86
             ||||||||||||||||||||
Sbjct: 91159 tctgtctgtctctccatctc 91140



to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     tttttacatcagaagcaaaa 302
               ||||||||||||||||||||
Sbjct: 1817508 tttttacatcagaagcaaaa 1817527



to top

>gb|U60589.1|SAU60589 Staphylococcus aureus novel antigen gene, complete cds
          Length = 1022

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 tttttacatcagaagcaaaa 302
           ||||||||||||||||||||
Sbjct: 888 tttttacatcagaagcaaaa 869



to top

>emb|Z95437.1|HSA1 Human DNA sequence from clone XX-A1 on chromosome 6. Contains ESTs,
            GSSs and a CpG island, complete sequence
          Length = 18577

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 72   ctgtctctccatctcactta 91
            ||||||||||||||||||||
Sbjct: 2927 ctgtctctccatctcactta 2946



to top

>dbj|AB034443.1| Human immunodeficiency virus type 1 proviral gene for Tat protein
          exon 2 region, partial CDS, isolate:patient 6,
          clone:tat-2(6)-01
          Length = 91

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 63 catctctgtctgtctctccatctc 86
          ||||||||||| ||||||||||||
Sbjct: 76 catctctgtctctctctccatctc 53



to top

>dbj|AB034436.1| Human immunodeficiency virus type 1 proviral gene for Tat protein
          exon 2 region, partial CDS, isolate:patient 2,
          clone:tat-2(2)-01
          Length = 91

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 63 catctctgtctgtctctccatctc 86
          ||||||||||| ||||||||||||
Sbjct: 76 catctctgtctctctctccatctc 53



to top

>dbj|AB034387.1| Human immunodeficiency virus type 1 proviral gene for Rev protein
          exon 2 region, partial CDS, isolate:patient 6,
          clone:rev-2(6)-01
          Length = 275

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 63 catctctgtctgtctctccatctc 86
          ||||||||||| ||||||||||||
Sbjct: 76 catctctgtctctctctccatctc 53



to top

>dbj|AB034383.1| Human immunodeficiency virus type 1 proviral gene for Rev protein
          exon 2 region, partial CDS, isolate:patient 2,
          clone:rev-2(2)-01
          Length = 275

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 63 catctctgtctgtctctccatctc 86
          ||||||||||| ||||||||||||
Sbjct: 76 catctctgtctctctctccatctc 53


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,267,967
Number of Sequences: 3902068
Number of extensions: 5267967
Number of successful extensions: 142084
Number of sequences better than 10.0: 109
Number of HSP's better than 10.0 without gapping: 109
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 141531
Number of HSP's gapped (non-prelim): 543
length of query: 553
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 530
effective length of database: 17,143,297,704
effective search space: 9085947783120
effective search space used: 9085947783120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top