>gb|AC093346.7| Mus musculus chromosome 5, clone RP23-15K13, complete sequence
          Length = 211278

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     cccatctgaaggaaaactaa 24
             ||||||||||||||||||||
Sbjct: 69560 cccatctgaaggaaaactaa 69541

>gb|AC158379.5| Mus musculus BAC clone RP24-497L12 from chromosome 5, complete sequence
          Length = 209526

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      cccatctgaaggaaaactaa 24
              ||||||||||||||||||||
Sbjct: 161585 cccatctgaaggaaaactaa 161566

>gb|AF267747.1|AF267747 Mus musculus p47-phox gene, complete cds
          Length = 180686

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     cccatctgaaggaaaactaa 24
             ||||||||||||||||||||
Sbjct: 67151 cccatctgaaggaaaactaa 67132

>gb|AC073651.23| Homo sapiens 12 BAC RP11-6B19 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 165565

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 11   tgaaggaaaactaaactat 29
            |||||||||||||||||||
Sbjct: 2797 tgaaggaaaactaaactat 2815

>gb|AC025656.7| Homo sapiens chromosome 18, clone RP11-36L19, complete sequence
          Length = 193351

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      catctgaaggaaaactaaa 25
              |||||||||||||||||||
Sbjct: 119094 catctgaaggaaaactaaa 119076

>gb|AC154622.2| Mus musculus BAC clone RP23-325D11 from chromosome 16, complete
             sequence
          Length = 189631

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     gagcccatctgaaggaaaa 20
             |||||||||||||||||||
Sbjct: 78411 gagcccatctgaaggaaaa 78429

>emb|BX927255.9| Zebrafish DNA sequence from clone CH211-266I18 in linkage group 20,
             complete sequence
          Length = 155519

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    ctgaaggaaaactaaacta 28
             |||||||||||||||||||
Sbjct: 18370 ctgaaggaaaactaaacta 18352

>emb|CT025586.10| Mouse DNA sequence from clone RP23-433J21 on chromosome 16, complete
             sequence
          Length = 190365

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     gagcccatctgaaggaaaa 20
             |||||||||||||||||||
Sbjct: 82527 gagcccatctgaaggaaaa 82509

>emb|AL928794.4| Mouse DNA sequence from clone RP23-51H24 on chromosome 2, complete
             sequence
          Length = 50262

 Score = 38.2 bits (19), Expect = 6.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    gaaggaaaactaaactatc 30
             |||||||||||||||||||
Sbjct: 40847 gaaggaaaactaaactatc 40865


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 457,348
Number of Sequences: 3902068
Number of extensions: 457348
Number of successful extensions: 39058
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39045
Number of HSP's gapped (non-prelim): 13
length of query: 130
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 109
effective length of database: 17,151,101,840
effective search space: 1869470100560
effective search space used: 1869470100560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)