ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd20l18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB058923.1| Hordeum vulgare mRNA for protein kinase HvPKABA1... 1146 0.0
2dbj|AB058924.1| Hordeum vulgare gene for protein kinase HvPKABA1... 934 0.0
3gb|M94726.1|M94726 Triticum aestivum protein kinase mRNA, partia... 605 e-170
4gb|U29095.1|U29095 Triticum aestivum serine-threonine protein ki... 422 e-115
5ref|XM_470803.1| Oryza sativa (japonica cultivar-group), mRNA 254 3e-64
6dbj|AB125302.1| Oryza sativa (japonica cultivar-group) SAPK1 mRN... 254 3e-64
7dbj|AK068899.1| Oryza sativa (japonica cultivar-group) cDNA clon... 254 3e-64
8dbj|AK060856.1| Oryza sativa (japonica cultivar-group) cDNA clon... 254 3e-64
9gb|AY108950.1| Zea mays PCO069505 mRNA sequence 186 6e-44
10gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence 172 8e-40
11gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 161 3e-36
12gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom... 161 3e-36
13dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
14ref|NM_189878.2| Oryza sativa (japonica cultivar-group), mRNA 117 4e-23
15ref|XM_506481.1| PREDICTED Oryza sativa (japonica cultivar-group... 117 4e-23
16gb|AY207043.1| Oryza sativa (indica cultivar-group) abcisic acid... 117 4e-23
17dbj|AB125303.1| Oryza sativa (japonica cultivar-group) sapk2 mRN... 117 4e-23
18dbj|AK103945.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-23
19dbj|AK070965.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-23
20gb|AY714526.1| Aegilops tauschii protein kinase 1 mRNA, complete... 88 4e-14
21dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
22dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
23gb|AY107474.1| Zea mays PCO105841 mRNA sequence 76 1e-10
24gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence 42 2.1
25gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence 42 2.1
26gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, r... 42 2.1
27gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, r... 42 2.1
28gb|AC154430.3| Mus musculus BAC clone RP24-208K8 from chromosome... 42 2.1
29gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70... 42 2.1
30gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome... 40 8.1
31gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, co... 40 8.1
32ref|NM_019576.1| Mus musculus thrombospondin, type I, domain 1 (... 40 8.1
33gb|AC139553.5| Mus musculus chromosome 19, clone RP24-386E18, co... 40 8.1
34gb|AC123941.3| Mus musculus BAC clone RP23-458G24 from chromosom... 40 8.1
35gb|BC051957.1| Mus musculus thrombospondin, type I, domain 1, mR... 40 8.1
36gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosom... 40 8.1
37ref|XM_765844.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 8.1
38gb|AY316305.1| Homo sapiens glutathione transferase zeta 1 (male... 40 8.1
39dbj|AK094344.1| Homo sapiens cDNA FLJ37025 fis, clone BRACE20108... 40 8.1
40gb|AC148755.6| Medicago truncatula clone mth2-24n16, complete se... 40 8.1
41gb|AC090282.6| Homo sapiens chromosome 17, clone CTD-2309O5, com... 40 8.1
42dbj|AK052555.1| Mus musculus 13 days embryo stomach cDNA, RIKEN ... 40 8.1
43emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on ch... 40 8.1
44dbj|AK049636.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 40 8.1
45dbj|AK014758.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 40 8.1
46dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
47dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
48dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
49dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 8.1
50gb|AC007954.7|AC007954 Homo sapiens chromosome 14 clone RP11-493... 40 8.1
51gb|AF053543.1|HSGSTZ1G5 Homo sapiens glutathione transferase zet... 40 8.1
52gb|AF116597.1|AF116597 Metarhizium anisopliae cAMP-dependent pro... 40 8.1
53gb|AC108421.8| Mus musculus chromosome 19, clone RP23-433N7, com... 40 8.1
54emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4,... 40 8.1
55dbj|AB039946.1| Mus musculus TMTSP mRNA for transmembrane molecu... 40 8.1

>dbj|AB058923.1| Hordeum vulgare mRNA for protein kinase HvPKABA1, complete cds,
            cultivar:Himalaya
          Length = 1329

 Score = 1146 bits (578), Expect = 0.0
 Identities = 586/589 (99%)
 Strand = Plus / Minus

                                                                        
Query: 9    cttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttctacacggca 68
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1329 cttaactagtgatttcgatattcgcatgtaaacttgtctcgtactggtttctacacggca 1270

                                                                        
Query: 69   aggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaagcacgacaa 128
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1269 aggccgatctgtgcagcacacagaaaatatgtgatccggaagaaaatcgaagcacgacaa 1210

                                                                        
Query: 129  acagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacgg 188
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1209 acagggatccatccacagctaaaccaccaagaacttctaaacccatcagcatcacaacgg 1150

                                                                        
Query: 189  gcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgtc 248
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1149 gcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatcaatgtcgtc 1090

                                                                        
Query: 249  tagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccgg 308
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1089 tagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgttatgacccgg 1030

                                                                        
Query: 309  tttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcat 368
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1029 tttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcat 970

                                                                        
Query: 369  gtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgag 428
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 969  gtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgag 910

                                                                        
Query: 429  gaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttccaacgaa 488
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 909  gaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttccaacgaa 850

                                                                        
Query: 489  aatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacggagta 548
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 849  aatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacggagta 790

                                                             
Query: 549  ctgtacgctgagtatccttgcgatcgttttgcggaagttnctcggctca 597
            ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 789  ctgtacgctgagtatccttgcgatcgttttgcggaagttcctcggctca 741



to top

>dbj|AB058924.1| Hordeum vulgare gene for protein kinase HvPKABA1, complete cds,
             cultivar:Igri
          Length = 11684

 Score =  934 bits (471), Expect = 0.0
 Identities = 471/471 (100%)
 Strand = Plus / Minus

                                                                         
Query: 1     gagtattccttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttct 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10950 gagtattccttaactagtgatttcgatattcgcatgtaaacttgtctcatactggtttct 10891

                                                                         
Query: 61    acacggcaaggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaag 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10890 acacggcaaggccgatctgtgcagcccacagaaaatatgtgatccggaagaaaatcgaag 10831

                                                                         
Query: 121   cacgacaaacagggatccatccacagctaaaccaccaagaacttctaaacccatcagcat 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10830 cacgacaaacagggatccatccacagctaaaccaccaagaacttctaaacccatcagcat 10771

                                                                         
Query: 181   cacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatca 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10770 cacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatca 10711

                                                                         
Query: 241   atgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgtta 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10710 atgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgtta 10651

                                                                         
Query: 301   tgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggc 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10650 tgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggc 10591

                                                                         
Query: 361   gtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcagg 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10590 gtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcagg 10531

                                                                
Query: 421   cgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 471
             |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10530 cgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 10480



 Score =  196 bits (99), Expect = 6e-47
 Identities = 99/99 (100%)
 Strand = Plus / Minus

                                                                         
Query: 468   ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10292 ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 10233

                                                    
Query: 528   aacgtagtccggaacggagtactgtacgctgagtatcct 566
             |||||||||||||||||||||||||||||||||||||||
Sbjct: 10232 aacgtagtccggaacggagtactgtacgctgagtatcct 10194



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                            
Query: 567   tgcgatcgttttgcggaagttnctcggctca 597
             ||||||||||||||||||||| |||||||||
Sbjct: 10087 tgcgatcgttttgcggaagttcctcggctca 10057



to top

>gb|M94726.1|M94726 Triticum aestivum protein kinase mRNA, partial cds
          Length = 1210

 Score =  605 bits (305), Expect = e-170
 Identities = 436/477 (91%), Gaps = 6/477 (1%)
 Strand = Plus / Minus

                                                                        
Query: 127  aaacagggatccatccacagctaaaccaccaaga--acttctaaacc---catcagca-t 180
            ||||||||||||||||||||  |||||| |||||  |||| | ||||   ||| |||| |
Sbjct: 1058 aaacagggatccatccacaggcaaaccatcaagagaacttttgaaccactcatgagcaat 999

                                                                        
Query: 181  cacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaatca 240
            ||||||||||||||||| ||||||||| |||||| ||||||||||||||  |||||||| 
Sbjct: 998  cacaacgggcacacgaaatccccgctgctctcaacgtcaatgtcgtcgatatcgaaatcg 939

                                                                        
Query: 241  atgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagccctagggcgtta 300
            |||||||| | |||||||||||||||||||||||||||||| |||| |||||||||||||
Sbjct: 938  atgtcgtccaaatccatgctccccaggcaggcaacctgcccggcaacccctagggcgtta 879

                                                                        
Query: 301  tgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggc 360
            |  || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 878  tcgccaggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgtgacggc 819

                                                                        
Query: 361  gtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcagg 420
            |||||||||||||||| |||||||| |||||||||||| || ||||||||||||||||  
Sbjct: 818  gtgttcatgtctgccagctgcatgctcctttggtactcatcggtcatctcaacgggcaat 759

                                                                        
Query: 421  cgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggattt 480
            |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 758  ctcttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggattt 699

                                                                        
Query: 481  ccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccgga 540
            |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 698  ccaacgaaaatgcgggacagtagatgtatgcagtccatcgagactcgaacgtagtccgga 639

                                                                     
Query: 541  acggagtactgtacgctgagtatccttgcgatcgttttgcggaagttnctcggctca 597
            || ||||||||||||||||||||||| | |||||||||||||||||| || ||||||
Sbjct: 638  acagagtactgtacgctgagtatcctagtgatcgttttgcggaagttccttggctca 582



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 12   aactagtgatttcgatattcgcatgtaaactt 43
            ||||| ||||||||||||  ||||||||||||
Sbjct: 1173 aactactgatttcgatataagcatgtaaactt 1142



to top

>gb|U29095.1|U29095 Triticum aestivum serine-threonine protein kinase (TaPK3) gene, exons
            3 through 9 and complete cds
          Length = 2250

 Score =  422 bits (213), Expect = e-115
 Identities = 279/299 (93%), Gaps = 4/299 (1%)
 Strand = Plus / Minus

                                                                        
Query: 176  agcatcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcga---cgt 232
            |||||||||||||||||||||| ||||||||||||||||| || ||||||||||   |||
Sbjct: 1961 agcatcacaacgggcacacgaaatccccgctgttctcaat-tcgatgtcgtcgatgtcgt 1903

                                                                        
Query: 233  cgaaatcaatgtcgtctagatccatgctccccaggcaggcaacctgcccagcaagcccta 292
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 1902 cgaaatcaatgtcatctagatccatgctccccaggcaggcaacctgcccagcaattccta 1843

                                                                        
Query: 293  gggcgttatgacccggtttctgcgcctcctggatgatcgccatggcttcttccaggctct 352
            ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||| |||||
Sbjct: 1842 gggcgttatcacccggtttctgtgcctcgtggatgatcgccatggcttcttccatgctct 1783

                                                                        
Query: 353  gcgacggcgtgttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaa 412
            | ||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||
Sbjct: 1782 gtgacggcgtgttcatgtctgccaactgcatgctcctttggtactcatcggtcatctcaa 1723

                                                                       
Query: 413  cgggcaggcgtttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 471
            |||||||  |||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1722 cgggcagttgtttgaggaaccatggatggttcttgatctccggcatggttattcgctgc 1664



 Score =  157 bits (79), Expect = 5e-35
 Identities = 94/99 (94%)
 Strand = Plus / Minus

                                                                        
Query: 468  ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
            ||||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||||||
Sbjct: 1597 ctgctgaggatttccaatgaaaatgcgggacagcaaatgcatgcagtccatcgagactcg 1538

                                                   
Query: 528  aacgtagtccggaacggagtactgtacgctgagtatcct 566
            ||||||||||||||| |||||||||||||||||||||||
Sbjct: 1537 aacgtagtccggaacagagtactgtacgctgagtatcct 1499



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 56/65 (86%), Gaps = 6/65 (9%)
 Strand = Plus / Minus

                                                                        
Query: 88   acagaaaatatgtgatccggaagaaaatcgaa-----gcacgacaaa-cagggatccatc 141
            |||||||||||||||||| |||||||||| ||     ||| |||||| ||||||||||||
Sbjct: 2060 acagaaaatatgtgatccagaagaaaatccaacccaagcatgacaaaacagggatccatc 2001

                 
Query: 142  cacag 146
            |||||
Sbjct: 2000 cacag 1996



to top

>ref|XM_470803.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1468

 Score =  254 bits (128), Expect = 3e-64
 Identities = 245/284 (86%)
 Strand = Plus / Minus

                                                                        
Query: 304  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1112 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1053

                                                                        
Query: 364  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1052 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 993

                                                                        
Query: 424  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 483
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 992  ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 933

                                                                        
Query: 484  acgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacg 543
            |||||||| |||||||| |||||| |||| |||   || |||||||||||||| ||||  
Sbjct: 932  acgaaaatccgggacaggagatgtctgcagtccgctgaaactcgaacgtagtctggaatt 873

                                                        
Query: 544  gagtactgtacgctgagtatccttgcgatcgttttgcggaagtt 587
            || |||||||| ||||||||||| | |||||| |||||||||||
Sbjct: 872  gaatactgtacactgagtatcctagtgatcgtcttgcggaagtt 829



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 179  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1237 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1181

                                                       
Query: 239  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1180 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1138



to top

>dbj|AB125302.1| Oryza sativa (japonica cultivar-group) SAPK1 mRNA for
            serine/threonine protein kinase SAPK1, complete cds
          Length = 1471

 Score =  254 bits (128), Expect = 3e-64
 Identities = 245/284 (86%)
 Strand = Plus / Minus

                                                                        
Query: 304  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1141 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1082

                                                                        
Query: 364  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1081 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 1022

                                                                        
Query: 424  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 483
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 1021 ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 962

                                                                        
Query: 484  acgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacg 543
            |||||||| |||||||| |||||| |||| |||   || |||||||||||||| ||||  
Sbjct: 961  acgaaaatccgggacaggagatgtctgcagtccgctgaaactcgaacgtagtctggaatt 902

                                                        
Query: 544  gagtactgtacgctgagtatccttgcgatcgttttgcggaagtt 587
            || |||||||| ||||||||||| | |||||| |||||||||||
Sbjct: 901  gaatactgtacactgagtatcctagtgatcgtcttgcggaagtt 858



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 179  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1266 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1210

                                                       
Query: 239  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1209 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1167



to top

>dbj|AK068899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G01, full
            insert sequence
          Length = 1674

 Score =  254 bits (128), Expect = 3e-64
 Identities = 245/284 (86%)
 Strand = Plus / Minus

                                                                        
Query: 304  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1122 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1063

                                                                        
Query: 364  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1062 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 1003

                                                                        
Query: 424  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 483
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 1002 ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 943

                                                                        
Query: 484  acgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacg 543
            |||||||| |||||||| |||||| |||| |||   || |||||||||||||| ||||  
Sbjct: 942  acgaaaatccgggacaggagatgtctgcagtccgctgaaactcgaacgtagtctggaatt 883

                                                        
Query: 544  gagtactgtacgctgagtatccttgcgatcgttttgcggaagtt 587
            || |||||||| ||||||||||| | |||||| |||||||||||
Sbjct: 882  gaatactgtacactgagtatcctagtgatcgtcttgcggaagtt 839



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 179  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1247 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1191

                                                       
Query: 239  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1190 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1148



to top

>dbj|AK060856.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-F03, full
            insert sequence
          Length = 1390

 Score =  254 bits (128), Expect = 3e-64
 Identities = 245/284 (86%)
 Strand = Plus / Minus

                                                                        
Query: 304  cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
            ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 1079 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 1020

                                                                        
Query: 364  ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
            |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 1019 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 960

                                                                        
Query: 424  ttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcca 483
            || ||||||||||| |||||||||||||| ||||| ||||| | ||||| ||||||||||
Sbjct: 959  ttcaggaaccatgggtggttcttgatctctgggatagttatcctctgctcaggatttcca 900

                                                                        
Query: 484  acgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacg 543
            |||||||| |||||||| |||||| |||| |||   || |||||||||||||| ||||  
Sbjct: 899  acgaaaatccgggacaggagatgtctgcagtccgctgaaactcgaacgtagtctggaatt 840

                                                        
Query: 544  gagtactgtacgctgagtatccttgcgatcgttttgcggaagtt 587
            || |||||||| ||||||||||| | |||||| |||||||||||
Sbjct: 839  gaatactgtacactgagtatcctagtgatcgtcttgcggaagtt 796



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                        
Query: 179  atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
            ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 1204 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 1148

                                                       
Query: 239  caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
            | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 1147 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 1105



to top

>gb|AY108950.1| Zea mays PCO069505 mRNA sequence
          Length = 1328

 Score =  186 bits (94), Expect = 6e-44
 Identities = 229/274 (83%)
 Strand = Plus / Minus

                                                                        
Query: 314  gcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtgttcatgtctg 373
            ||||||||||||||||||||||  | || |||||||| |||  ||| |||||||||||||
Sbjct: 1028 gcgcctcctggatgatcgccatcacctcctccaggctttgccccggggtgttcatgtctg 969

                                                                        
Query: 374  ccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgtttgaggaacc 433
            |||||||||||| |   ||||||||||| |||||||| | ||||||    ||||||||||
Sbjct: 968  ccaactgcatgctctgctggtactcgtcggtcatctcgatgggcagattcttgaggaacc 909

                                                                        
Query: 434  atggatggttcttgatctccgggatggttattcgctgctgaggatttccaacgaaaatgc 493
            | || || ||||||||||| || |||||||||| ||||| |||||||||||| || || |
Sbjct: 908  acgggtgcttcttgatctcaggaatggttattctctgctcaggatttccaacaaatatcc 849

                                                                        
Query: 494  gggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaacggagtactgta 553
            | ||||||||||||  ||| ||||| |  || ||||||||||| ||||  ||||||||||
Sbjct: 848  gagacagcagatgtccgcactccattgtaacgcgaacgtagtctggaattgagtactgta 789

                                              
Query: 554  cgctgagtatccttgcgatcgttttgcggaagtt 587
            | |||||||| || | |||||| |||||||||||
Sbjct: 788  cactgagtattctcgtgatcgtcttgcggaagtt 755



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 71/82 (86%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                        
Query: 193  acgaagtccccgctgttctcaatgtcaatgtcgtcga---cgtcgaaatcaatgtcgtct 249
            |||||||| |||||||||||| |||| |||||||| |   |||| |||||||||||||| 
Sbjct: 1149 acgaagtcgccgctgttctcagtgtcgatgtcgtcaatatcgtcaaaatcaatgtcgtca 1090

                                  
Query: 250  agatccatgctccccaggcagg 271
            || |||| ||||||||||||||
Sbjct: 1089 aggtccacgctccccaggcagg 1068



to top

>gb|DQ295068.1| Secale cereale PKABA1 gene, partial sequence
          Length = 1082

 Score =  172 bits (87), Expect = 8e-40
 Identities = 96/99 (96%)
 Strand = Plus / Minus

                                                                       
Query: 468 ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 884 ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatggagactcg 825

                                                  
Query: 528 aacgtagtccggaacggagtactgtacgctgagtatcct 566
           |||||||||||||| |||||||||||| |||||||||||
Sbjct: 824 aacgtagtccggaatggagtactgtacactgagtatcct 786



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 439  tggttcttgatctccgggatggttattcgctgc 471
            |||||||||||||||||||||||||||||||||
Sbjct: 1078 tggttcttgatctccgggatggttattcgctgc 1046



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Plus

                                                                            
Query: 304      cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
                ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 15466845 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 15466904

                                                                            
Query: 364      ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
                |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 15466905 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 15466964

                                                         
Query: 424      ttgaggaaccatggatggttcttgatctccgggatggttat 464
                || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 15466965 ttcaggaaccatgggtggttcttgatctctgggatagttat 15467005



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                            
Query: 179      atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
                ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 15466720 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 15466776

                                                           
Query: 239      caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
                | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 15466777 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 15466819



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                            
Query: 468      ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
                ||||| |||||||||||||||||| |||||||| |||||| |||| |||   || |||||
Sbjct: 15467132 ctgctcaggatttccaacgaaaatccgggacaggagatgtctgcagtccgctgaaactcg 15467191

                                                       
Query: 528      aacgtagtccggaacggagtactgtacgctgagtatcct 566
                ||||||||| ||||  || |||||||| |||||||||||
Sbjct: 15467192 aacgtagtctggaattgaatactgtacactgagtatcct 15467230



to top

>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete
             sequence
          Length = 164705

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Minus

                                                                         
Query: 304   cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
             ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 34681 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 34622

                                                                         
Query: 364   ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
             |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 34621 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 34562

                                                      
Query: 424   ttgaggaaccatggatggttcttgatctccgggatggttat 464
             || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 34561 ttcaggaaccatgggtggttcttgatctctgggatagttat 34521



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Minus

                                                                         
Query: 179   atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
             ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 34806 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 34750

                                                        
Query: 239   caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
             | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 34749 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 34707



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                         
Query: 468   ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
             ||||| |||||||||||||||||| |||||||| |||||| |||| |||   || |||||
Sbjct: 34394 ctgctcaggatttccaacgaaaatccgggacaggagatgtctgcagtccgctgaaactcg 34335

                                                    
Query: 528   aacgtagtccggaacggagtactgtacgctgagtatcct 566
             ||||||||| ||||  || |||||||| |||||||||||
Sbjct: 34334 aacgtagtctggaattgaatactgtacactgagtatcct 34296



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  161 bits (81), Expect = 3e-36
 Identities = 141/161 (87%)
 Strand = Plus / Plus

                                                                            
Query: 304      cccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgtg 363
                ||||||||| | |||||||| |||||||||||| | || |||||||||||||||||||||
Sbjct: 15461379 cccggtttccgggcctcctgaatgatcgccatgacctcctccaggctctgcgacggcgtg 15461438

                                                                            
Query: 364      ttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcgt 423
                |||||||| |||| |||||||| ||| ||||||||||| |||||||| | |||||||   
Sbjct: 15461439 ttcatgtccgccagctgcatgctcctctggtactcgtcggtcatctcgatgggcaggttc 15461498

                                                         
Query: 424      ttgaggaaccatggatggttcttgatctccgggatggttat 464
                || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 15461499 ttcaggaaccatgggtggttcttgatctctgggatagttat 15461539



 Score =  113 bits (57), Expect = 7e-22
 Identities = 92/103 (89%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                            
Query: 179      atcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcgacgtcgaaat 238
                ||||||| | |||||||||||||||||||||||| ||||||||||||||||  |||   |
Sbjct: 15461254 atcacaaggcgcacacgaagtccccgctgttctcgatgtcaatgtcgtcgatatcg---t 15461310

                                                           
Query: 239      caatgtcgtctagatccatgctccccaggcaggcaacctgccc 281
                | |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 15461311 cgatgtcgtcgagatccatgctccccaggcaggcgacctgccc 15461353



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                            
Query: 468      ctgctgaggatttccaacgaaaatgcgggacagcagatgtatgcaatccatcgagactcg 527
                ||||| |||||||||||||||||| |||||||| |||||| |||| |||   || |||||
Sbjct: 15461666 ctgctcaggatttccaacgaaaatccgggacaggagatgtctgcagtccgctgaaactcg 15461725

                                                       
Query: 528      aacgtagtccggaacggagtactgtacgctgagtatcct 566
                ||||||||| ||||  || |||||||| |||||||||||
Sbjct: 15461726 aacgtagtctggaattgaatactgtacactgagtatcct 15461764



to top

>ref|NM_189878.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1398

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                        
Query: 303  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1128 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1069

                                                                        
Query: 363  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1068 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1009

                                                                        
Query: 423  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1008 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 949

                                                                        
Query: 483  aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
             |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 948  cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 889

                                   
Query: 543  ggagtactgtacgctgagtatcc 565
               ||| |||||||| |||||||
Sbjct: 888  catgtattgtacgcttagtatcc 866



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1242 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1194



to top

>ref|XM_506481.1| PREDICTED Oryza sativa (japonica cultivar-group), P0594D10.134 mRNA
          Length = 1414

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                        
Query: 303  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1130 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1071

                                                                        
Query: 363  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1070 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1011

                                                                        
Query: 423  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1010 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 951

                                                                        
Query: 483  aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
             |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 950  cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 891

                                   
Query: 543  ggagtactgtacgctgagtatcc 565
               ||| |||||||| |||||||
Sbjct: 890  catgtattgtacgcttagtatcc 868



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1244 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1196



to top

>gb|AY207043.1| Oryza sativa (indica cultivar-group) abcisic acid-inducible protein
           kinanase mRNA, partial cds
          Length = 1089

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                       
Query: 303 acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
           |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 949 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 890

                                                                       
Query: 363 gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
           ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 889 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 830

                                                                       
Query: 423 tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
            |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 829 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 770

                                                                       
Query: 483 aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
            |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 769 cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 710

                                  
Query: 543 ggagtactgtacgctgagtatcc 565
              ||| |||||||| |||||||
Sbjct: 709 catgtattgtacgcttagtatcc 687



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1063 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1015



to top

>dbj|AB125303.1| Oryza sativa (japonica cultivar-group) sapk2 mRNA for
            serine/threonine protein kinase SAPK2, complete cds
          Length = 1401

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                        
Query: 303  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1131 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1072

                                                                        
Query: 363  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1071 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1012

                                                                        
Query: 423  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1011 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 952

                                                                        
Query: 483  aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
             |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 951  cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 892

                                   
Query: 543  ggagtactgtacgctgagtatcc 565
               ||| |||||||| |||||||
Sbjct: 891  catgtattgtacgcttagtatcc 869



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1245 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1197



to top

>dbj|AK103945.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A05, full
            insert sequence
          Length = 1397

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                        
Query: 303  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1127 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1068

                                                                        
Query: 363  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1067 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1008

                                                                        
Query: 423  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1007 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 948

                                                                        
Query: 483  aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
             |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 947  cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 888

                                   
Query: 543  ggagtactgtacgctgagtatcc 565
               ||| |||||||| |||||||
Sbjct: 887  catgtattgtacgcttagtatcc 865



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1241 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1193



to top

>dbj|AK070965.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023068H23, full
            insert sequence
          Length = 1414

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Minus

                                                                        
Query: 303  acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
            |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 1130 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 1071

                                                                        
Query: 363  gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
            ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 1070 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 1011

                                                                        
Query: 423  tttgaggaaccatggatggttcttgatctccgggatggttattcgctgctgaggatttcc 482
             |||||||||||||| |||||||||||||| || ||||| ||||| ||||  || ||| |
Sbjct: 1010 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgttgctctgggtttgc 951

                                                                        
Query: 483  aacgaaaatgcgggacagcagatgtatgcaatccatcgagactcgaacgtagtccggaac 542
             |||||||| |||||||| |||||| |||| |||||||| |||||||| || || |||||
Sbjct: 950  cacgaaaatccgggacagaagatgtctgcattccatcgaaactcgaacataatcaggaac 891

                                   
Query: 543  ggagtactgtacgctgagtatcc 565
               ||| |||||||| |||||||
Sbjct: 890  catgtattgtacgcttagtatcc 868



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 180  tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
            |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 1244 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 1196



to top

>gb|AY714526.1| Aegilops tauschii protein kinase 1 mRNA, complete cds
          Length = 1438

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 143/176 (81%)
 Strand = Plus / Minus

                                                                        
Query: 391  tggtactcgtctgtcatctcaacgggcaggcgtttgaggaaccatggatggttcttgatc 450
            ||||||||||| |||||||| |  |||||    ||||||||||| || ||||||||||||
Sbjct: 1036 tggtactcgtcggtcatctcgatcggcagattcttgaggaaccacgggtggttcttgatc 977

                                                                        
Query: 451  tccgggatggttattcgctgctgaggatttccaacgaaaatgcgggacagcagatgtatg 510
            ||  ||||||||||||| |||| ||| ||| | |||||||| |||||||||| |||| ||
Sbjct: 976  tcttggatggttattcgttgctcagggtttgccacgaaaatccgggacagcaaatgtctg 917

                                                                    
Query: 511  caatccatcgagactcgaacgtagtccggaacggagtactgtacgctgagtatcct 566
            || ||||| || |  || || || || || || ||||| ||||| |||||||||||
Sbjct: 916  cactccattgaaatccggacataatcaggtactgagtattgtacactgagtatcct 861



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 304  cccggtttctgcgcctcctggatgatcgccatg 336
            |||||| || |||||||||||||||| ||||||
Sbjct: 1123 cccggtatccgcgcctcctggatgatggccatg 1091



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 137/169 (81%)
 Strand = Plus / Minus

                                                                            
Query: 303      acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
                |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 25668145 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 25668086

                                                                            
Query: 363      gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
                ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 25668085 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 25668026

                                                                 
Query: 423      tttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 471
                 |||||||||||||| |||||||||||||| || ||||| |||||||||
Sbjct: 25668025 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgctgc 25667977



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                 
Query: 180      tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
                |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 25668259 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 25668211



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0594D10
          Length = 143200

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 137/169 (81%)
 Strand = Plus / Minus

                                                                          
Query: 303    acccggtttctgcgcctcctggatgatcgccatggcttcttccaggctctgcgacggcgt 362
              |||||| ||| |||||||||| ||||| ||||||   || ||||||| ||| ||||| ||
Sbjct: 122118 acccggcttccgcgcctcctgtatgatggccatgatctcctccaggccctgtgacggggt 122059

                                                                          
Query: 363    gttcatgtctgccaactgcatgcccctttggtactcgtctgtcatctcaacgggcaggcg 422
              ||| |||||   || ||| | || | | ||||||||||| |||||||| |  ||||||  
Sbjct: 122058 gttgatgtcgttcatctggacgctcatctggtactcgtcagtcatctcgatcggcaggtt 121999

                                                               
Query: 423    tttgaggaaccatggatggttcttgatctccgggatggttattcgctgc 471
               |||||||||||||| |||||||||||||| || ||||| |||||||||
Sbjct: 121998 cttgaggaaccatgggtggttcttgatctcaggaatggtaattcgctgc 121950



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 180    tcacaacgggcacacgaagtccccgctgttctcaatgtcaatgtcgtcg 228
              |||||| | |||||||||||| ||||||| ||| | ||| |||||||||
Sbjct: 122232 tcacaatgcgcacacgaagtcgccgctgtcctcgacgtcgatgtcgtcg 122184



to top

>gb|AY107474.1| Zea mays PCO105841 mRNA sequence
          Length = 970

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 391 tggtactcgtctgtcatctcaacgggcaggcgtttgaggaaccatggatggttcttgatc 450
           ||||||||||| |||||||| | |||||||   || ||||||||||| ||||||||||||
Sbjct: 495 tggtactcgtcggtcatctcgatgggcaggttcttcaggaaccatgggtggttcttgatc 436

                         
Query: 451 tccgggatggttat 464
           || |||||||||||
Sbjct: 435 tctgggatggttat 422



to top

>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence
          Length = 103167

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 424   ttgaggaaccatggatggttcttgatctc 452
             |||| ||||||||||||| ||||||||||
Sbjct: 26525 ttgacgaaccatggatggctcttgatctc 26553



to top

>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence
          Length = 125927

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 424   ttgaggaaccatggatggttcttgatctc 452
             |||| ||||||||||||| ||||||||||
Sbjct: 93170 ttgacgaaccatggatggctcttgatctc 93198



to top

>gb|AC009204.5|AC009204 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR03E19, complete sequence
          Length = 167777

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   atgctccccaggcaggcaacc 276
             |||||||||||||||||||||
Sbjct: 93403 atgctccccaggcaggcaacc 93423



to top

>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone
             BACR17A06, complete sequence
          Length = 170546

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   atgctccccaggcaggcaacc 276
             |||||||||||||||||||||
Sbjct: 43989 atgctccccaggcaggcaacc 44009



to top

>gb|AC154430.3| Mus musculus BAC clone RP24-208K8 from chromosome 16, complete sequence
          Length = 178222

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 469   tgctgaggatttccaacgaaa 489
             |||||||||||||||||||||
Sbjct: 93397 tgctgaggatttccaacgaaa 93377



to top

>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the
            complete sequence
          Length = 265558

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 256  atgctccccaggcaggcaacc 276
            |||||||||||||||||||||
Sbjct: 9127 atgctccccaggcaggcaacc 9147



to top

>gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome 9, complete sequence
          Length = 193364

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   ctgcccagcaagccctaggg 295
             ||||||||||||||||||||
Sbjct: 63405 ctgcccagcaagccctaggg 63424



to top

>gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, complete sequence
          Length = 190317

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 276    ctgcccagcaagccctaggg 295
              ||||||||||||||||||||
Sbjct: 107126 ctgcccagcaagccctaggg 107107



to top

>ref|NM_019576.1| Mus musculus thrombospondin, type I, domain 1 (Thsd1), mRNA
          Length = 2815

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 2677 gtgcagcccacagaaagtatgtga 2654



to top

>gb|AC139553.5| Mus musculus chromosome 19, clone RP24-386E18, complete sequence
          Length = 168091

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    gagtattccttaactagtga 20
            ||||||||||||||||||||
Sbjct: 8468 gagtattccttaactagtga 8449



to top

>gb|AC123941.3| Mus musculus BAC clone RP23-458G24 from chromosome 19, complete
             sequence
          Length = 182733

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gagtattccttaactagtga 20
             ||||||||||||||||||||
Sbjct: 76749 gagtattccttaactagtga 76768



to top

>gb|BC051957.1| Mus musculus thrombospondin, type I, domain 1, mRNA (cDNA clone
            IMAGE:6401753), containing frame-shift errors
          Length = 3261

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 2602 gtgcagcccacagaaagtatgtga 2579



to top

>gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosome 8, complete sequence
          Length = 182816

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    gtgcagcccacagaaaatatgtga 102
             |||||||||||||||| |||||||
Sbjct: 65385 gtgcagcccacagaaagtatgtga 65408



to top

>ref|XM_765844.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_608_54498_53302) partial mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 435 tggatggttcttgatctccg 454
           ||||||||||||||||||||
Sbjct: 774 tggatggttcttgatctccg 755



to top

>gb|AY316305.1| Homo sapiens glutathione transferase zeta 1 (maleylacetoacetate
             isomerase) (GSTZ1) gene, complete cds
          Length = 12743

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 76    tctgtgcagcccacagaaaatatgtgat 103
             ||||||||||||| ||||||| ||||||
Sbjct: 10027 tctgtgcagcccaaagaaaatctgtgat 10000



to top

>dbj|AK094344.1| Homo sapiens cDNA FLJ37025 fis, clone BRACE2010888, weakly similar
           to MALEYLACETOACETATE ISOMERASE (EC 5.2.1.2)
          Length = 2338

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 76  tctgtgcagcccacagaaaatatgtgat 103
           ||||||||||||| ||||||| ||||||
Sbjct: 684 tctgtgcagcccaaagaaaatctgtgat 657



to top

>gb|AC148755.6| Medicago truncatula clone mth2-24n16, complete sequence
          Length = 119876

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 430   aaccatggatggttcttgat 449
             ||||||||||||||||||||
Sbjct: 81151 aaccatggatggttcttgat 81132



to top

>gb|AC090282.6| Homo sapiens chromosome 17, clone CTD-2309O5, complete sequence
          Length = 164883

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    cagcccacagaaaatatgtg 101
             ||||||||||||||||||||
Sbjct: 84659 cagcccacagaaaatatgtg 84678



to top

>dbj|AK052555.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched
            library, clone:D530002G20 product:transmembrane molecule
            with thrombospondin module, full insert sequence
          Length = 3273

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 2647 gtgcagcccacagaaagtatgtga 2624



to top

>emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on chromosome 3, complete
              sequence
          Length = 180483

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 334    atggcttcttccaggctctg 353
              ||||||||||||||||||||
Sbjct: 145542 atggcttcttccaggctctg 145523



to top

>dbj|AK049636.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
            enriched library, clone:C530010H06 product:transmembrane
            molecule with thrombospondin module, full insert sequence
          Length = 4383

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 2811 gtgcagcccacagaaagtatgtga 2788



to top

>dbj|AK014758.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
            library, clone:4833423O18 product:transmembrane molecule
            with thrombospondin module, full insert sequence
          Length = 1297

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 1148 gtgcagcccacagaaagtatgtga 1125



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 92       aaaatatgtgatccggaagaaaat 115
                |||||| |||||||||||||||||
Sbjct: 32056967 aaaataagtgatccggaagaaaat 32056990



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 150      aaccaccaagaacttctaaa 169
                ||||||||||||||||||||
Sbjct: 30975410 aaccaccaagaacttctaaa 30975429



to top

>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0439E07
          Length = 176486

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   aaccaccaagaacttctaaa 169
             ||||||||||||||||||||
Sbjct: 32389 aaccaccaagaacttctaaa 32408



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 224     cgtcgacgtcgaaatcaatg 243
               ||||||||||||||||||||
Sbjct: 6233514 cgtcgacgtcgaaatcaatg 6233533



to top

>gb|AC007954.7|AC007954 Homo sapiens chromosome 14 clone RP11-493G17 and CTD-2516D11 map 14q24.3,
              complete sequence
          Length = 210204

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 76     tctgtgcagcccacagaaaatatgtgat 103
              ||||||||||||| ||||||| ||||||
Sbjct: 116102 tctgtgcagcccaaagaaaatctgtgat 116075



to top

>gb|AF053543.1|HSGSTZ1G5 Homo sapiens glutathione transferase zeta 1 (GSTZ1) gene, exons 6
           and 7
          Length = 964

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 76  tctgtgcagcccacagaaaatatgtgat 103
           ||||||||||||| ||||||| ||||||
Sbjct: 168 tctgtgcagcccaaagaaaatctgtgat 141



to top

>gb|AF116597.1|AF116597 Metarhizium anisopliae cAMP-dependent protein kinase catalytic
            subunit (PKA) gene, complete cds
          Length = 5864

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  gaaccatggatggttcttga 448
            ||||||||||||||||||||
Sbjct: 4815 gaaccatggatggttcttga 4796



to top

>gb|AC108421.8| Mus musculus chromosome 19, clone RP23-433N7, complete sequence
          Length = 190980

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1    gagtattccttaactagtga 20
            ||||||||||||||||||||
Sbjct: 2715 gagtattccttaactagtga 2734



to top

>emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0089N06,
             complete sequence
          Length = 141752

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 92    aaaatatgtgatccggaagaaaat 115
             |||||| |||||||||||||||||
Sbjct: 77674 aaaataagtgatccggaagaaaat 77697



to top

>dbj|AB039946.1| Mus musculus TMTSP mRNA for transmembrane molecule with
            thrombospondin module, complete cds
          Length = 2815

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   gtgcagcccacagaaaatatgtga 102
            |||||||||||||||| |||||||
Sbjct: 2677 gtgcagcccacagaaagtatgtga 2654


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,836,930
Number of Sequences: 3902068
Number of extensions: 3836930
Number of successful extensions: 66183
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65952
Number of HSP's gapped (non-prelim): 220
length of query: 597
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 574
effective length of database: 17,143,297,704
effective search space: 9840252882096
effective search space used: 9840252882096
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top