ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd21a12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF527606.1| Hordeum vulgare iron/ascorbate-dependent oxidored... 385 e-103
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
3dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
4dbj|AK065581.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
5ref|NM_185692.1| Oryza sativa (japonica cultivar-group), Ozsa804... 66 1e-07
6ref|XM_476309.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
8dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
9dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
10emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chro... 44 0.43
11emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, c... 44 0.43
12gb|AC121560.17| Mus musculus chromosome 16, clone RP24-398G11, c... 42 1.7
13gb|AY596171.1| Populus tomentosa gibberellin 20-oxidase gene, co... 42 1.7
14gb|AY479975.1| Populus tomentosa gibberellin 20-oxidase mRNA, co... 42 1.7
15emb|AJ843665.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
16emb|AJ843664.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
17emb|AJ843663.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
18emb|AJ843662.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
19emb|AJ843661.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
20emb|AJ843660.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
21emb|AJ843658.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
22emb|AJ843657.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
23emb|AJ843656.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
24emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
25emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
26emb|AJ843653.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
27emb|AJ843652.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
28emb|AJ843651.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
29emb|AJ843650.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
30emb|AJ843649.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
31emb|AJ843648.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
32emb|AJ843647.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
33emb|AJ843646.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
34emb|AJ843645.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
35emb|AJ843644.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
36emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
37emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
38emb|AJ843641.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
39emb|AJ843640.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
40emb|AJ843639.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
41emb|AJ843638.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
42emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
43emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
44emb|AJ843635.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
45emb|AJ843634.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
46emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
47emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
48emb|AJ843630.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
49emb|AJ843629.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
50emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
51emb|AJ843627.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
52emb|AJ843626.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
53emb|AJ843625.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
54emb|AJ843624.1| Populus tremula ga20ox1 gene for gibberellin 20-... 42 1.7
55emb|CR376855.11| Zebrafish DNA sequence from clone DKEY-56N2 in ... 42 1.7
56emb|BX248386.35| Zebrafish DNA sequence from clone CH211-231M12,... 42 1.7
57emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on ch... 42 1.7
58emb|AJ001326.2|PTXPTGIBB Populus tremula x Populus tremuloides m... 42 1.7
59emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in... 42 1.7
60emb|BX005349.6| Zebrafish DNA sequence from clone DKEY-111D8 in ... 42 1.7
61dbj|AB090241.1| Populus alba PaGA20ox1b gene for gibberellin 20-... 42 1.7
62dbj|AB090240.1| Populus alba PaGA20ox1b mRNA for gibberellin 20-... 42 1.7
63dbj|AB090239.1| Populus alba PaGA20ox1a gene for gibberellin 20-... 42 1.7
64dbj|AB090238.1| Populus alba PaGA20ox1a mRNA for gibberellin 20-... 42 1.7
65dbj|AB089676.1| Populus nigra PnGA20ox1 gene for gibberellin 20-... 42 1.7
66dbj|AB089675.1| Populus nigra PnGA20ox1 mRNA for gibberellin 20-... 42 1.7
67emb|BX571961.11| Zebrafish DNA sequence from clone DKEY-205O12 i... 42 1.7
68dbj|AB021290.1| Homo sapiens gene for chondromodulin-1, promoter... 42 1.7
69ref|NM_124779.1| Arabidopsis thaliana oxidoreductase, acting on ... 40 6.7
70ref|NM_185701.1| Oryza sativa (japonica cultivar-group), Ozsa805... 40 6.7
71ref|NM_185691.1| Oryza sativa (japonica cultivar-group), Ozsa804... 40 6.7
72gb|BT016483.1| Zea mays clone Contig316 mRNA sequence 40 6.7
73gb|BT018033.1| Zea mays clone EL01N0530E08.c mRNA sequence 40 6.7
74gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, c... 40 6.7
75ref|XM_753922.1| Ustilago maydis 521 hypothetical protein (UM028... 40 6.7
76gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosom... 40 6.7
77gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome... 40 6.7
78emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 i... 40 6.7
79gb|AC099414.4| Mus musculus BAC clone RP23-122C18 from 3, comple... 40 6.7
80emb|CR956383.8| Pig DNA sequence from clone CH242-271L5 on chrom... 40 6.7
81gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosom... 40 6.7
82gb|DQ056720.1| Arabidopsis thaliana oxidoreductase (At5g54000) m... 40 6.7
83gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, com... 40 6.7
84gb|AC023426.29| Homo sapiens 12 BAC RP11-396L8 (Roswell Park Can... 40 6.7
85gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete... 40 6.7
86gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, comple... 40 6.7
87dbj|AB007644.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.7
88gb|U29379.1| Caenorhabditis elegans cosmid K05B2, complete sequence 40 6.7
89emb|CR954297.15| Zebrafish DNA sequence from clone DKEY-69M3 in ... 40 6.7
90gb|AE000657.1| Aquifex aeolicus VF5, complete genome 40 6.7
91gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, compl... 40 6.7
92emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chr... 40 6.7 
>gb|AF527606.1| Hordeum vulgare iron/ascorbate-dependent oxidoreductase (Hcp1) mRNA,
            complete cds
          Length = 1360

 Score =  385 bits (194), Expect = e-103
 Identities = 392/458 (85%)
 Strand = Plus / Minus

                                                                        
Query: 37   ttcagggtgttgatgaatctcttcccttgacgaaaatgttcgaagagcccagccacaaag 96
            |||||||||| ||||||||||||||||||| | |||||||| ||||| ||  | || || 
Sbjct: 1076 ttcagggtgtcgatgaatctcttcccttgaaggaaatgttcaaagagtccgactacgaaa 1017

                                                                        
Query: 97   tccttggccaatattttcctatatcttggcggtcgcttgccatccagcaaaccgggcgcc 156
            ||||||||||  ||||||||||||||||| ||||||||  ||||||||||||||||||| 
Sbjct: 1016 tccttggccatcattttcctatatcttggtggtcgcttctcatccagcaaaccgggcgct 957

                                                                        
Query: 157  ggttctagcatcgtttccgcatccacggcgtaaaacatagccagggaaagcctatccttc 216
            || || |||| ||||||  |||||||||| || ||||  ||||| |||||||| ||||||
Sbjct: 956  ggctccagcaccgtttcttcatccacggcatagaacacggccagcgaaagcctctccttc 897

                                                                        
Query: 217  ttgaagttcgtcaccactctgtgaaatgggctcctaaagattccattgttcattatttct 276
            |    ||||||||||||||||||||  ||||||||||||||||||||||||||||| || 
Sbjct: 896  tcagtgttcgtcaccactctgtgaaccgggctcctaaagattccattgttcattatctcc 837

                                                                        
Query: 277  aggcagtctgctaggttaaccagcaatgtgtgcggcttggctggaacattgtaccatctc 336
            ||||||||||||| ||| | || ||  ||||| |||||||||||||||||||||||| ||
Sbjct: 836  aggcagtctgctaagttgatcaccagcgtgtgaggcttggctggaacattgtaccatttc 777

                                                                        
Query: 337  ccatctctctgaacttgcaagccaccgacggtgtcatcgttgagaaggatggtaaggaga 396
            |||||||||||||||||||||||||| ||   ||| |||   | ||||||||||||||| 
Sbjct: 776  ccatctctctgaacttgcaagccaccaacatcgtcgtcgacaaaaaggatggtaaggagg 717

                                                                        
Query: 397  ccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtag 456
               || || | ||||||| ||||||||||||||| |||||| ||||| || |||||||||
Sbjct: 716  ttgccatcagagtgaggcgtgaggcccaaaactaggtcaggtctcggacacggagggtag 657

                                                  
Query: 457  tagttgaatctagcaaacccggaagccttgtttgatat 494
            ||||  ||||||||||||||||||||||||||||||||
Sbjct: 656  tagtacaatctagcaaacccggaagccttgtttgatat 619
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                            
Query: 400      ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 459
                ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 10388357 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 10388298

                              
Query: 460      ttgaatctagcaaa 473
                |||||||| |||||
Sbjct: 10388297 ttgaatcttgcaaa 10388284
to top
>dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0669G10
          Length = 133372

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 400   ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 459
             ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 30779 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 30720

                           
Query: 460   ttgaatctagcaaa 473
             |||||||| |||||
Sbjct: 30719 ttgaatcttgcaaa 30706
to top
>dbj|AK065581.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013034J09, full
            insert sequence
          Length = 1729

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                        
Query: 400  ccgtcggtgtgaggcctgaggcccaaaactaagtcaggcctcgggcatggagggtagtag 459
            ||||||| ||||||||||| ||| || || | ||||||||| || || ||||||||||||
Sbjct: 1032 ccgtcggagtgaggcctgatgccgaacacaaggtcaggccttggacagggagggtagtag 973

                          
Query: 460  ttgaatctagcaaa 473
            |||||||| |||||
Sbjct: 972  ttgaatcttgcaaa 959
to top
>ref|NM_185692.1| Oryza sativa (japonica cultivar-group), Ozsa8043 predicted mRNA
          Length = 1164

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                       
Query: 320 gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
           |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 704

                                                                       
Query: 380 gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
           |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 703 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 644

                                            
Query: 440 tcgggcatggagggtagtagttgaatctagcaa 472
           | || || |||||||||||||||||||| ||||
Sbjct: 643 ttggacagggagggtagtagttgaatcttgcaa 611
to top
>ref|XM_476309.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1053

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                       
Query: 320 gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
           |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 763 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 704

                                                                       
Query: 380 gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
           |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 703 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 644

                                            
Query: 440 tcgggcatggagggtagtagttgaatctagcaa 472
           | || || |||||||||||||||||||| ||||
Sbjct: 643 ttggacagggagggtagtagttgaatcttgcaa 611
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 320     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3905561 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3905502

                                                                           
Query: 380     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3905501 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3905442

                                                
Query: 440     tcgggcatggagggtagtagttgaatctagcaa 472
               | || || |||||||||||||||||||| ||||
Sbjct: 3905441 ttggacagggagggtagtagttgaatcttgcaa 3905409



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 320     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3893670 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3893611

                                                                           
Query: 380     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3893610 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3893551

                                                
Query: 440     tcgggcatggagggtagtagttgaatctagcaa 472
               | || || |||||||||||||||||||| ||||
Sbjct: 3893550 ttggacagggagggtagtagttgaatcttgcaa 3893518



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                           
Query: 320     gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
               |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 3855682 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 3855623

                                                                           
Query: 380     gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
               |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 3855622 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 3855563

                                                
Query: 440     tcgggcatggagggtagtagttgaatctagcaa 472
               | || || |||||||||||||||||||| ||||
Sbjct: 3855562 ttggacagggagggtagtagttgaatcttgcaa 3855530



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 449     gagggtagtagttgaatctagcaa 472
               |||||||||||||||||| |||||
Sbjct: 3900941 gagggtagtagttgaatcgagcaa 3900918



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 449     gagggtagtagttgaatctagcaa 472
               |||||||||||||||||| |||||
Sbjct: 3889118 gagggtagtagttgaatcgagcaa 3889095



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 449     gagggtagtagttgaatctagcaa 472
               |||||||||||||||||| |||||
Sbjct: 3851062 gagggtagtagttgaatcgagcaa 3851039
to top
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0035I03
          Length = 153749

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                         
Query: 320   gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
             |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 11437 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 11378

                                                                         
Query: 380   gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
             |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 11377 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 11318

                                              
Query: 440   tcgggcatggagggtagtagttgaatctagcaa 472
             | || || |||||||||||||||||||| ||||
Sbjct: 11317 ttggacagggagggtagtagttgaatcttgcaa 11285



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 449  gagggtagtagttgaatctagcaa 472
            |||||||||||||||||| |||||
Sbjct: 6817 gagggtagtagttgaatcgagcaa 6794
to top
>dbj|AP002069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0015E04
          Length = 152046

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                          
Query: 320    gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
              |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 151692 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 151633

                                                                          
Query: 380    gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
              |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 151632 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 151573

                                               
Query: 440    tcgggcatggagggtagtagttgaatctagcaa 472
              | || || |||||||||||||||||||| ||||
Sbjct: 151572 ttggacagggagggtagtagttgaatcttgcaa 151540



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Minus

                                                                          
Query: 320    gaacattgtaccatctcccatctctctgaacttgcaagccaccgacggtgtcatcgttga 379
              |||||||||||||  | ||||| ||||||| ||||| |||||||||    || |||  ||
Sbjct: 113636 gaacattgtaccacttgccatccctctgaatttgcaggccaccgacatcttcgtcgacga 113577

                                                                          
Query: 380    gaaggatggtaaggagaccaccgtcggtgtgaggcctgaggcccaaaactaagtcaggcc 439
              |||| || |||| |||    ||||||| ||||||||||| ||| || || | ||||||||
Sbjct: 113576 gaagaatcgtaaagagggagccgtcggagtgaggcctgacgccgaacacaaggtcaggcc 113517

                                               
Query: 440    tcgggcatggagggtagtagttgaatctagcaa 472
              | || || |||||||||||||||||||| ||||
Sbjct: 113516 ttggacagggagggtagtagttgaatcttgcaa 113484



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 449    gagggtagtagttgaatctagcaa 472
              |||||||||||||||||| |||||
Sbjct: 147072 gagggtagtagttgaatcgagcaa 147049



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 449    gagggtagtagttgaatctagcaa 472
              |||||||||||||||||| |||||
Sbjct: 109016 gagggtagtagttgaatcgagcaa 108993
to top
>emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chromosome 10 Contains part
             of the DOCK1 gene for dedicator of cyto-kinesis 1,
             complete sequence
          Length = 154818

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 333   tctcccatctctctgaacttgc 354
             ||||||||||||||||||||||
Sbjct: 76243 tctcccatctctctgaacttgc 76264
to top
>emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, complete sequence
          Length = 177714

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 175    gcatccacggcgtaaaacatag 196
              ||||||||||||||||||||||
Sbjct: 121066 gcatccacggcgtaaaacatag 121087
to top
>gb|AC121560.17| Mus musculus chromosome 16, clone RP24-398G11, complete sequence
          Length = 189161

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 26     caacctatattttcagggtgt 46
              |||||||||||||||||||||
Sbjct: 128875 caacctatattttcagggtgt 128855
to top
>gb|AY596171.1| Populus tomentosa gibberellin 20-oxidase gene, complete cds
          Length = 1362

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 884 ggcatggagggtagtagttga 864
to top
>gb|AY479975.1| Populus tomentosa gibberellin 20-oxidase mRNA, complete cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>emb|AJ843665.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 98_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843664.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 98_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843663.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 94_2
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843662.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 94_1
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843661.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 92_2
          Length = 1710

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1008 ggcatggagggtagtagttga 988
to top
>emb|AJ843660.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 92_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843658.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 87_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843657.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 70_2
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843656.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 70_1
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843655.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 67_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843654.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 67_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843653.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 65_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843652.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 65_1
          Length = 1695

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 993 ggcatggagggtagtagttga 973
to top
>emb|AJ843651.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 58_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843650.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 58_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843649.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 24_2
          Length = 1685

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 983 ggcatggagggtagtagttga 963
to top
>emb|AJ843648.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 24_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843647.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 22_2
          Length = 1693

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 991 ggcatggagggtagtagttga 971
to top
>emb|AJ843646.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 22_1
          Length = 1693

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 991 ggcatggagggtagtagttga 971
to top
>emb|AJ843645.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 17_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843644.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 17_1
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843643.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843642.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 13_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843641.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 114_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843640.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 114_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843639.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 112_2
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843638.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 112_1
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1010 ggcatggagggtagtagttga 990
to top
>emb|AJ843637.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 111_2
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843636.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 111_1
          Length = 1692

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 990 ggcatggagggtagtagttga 970
to top
>emb|AJ843635.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 10_2
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 985 ggcatggagggtagtagttga 965
to top
>emb|AJ843634.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 10_1
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843633.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 109_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843631.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 108_2
          Length = 1691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 989 ggcatggagggtagtagttga 969
to top
>emb|AJ843630.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 108_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843629.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 107_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843628.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 107_1
          Length = 1711

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1009 ggcatggagggtagtagttga 989
to top
>emb|AJ843627.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 104_2
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843626.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
            isolate 104_1
          Length = 1709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1007 ggcatggagggtagtagttga 987
to top
>emb|AJ843625.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 102_1
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|AJ843624.1| Populus tremula ga20ox1 gene for gibberellin 20-oxidase, exons 1-3,
           isolate 102_2
          Length = 1689

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 987 ggcatggagggtagtagttga 967
to top
>emb|CR376855.11| Zebrafish DNA sequence from clone DKEY-56N2 in linkage group 25, complete
              sequence
          Length = 219164

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 175    gcatccacggcgtaaaacata 195
              |||||||||||||||||||||
Sbjct: 152114 gcatccacggcgtaaaacata 152134
to top
>emb|BX248386.35| Zebrafish DNA sequence from clone CH211-231M12, complete sequence
          Length = 148681

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 175    gcatccacggcgtaaaacata 195
              |||||||||||||||||||||
Sbjct: 123942 gcatccacggcgtaaaacata 123922
to top
>emb|AL139085.13| Human DNA sequence from clone RP11-431O22 on chromosome 13 Contains the
             5' end of the gene for chondromodulin I precursor (CHM-I),
             a novel gene, the PCDH8 gene for protocadherin 8 and 4 CpG
             islands, complete sequence
          Length = 173292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 324   attgtaccatctcccatctctctga 348
             |||||||||||||||| ||||||||
Sbjct: 29810 attgtaccatctcccacctctctga 29786
to top
>emb|AJ001326.2|PTXPTGIBB Populus tremula x Populus tremuloides mRNA for gibberellin 20-oxidase
          Length = 1857

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 443  ggcatggagggtagtagttga 463
            |||||||||||||||||||||
Sbjct: 1002 ggcatggagggtagtagttga 982
to top
>emb|BX293556.14| Zebrafish DNA sequence from clone DKEY-21N20 in linkage group 11,
              complete sequence
          Length = 212880

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 175    gcatccacggcgtaaaacata 195
              |||||||||||||||||||||
Sbjct: 207644 gcatccacggcgtaaaacata 207624
to top
>emb|BX005349.6| Zebrafish DNA sequence from clone DKEY-111D8 in linkage group 10,
             complete sequence
          Length = 103469

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 175   gcatccacggcgtaaaacata 195
             |||||||||||||||||||||
Sbjct: 10940 gcatccacggcgtaaaacata 10920
to top
>dbj|AB090241.1| Populus alba PaGA20ox1b gene for gibberellin 20-oxidase, complete
           cds
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB090240.1| Populus alba PaGA20ox1b mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>dbj|AB090239.1| Populus alba PaGA20ox1a gene for gibberellin 20-oxidase, complete
           cds
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB090238.1| Populus alba PaGA20ox1a mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>dbj|AB089676.1| Populus nigra PnGA20ox1 gene for gibberellin 20-oxidase, complete
           cds
          Length = 1449

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 835 ggcatggagggtagtagttga 815
to top
>dbj|AB089675.1| Populus nigra PnGA20ox1 mRNA for gibberellin 20-oxidase, complete
           cds
          Length = 1158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 443 ggcatggagggtagtagttga 463
           |||||||||||||||||||||
Sbjct: 724 ggcatggagggtagtagttga 704
to top
>emb|BX571961.11| Zebrafish DNA sequence from clone DKEY-205O12 in linkage group 22,
             complete sequence
          Length = 149478

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 175   gcatccacggcgtaaaacata 195
             |||||||||||||||||||||
Sbjct: 98344 gcatccacggcgtaaaacata 98364
to top
>dbj|AB021290.1| Homo sapiens gene for chondromodulin-1, promoter and partial cds
          Length = 2982

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 324  attgtaccatctcccatctctctga 348
            |||||||||||||||| ||||||||
Sbjct: 1330 attgtaccatctcccacctctctga 1354
to top
>ref|NM_124779.1| Arabidopsis thaliana oxidoreductase, acting on paired donors, with
           incorporation or reduction of molecular oxygen,
           2-oxoglutarate as one donor, and > AT5G54000 mRNA,
           complete cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 436 ggcctcgggcatggagggtagtagttgaatct 467
           |||||||| ||||||||||||  |||||||||
Sbjct: 650 ggcctcggacatggagggtagatgttgaatct 619
to top
>ref|NM_185701.1| Oryza sativa (japonica cultivar-group), Ozsa8052 predicted mRNA
          Length = 1050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 449 gagggtagtagttgaatctagcaa 472
           |||||||||||||||||| |||||
Sbjct: 631 gagggtagtagttgaatcgagcaa 608
to top
>ref|NM_185691.1| Oryza sativa (japonica cultivar-group), Ozsa8042 predicted mRNA
          Length = 1050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 449 gagggtagtagttgaatctagcaa 472
           |||||||||||||||||| |||||
Sbjct: 631 gagggtagtagttgaatcgagcaa 608
to top
>gb|BT016483.1| Zea mays clone Contig316 mRNA sequence
          Length = 1124

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 ggagggtagtagttgaatct 467
           ||||||||||||||||||||
Sbjct: 611 ggagggtagtagttgaatct 592
to top
>gb|BT018033.1| Zea mays clone EL01N0530E08.c mRNA sequence
          Length = 1095

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 448 ggagggtagtagttgaatct 467
           ||||||||||||||||||||
Sbjct: 556 ggagggtagtagttgaatct 537
to top
>gb|AC125448.16| Mus musculus chromosome 10, clone RP23-122D10, complete sequence
          Length = 188948

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 162    tagcatcgtttccgcatcca 181
              ||||||||||||||||||||
Sbjct: 166593 tagcatcgtttccgcatcca 166612
to top
>ref|XM_753922.1| Ustilago maydis 521 hypothetical protein (UM02868.1) partial mRNA
          Length = 2991

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 89   ccacaaagtccttggccaat 108
            ||||||||||||||||||||
Sbjct: 2887 ccacaaagtccttggccaat 2868
to top
>gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosome 8, complete sequence
          Length = 211388

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    caatattttcctatatcttg 124
              ||||||||||||||||||||
Sbjct: 141678 caatattttcctatatcttg 141697
to top
>gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome 3, complete sequence
          Length = 166604

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   ttccattgttcattatttct 276
             ||||||||||||||||||||
Sbjct: 80071 ttccattgttcattatttct 80052
to top
>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12,
              complete sequence
          Length = 212974

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    gcatccacggcgtaaaacat 194
              ||||||||||||||||||||
Sbjct: 117154 gcatccacggcgtaaaacat 117135
to top
>gb|AC099414.4| Mus musculus BAC clone RP23-122C18 from 3, complete sequence
          Length = 203057

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 257  ttccattgttcattatttct 276
            ||||||||||||||||||||
Sbjct: 9450 ttccattgttcattatttct 9469
to top
>emb|CR956383.8| Pig DNA sequence from clone CH242-271L5 on chromosome 17, complete
              sequence
          Length = 163007

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     taataaacgcccaacctata 34
              ||||||||||||||||||||
Sbjct: 118910 taataaacgcccaacctata 118929
to top
>gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosome 9, complete sequence
          Length = 211119

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    tctgtgaaatgggctcctaa 253
              ||||||||||||||||||||
Sbjct: 153685 tctgtgaaatgggctcctaa 153704
to top
>gb|DQ056720.1| Arabidopsis thaliana oxidoreductase (At5g54000) mRNA, complete cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 436 ggcctcgggcatggagggtagtagttgaatct 467
           |||||||| ||||||||||||  |||||||||
Sbjct: 650 ggcctcggacatggagggtagatgttgaatct 619
to top
>gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, complete sequence
          Length = 183583

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 378   gagaaggatggtaaggagac 397
             ||||||||||||||||||||
Sbjct: 88314 gagaaggatggtaaggagac 88333
to top
>gb|AC023426.29| Homo sapiens 12 BAC RP11-396L8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 148610

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    atttctaggcagtctgctag 290
              ||||||||||||||||||||
Sbjct: 122632 atttctaggcagtctgctag 122613
to top
>gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete genome
          Length = 34119

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    agtccttggccaatattttc 114
             ||||||||||||||||||||
Sbjct: 32595 agtccttggccaatattttc 32614
to top
>gb|AC019106.3| Homo sapiens BAC clone RP11-479L11 from 2, complete sequence
          Length = 198540

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   agattccattgttcattatt 273
             ||||||||||||||||||||
Sbjct: 51899 agattccattgttcattatt 51918
to top
>dbj|AB007644.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19P17
          Length = 73840

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 436   ggcctcgggcatggagggtagtagttgaatct 467
             |||||||| ||||||||||||  |||||||||
Sbjct: 57998 ggcctcggacatggagggtagatgttgaatct 58029
to top
>gb|U29379.1| Caenorhabditis elegans cosmid K05B2, complete sequence
          Length = 37599

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    tatattttcagggtgttgat 50
             ||||||||||||||||||||
Sbjct: 23471 tatattttcagggtgttgat 23452
to top
>emb|CR954297.15| Zebrafish DNA sequence from clone DKEY-69M3 in linkage group 8,
             complete sequence
          Length = 232837

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   gcatccacggcgtaaaacat 194
             ||||||||||||||||||||
Sbjct: 85062 gcatccacggcgtaaaacat 85081
to top
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 54      tctcttcccttgacgaaaat 73
               ||||||||||||||||||||
Sbjct: 1096031 tctcttcccttgacgaaaat 1096012
to top
>gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, complete sequence
          Length = 181469

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 338    catctctctgaacttgcaag 357
              ||||||||||||||||||||
Sbjct: 124280 catctctctgaacttgcaag 124261
to top
>emb|AL713894.12| Mouse DNA sequence from clone RP23-48J18 on chromosome X, complete
              sequence
          Length = 264395

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 199    agggaaagcctatccttcttgaag 222
              ||||||| ||||||||||||||||
Sbjct: 197778 agggaaatcctatccttcttgaag 197755


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,641,272
Number of Sequences: 3902068
Number of extensions: 3641272
Number of successful extensions: 71095
Number of sequences better than 10.0: 92
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70891
Number of HSP's gapped (non-prelim): 203
length of query: 494
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 472
effective length of database: 17,147,199,772
effective search space: 8093478292384
effective search space used: 8093478292384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top