ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd20i02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103915.1| Zea mays PCO106165 mRNA sequence Length = 978 Score = 141 bits (71), Expect = 7e-31 Identities = 117/133 (87%) Strand = Plus / Minus Query: 20 gccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggt 79 |||||| | ||||||||||||||||||||| |||| ||||||||| || || ||||| || Sbjct: 623 gccaacagcaacacccatgcaaagcaccttcttcagctggaacttaactgtagcctttgt 564 Query: 80 ctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||||||||||||||||||||| |||||||| | |||||| || || || |||||||| Sbjct: 563 ctcattaaccttggactcaagggattcctggtgtgtcaccaaggtagggaattttcctgc 504 Query: 140 cttgntaagacca 152 |||| |||||||| Sbjct: 503 cttgttaagacca 491
>gb|BT012985.1| Lycopersicon esculentum clone 114201R, mRNA sequence Length = 895 Score = 115 bits (58), Expect = 4e-23 Identities = 113/132 (85%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||||||||||||||| |||||||||||||||| || |||||||| Sbjct: 589 ccaacagcaacacccatgcaaagcaccttcttcaactggaacttgatggtagccttggtt 530 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||||||||| ||||| || ||||| ||||| || || | ||||||||||| |||||| Sbjct: 529 tcattaaccttagactcgagtgactcttggtgggaaacaagggttggaaacttacctgcc 470 Query: 141 ttgntaagacca 152 ||| | |||||| Sbjct: 469 ttgttcagacca 458
>ref|NM_190697.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 627 Score = 101 bits (51), Expect = 6e-19 Identities = 87/99 (87%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 ||||||||||||||| |||||||||| |||||||| || || ||||| ||||| ||||| Sbjct: 474 aacacccatgcaaagaacctttttcagttggaacttcactgtagccttagtctcgttaac 415 Query: 89 cttggactcaagggactcctggtgagacaccaaagttgg 127 |||||||||||| || |||||||||| |||||| ||||| Sbjct: 414 cttggactcaagtgattcctggtgagtcaccaacgttgg 376
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 101 bits (51), Expect = 6e-19 Identities = 87/99 (87%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 ||||||||||||||| |||||||||| |||||||| || || ||||| ||||| ||||| Sbjct: 37227108 aacacccatgcaaagaacctttttcagttggaacttcactgtagccttagtctcgttaac 37227049 Query: 89 cttggactcaagggactcctggtgagacaccaaagttgg 127 |||||||||||| || |||||||||| |||||| ||||| Sbjct: 37227048 cttggactcaagtgattcctggtgagtcaccaacgttgg 37227010
>dbj|AP003794.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0489B03 Length = 150381 Score = 101 bits (51), Expect = 6e-19 Identities = 87/99 (87%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 ||||||||||||||| |||||||||| |||||||| || || ||||| ||||| ||||| Sbjct: 101764 aacacccatgcaaagaacctttttcagttggaacttcactgtagccttagtctcgttaac 101705 Query: 89 cttggactcaagggactcctggtgagacaccaaagttgg 127 |||||||||||| || |||||||||| |||||| ||||| Sbjct: 101704 cttggactcaagtgattcctggtgagtcaccaacgttgg 101666
>dbj|AP003287.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0679C12 Length = 153666 Score = 101 bits (51), Expect = 6e-19 Identities = 87/99 (87%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 ||||||||||||||| |||||||||| |||||||| || || ||||| ||||| ||||| Sbjct: 64097 aacacccatgcaaagaacctttttcagttggaacttcactgtagccttagtctcgttaac 64038 Query: 89 cttggactcaagggactcctggtgagacaccaaagttgg 127 |||||||||||| || |||||||||| |||||| ||||| Sbjct: 64037 cttggactcaagtgattcctggtgagtcaccaacgttgg 63999
>ref|XM_483755.1| Oryza sativa (japonica cultivar-group), mRNA Length = 936 Score = 97.6 bits (49), Expect = 9e-18 Identities = 105/124 (84%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || |||||||| || Sbjct: 572 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcattgac 513 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||||||| | || Sbjct: 512 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgccttgtttag 453 Query: 149 acca 152 |||| Sbjct: 452 acca 449
>dbj|AK061522.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-B06, full insert sequence Length = 936 Score = 97.6 bits (49), Expect = 9e-18 Identities = 105/124 (84%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || |||||||| || Sbjct: 572 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcattgac 513 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||||||| | || Sbjct: 512 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgccttgtttag 453 Query: 149 acca 152 |||| Sbjct: 452 acca 449
>dbj|AK102574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097O05, full insert sequence Length = 917 Score = 93.7 bits (47), Expect = 1e-16 Identities = 111/133 (83%) Strand = Plus / Minus Query: 20 gccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggt 79 |||||| | |||||||||||| || ||||| |||| |||||| || || || ||||| || Sbjct: 580 gccaacagcaacacccatgcagagaaccttcttcagctggaatttcactgtagccttagt 521 Query: 80 ctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 ||||||||||||||||||||| || ||||| || | ||||| |||||| || || ||||| Sbjct: 520 ctcattaaccttggactcaagtgattcctgatgcgtcaccagagttgggaatttgcctgc 461 Query: 140 cttgntaagacca 152 ||| |||||||| Sbjct: 460 tttgttaagacca 448
>dbj|AK062103.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-A11, full insert sequence Length = 915 Score = 93.7 bits (47), Expect = 1e-16 Identities = 111/133 (83%) Strand = Plus / Minus Query: 20 gccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggt 79 |||||| | |||||||||||| || ||||| |||| |||||| || || || ||||| || Sbjct: 579 gccaacagcaacacccatgcagagaaccttcttcagctggaatttcactgtagccttagt 520 Query: 80 ctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 ||||||||||||||||||||| || ||||| || | ||||| |||||| || || ||||| Sbjct: 519 ctcattaaccttggactcaagtgattcctgatgcgtcaccagagttgggaatttgcctgc 460 Query: 140 cttgntaagacca 152 ||| |||||||| Sbjct: 459 tttgttaagacca 447
>ref|XM_483761.1| Oryza sativa (japonica cultivar-group), mRNA Length = 937 Score = 89.7 bits (45), Expect = 2e-15 Identities = 104/124 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || ||||| || || Sbjct: 568 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcgttgac 509 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||||||| | || Sbjct: 508 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgccttgttgag 449 Query: 149 acca 152 |||| Sbjct: 448 acca 445
>dbj|AK122095.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125C22, full insert sequence Length = 937 Score = 89.7 bits (45), Expect = 2e-15 Identities = 104/124 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || ||||| || || Sbjct: 568 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcgttgac 509 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||||||| | || Sbjct: 508 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgccttgttgag 449 Query: 149 acca 152 |||| Sbjct: 448 acca 445
>dbj|AK071249.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088C14, full insert sequence Length = 982 Score = 89.7 bits (45), Expect = 2e-15 Identities = 104/124 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || ||||| || || Sbjct: 640 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcgttgac 581 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||||||| | || Sbjct: 580 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgccttgttgag 521 Query: 149 acca 152 |||| Sbjct: 520 acca 517
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 85.7 bits (43), Expect = 4e-14 Identities = 94/111 (84%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || |||||||| || Sbjct: 27923980 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcattgac 27923921 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||| Sbjct: 27923920 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgc 27923870 Score = 77.8 bits (39), Expect = 9e-12 Identities = 93/111 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || ||||| || || Sbjct: 27957708 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcgttgac 27957649 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||| Sbjct: 27957648 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgc 27957598
>dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0562A06 Length = 154198 Score = 85.7 bits (43), Expect = 4e-14 Identities = 94/111 (84%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || |||||||| || Sbjct: 1472 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcattgac 1413 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||| Sbjct: 1412 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgc 1362 Score = 77.8 bits (39), Expect = 9e-12 Identities = 93/111 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || ||||| || || Sbjct: 35200 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcgttgac 35141 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||| Sbjct: 35140 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgc 35090
>dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1150_A11 Length = 142010 Score = 85.7 bits (43), Expect = 4e-14 Identities = 94/111 (84%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 |||||||||||| || ||||| |||| |||||||||||| || || || |||||||| || Sbjct: 132058 aacacccatgcacagaaccttcttcagctggaacttgactgtagctttcgtctcattgac 131999 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgc 139 |||||| ||||| ||||||||||||| ||||| || || ||||| ||||| Sbjct: 131998 cttggattcaagagactcctggtgagtaaccaatgtagggaacttgcctgc 131948
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 81.8 bits (41), Expect = 5e-13 Identities = 91/108 (84%) Strand = Plus / Minus Query: 20 gccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggt 79 |||||| | |||||||||||| || ||||| |||| |||||| || || || ||||| || Sbjct: 12870968 gccaacagcaacacccatgcagagaaccttcttcagctggaatttcactgtagccttagt 12870909 Query: 80 ctcattaaccttggactcaagggactcctggtgagacaccaaagttgg 127 ||||||||||||||||||||| || ||||| || | ||||| |||||| Sbjct: 12870908 ctcattaaccttggactcaagtgattcctgatgcgtcaccagagttgg 12870861
>gb|AY846821.1| Triticum aestivum ribosomal protein L10A mRNA, complete cds Length = 788 Score = 81.8 bits (41), Expect = 5e-13 Identities = 103/124 (83%) Strand = Plus / Minus Query: 29 aacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaac 88 ||||||||||||||| ||||| || | |||||||||||| || || || ||||| || || Sbjct: 569 aacacccatgcaaagaaccttctttagctggaacttgactgtagcttttgtctcgttgac 510 Query: 89 cttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaag 148 ||||| ||||| || ||||||||| |||| ||| |||||||| ||||||||| |||| Sbjct: 509 cttggcttcaagagattcctggtgactaaccagagtgggaaacttgcctgccttgttaag 450 Query: 149 acca 152 |||| Sbjct: 449 acca 446
>dbj|AP005612.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0073A18 Length = 176755 Score = 81.8 bits (41), Expect = 5e-13 Identities = 91/108 (84%) Strand = Plus / Minus Query: 20 gccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggt 79 |||||| | |||||||||||| || ||||| |||| |||||| || || || ||||| || Sbjct: 90450 gccaacagcaacacccatgcagagaaccttcttcagctggaatttcactgtagccttagt 90391 Query: 80 ctcattaaccttggactcaagggactcctggtgagacaccaaagttgg 127 ||||||||||||||||||||| || ||||| || | ||||| |||||| Sbjct: 90390 ctcattaaccttggactcaagtgattcctgatgcgtcaccagagttgg 90343
>gb|AY104248.1| Zea mays PCO114889 mRNA sequence Length = 1019 Score = 79.8 bits (40), Expect = 2e-12 Identities = 102/123 (82%) Strand = Plus / Minus Query: 30 acacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaacc 89 |||||||||||||| || || |||| || |||||||| || ||||| |||||||| ||| Sbjct: 567 acacccatgcaaaggactttcttcagttgaaacttgactgtagccttcgtctcattcacc 508 Query: 90 ttggactcaagggactcctggtgagacaccaaagttggaaactttcctgccttgntaaga 149 ||||| || ||||| |||||||||| |||| ||| || ||||| ||||||||| | ||| Sbjct: 507 ttggattccagggattcctggtgagtgaccagagtggggaacttgcctgccttgttgaga 448 Query: 150 cca 152 ||| Sbjct: 447 cca 445
>gb|BT016546.1| Zea mays clone Contig379 mRNA sequence Length = 937 Score = 75.8 bits (38), Expect = 3e-11 Identities = 123/152 (80%) Strand = Plus / Minus Query: 1 tctcctccatacccaggtggccaacggnaacacccatgcaaagcacctttttcaactgga 60 |||||||||| ||| || ||| |||| || ||||||||||| ||||| || | ||||| Sbjct: 585 tctcctccatcgccaagttgccgacggcgacgcccatgcaaaggaccttcttgagctgga 526 Query: 61 acttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagacacca 120 ||||||| || ||||| ||||| || |||||||| || ||||| |||||||||| |||| Sbjct: 525 acttgacggttgccttagtctcgttcaccttggattcgagggattcctggtgagtaacca 466 Query: 121 aagttggaaactttcctgccttgntaagacca 152 || || ||||| ||||||||| | |||||| Sbjct: 465 gggtcgggaacttgcctgccttgttgagacca 434
>gb|AY109405.1| Zea mays CL4809_1 mRNA sequence Length = 1296 Score = 75.8 bits (38), Expect = 3e-11 Identities = 123/152 (80%) Strand = Plus / Minus Query: 1 tctcctccatacccaggtggccaacggnaacacccatgcaaagcacctttttcaactgga 60 |||||||||| ||| || ||| |||| || ||||||||||| ||||| || | ||||| Sbjct: 863 tctcctccatcgccaagttgccgacggcgacgcccatgcaaaggaccttcttgagctgga 804 Query: 61 acttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagacacca 120 ||||||| || ||||| ||||| || |||||||| || ||||| |||||||||| |||| Sbjct: 803 acttgacggttgccttagtctcgttcaccttggattcgagggattcctggtgagtaacca 744 Query: 121 aagttggaaactttcctgccttgntaagacca 152 || || ||||| ||||||||| | |||||| Sbjct: 743 gggtcgggaacttgcctgccttgttgagacca 712
>ref|NM_100709.3| Arabidopsis thaliana structural constituent of ribosome AT1G08360 mRNA, complete cds Length = 930 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 564 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 505 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 504 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 445 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 444 ttgttaagacca 433
>gb|AY114542.1| Arabidopsis thaliana putative ribosomal protein L10 (At1g08360) mRNA, complete cds Length = 714 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 506 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 447 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 446 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 387 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 386 ttgttaagacca 375
>gb|AY065077.1| Arabidopsis thaliana putative ribosomal protein L10 (At1g08360; T27G7.6) mRNA, complete cds Length = 883 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 560 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 501 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 500 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 441 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 440 ttgttaagacca 429
>emb|BX814727.1|CNS0ACAP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 870 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 564 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 505 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 504 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 445 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 444 ttgttaagacca 433
>emb|BX816002.1|CNS0ABUG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH22ZB09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 840 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 536 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 477 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 476 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 417 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 416 ttgttaagacca 405
>emb|BX841788.1|CNS09Y5M Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB6ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 847 Score = 67.9 bits (34), Expect = 8e-09 Identities = 107/132 (81%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| |||||||| || ||||| |||| ||||||||| || || ||||| || Sbjct: 543 ccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctttgtt 484 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| ||||| | ||| |||||||| ||| | |||||| || ||||||||| Sbjct: 483 tcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcctgcc 424 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 423 ttgttaagacca 412
>gb|AY389626.1| Hyacinthus orientalis 60S ribosomal protein L10A (RPL10A) mRNA, partial cds Length = 756 Score = 65.9 bits (33), Expect = 3e-08 Identities = 106/131 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||||||||| || || || | ||| ||||| || | || ||||| Sbjct: 457 ccaacagcaacacccatgcaaagaactttcttgagctgaaacttaaccattgctttggtt 398 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 |||||||| || | ||| | ||| ||||| |||| |||||| || ||||||||||||||| Sbjct: 397 tcattaactttcgcctccaaggattcctgatgagtcaccaatgtaggaaactttcctgcc 338 Query: 141 ttgntaagacc 151 ||| ||||||| Sbjct: 337 ttgttaagacc 327
>gb|DQ160125.1| Taraxacum officinale TO97-3 (To97-3) mRNA, partial cds Length = 310 Score = 65.9 bits (33), Expect = 3e-08 Identities = 77/92 (83%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||| ||||| ||||||||| |||| |||||||||||||| || |||||| Sbjct: 257 ccaacagcaactcccatacaaagcacccccttcagttggaacttgacagttgctttggtc 198 Query: 81 tcattaaccttggactcaagggactcctggtg 112 ||||| ||||| | ||||||||| |||||||| Sbjct: 197 tcattcacctttgcctcaagggattcctggtg 166
>ref|NM_179773.1| Arabidopsis thaliana structural constituent of ribosome AT2G27530 transcript variant AT2G27530.2 mRNA, complete cds Length = 904 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 571 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 512 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 511 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 452 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 451 ttgttaagacca 440
>ref|NM_128313.2| Arabidopsis thaliana structural constituent of ribosome AT2G27530 transcript variant AT2G27530.1 mRNA, complete cds Length = 935 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 602 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 543 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 542 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 483 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 482 ttgttaagacca 471
>gb|AY056371.1| Arabidopsis thaliana putative 60S ribosomal protein L10A (At2g27530) mRNA, complete cds Length = 682 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 506 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 447 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 446 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 387 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 386 ttgttaagacca 375
>gb|AF360146.1| Arabidopsis thaliana putative 60S ribosomal protein L10A (At2g27530) mRNA, complete cds Length = 916 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 567 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 508 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 507 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 448 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 447 ttgttaagacca 436
>gb|AY081263.1| Arabidopsis thaliana 60S ribosomal protein L10A (At2g27530) mRNA, complete cds Length = 891 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 602 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 543 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 542 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 483 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 482 ttgttaagacca 471
>gb|BT006262.1| Arabidopsis thaliana At2g27530 mRNA, complete cds Length = 651 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 506 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 447 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 446 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 387 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 386 ttgttaagacca 375
>emb|BX818761.1|CNS0A9SM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZC01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 850 Score = 60.0 bits (30), Expect = 2e-06 Identities = 106/132 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 545 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 486 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 485 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 426 Query: 141 ttgntaagacca 152 ||| |||||||| Sbjct: 425 ttgttaagacca 414
>emb|BX820970.1|CNS0A84X Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH87ZC06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 840 Score = 58.0 bits (29), Expect = 8e-06 Identities = 105/131 (80%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 545 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 486 Query: 81 tcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcctgcc 140 ||||| ||||| | || | ||||| |||||| ||| | ||||| |||||||||||| Sbjct: 485 tcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcctgcc 426 Query: 141 ttgntaagacc 151 ||| ||||||| Sbjct: 425 ttgttaagacc 415
>dbj|AK108883.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-D09, full insert sequence Length = 1289 Score = 56.0 bits (28), Expect = 3e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 30 acacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcatt 85 ||||||||||| |||||||| |||| ||||||||||| | |||||||||||||| Sbjct: 550 acacccatgcacagcaccttcttcagctggaacttgatggacgccttggtctcatt 495
>emb|AJ439529.1|PSP439529 Polytomella sp. 'Pringsheim 198.80' mRNA for 60S ribosomal protein l10a (r10a gene) Length = 756 Score = 52.0 bits (26), Expect = 5e-04 Identities = 40/45 (88%) Strand = Plus / Minus Query: 22 caacggnaacacccatgcaaagcacctttttcaactggaacttga 66 |||||| ||||||||||||||| ||||| || | ||||||||||| Sbjct: 506 caacggcaacacccatgcaaagaaccttcttaagctggaacttga 462
>dbj|AP006415.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT37I11, TM0302a, complete sequence Length = 96704 Score = 52.0 bits (26), Expect = 5e-04 Identities = 68/82 (82%) Strand = Plus / Plus Query: 33 cccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcattaaccttg 92 |||||||| ||||||||||| | ||| || ||||| | ||||| |||||||||||||| Sbjct: 49655 cccatgcagagcacctttttgagctgaaatttgaccatagccttagtctcattaaccttt 49714 Query: 93 gactcaagggactcctggtgag 114 | |||||||| || ||||||| Sbjct: 49715 gcttcaagggattcttggtgag 49736
>gb|AC006232.4| Arabidopsis thaliana chromosome 2 clone F10A12 map B68, complete sequence Length = 90341 Score = 48.1 bits (24), Expect = 0.008 Identities = 59/71 (83%) Strand = Plus / Plus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 68673 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 68732 Query: 81 tcattaacctt 91 ||||| ||||| Sbjct: 68733 tcattcacctt 68743
>gb|AC005824.3| Arabidopsis thaliana chromosome 2 clone F15K20 map B68, complete sequence Length = 118196 Score = 48.1 bits (24), Expect = 0.008 Identities = 59/71 (83%) Strand = Plus / Minus Query: 21 ccaacggnaacacccatgcaaagcacctttttcaactggaacttgacagtggccttggtc 80 ||||| | ||||||||| || || || || |||||||||||||| || || || |||||| Sbjct: 116000 ccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgctttggtc 115941 Query: 81 tcattaacctt 91 ||||| ||||| Sbjct: 115940 tcattcacctt 115930
>emb|BX005154.6| Zebrafish DNA sequence from clone CH211-288G17 in linkage group 19, complete sequence Length = 164384 Score = 44.1 bits (22), Expect = 0.12 Identities = 22/22 (100%) Strand = Plus / Minus Query: 47 ctttttcaactggaacttgaca 68 |||||||||||||||||||||| Sbjct: 101104 ctttttcaactggaacttgaca 101083
>gb|AF175385.1|AF175385 Chlamydomonas reinhardtii 60S ribosomal protein L10a mRNA, complete cds Length = 688 Score = 44.1 bits (22), Expect = 0.12 Identities = 31/34 (91%) Strand = Plus / Minus Query: 33 cccatgcaaagcacctttttcaactggaacttga 66 |||||||| |||||||| |||| ||||||||||| Sbjct: 490 cccatgcacagcaccttcttcagctggaacttga 457
>emb|CT033109.1| Platynereis dumerilii EST IB0AAA26CC06EM1 Length = 713 Score = 44.1 bits (22), Expect = 0.12 Identities = 31/34 (91%) Strand = Plus / Minus Query: 44 cacctttttcaactggaacttgacagtggccttg 77 ||||||||||| ||||||||||| ||||||||| Sbjct: 493 cacctttttcatctggaacttgatggtggccttg 460
>emb|CT033108.1| Platynereis dumerilii EST IB0AAA26CC06FM1 Length = 713 Score = 44.1 bits (22), Expect = 0.12 Identities = 31/34 (91%) Strand = Plus / Plus Query: 44 cacctttttcaactggaacttgacagtggccttg 77 ||||||||||| ||||||||||| ||||||||| Sbjct: 221 cacctttttcatctggaacttgatggtggccttg 254
>ref|XM_362251.1| Magnaporthe grisea 70-15 hypothetical protein (MG04696.4) partial cds Length = 468 Score = 42.1 bits (21), Expect = 0.47 Identities = 33/37 (89%) Strand = Plus / Minus Query: 30 acacccatgcaaagcacctttttcaactggaacttga 66 ||||||||||| || ||||| |||| ||||||||||| Sbjct: 314 acacccatgcagagaaccttcttcagctggaacttga 278
>gb|AY392166.1| Scyliorhinus canicula ribosomal protein L10a-like mRNA, partial sequence Length = 553 Score = 42.1 bits (21), Expect = 0.47 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttga 66 ||||||||||||| ||||||||||| Sbjct: 459 agcacctttttcatctggaacttga 435
>emb|AM049023.1| Georissus sp. APV-2005 mRNA for ribosomal protein L10Ae (rpL10e gene) Length = 654 Score = 42.1 bits (21), Expect = 0.47 Identities = 27/29 (93%) Strand = Plus / Minus Query: 38 gcaaagcacctttttcaactggaacttga 66 |||||| |||||||||| ||||||||||| Sbjct: 492 gcaaagtacctttttcatctggaacttga 464
>gb|DQ066323.1| Ixodes scapularis isolate IS-6-12L-22 60S ribosomal protein L10a mRNA, complete cds Length = 654 Score = 42.1 bits (21), Expect = 0.47 Identities = 27/29 (93%) Strand = Plus / Minus Query: 38 gcaaagcacctttttcaactggaacttga 66 |||||||||||| |||| ||||||||||| Sbjct: 492 gcaaagcaccttcttcatctggaacttga 464
>emb|CT573502.2| Medicago truncatula chromosome 5 clone mte1-69f21, COMPLETE SEQUENCE Length = 89977 Score = 42.1 bits (21), Expect = 0.47 Identities = 27/29 (93%) Strand = Plus / Minus Query: 72 gccttggtctcattaaccttggactcaag 100 ||||| |||||||||||||||| |||||| Sbjct: 8670 gccttagtctcattaaccttggcctcaag 8642
>gb|AY695059.1| Rattus norvegicus A kinase anchoring protein 12 alpha (Akap12) gene, promoter region and exon 1 Length = 5071 Score = 40.1 bits (20), Expect = 1.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 taaccttggactcaagggactcct 108 ||||||||||||||||||| |||| Sbjct: 1146 taaccttggactcaagggaatcct 1169
>ref|XM_524639.1| PREDICTED: Pan troglodytes LOC469254 (LOC469254), mRNA Length = 1014 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 ttgacagtggccttggtctc 82 |||||||||||||||||||| Sbjct: 203 ttgacagtggccttggtctc 184
>emb|CR388067.9| Zebrafish DNA sequence from clone CH211-169K21 in linkage group 25, complete sequence Length = 163519 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 tttttcaactggaacttgac 67 |||||||||||||||||||| Sbjct: 79699 tttttcaactggaacttgac 79680
>emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chromosome 1, complete sequence Length = 62080 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 ttgacagtggccttggtctc 82 |||||||||||||||||||| Sbjct: 18051 ttgacagtggccttggtctc 18070
>gb|AC105008.5| Homo sapiens chromosome 8, clone CTD-2589E21, complete sequence Length = 172661 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 ctcctccatacccaggtggc 21 |||||||||||||||||||| Sbjct: 143007 ctcctccatacccaggtggc 143026
>gb|AC104952.8| Homo sapiens chromosome 8, clone RP11-141J23, complete sequence Length = 190902 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 ctcctccatacccaggtggc 21 |||||||||||||||||||| Sbjct: 3851 ctcctccatacccaggtggc 3870
>ref|XM_940320.1| PREDICTED: Homo sapiens similar to protein tyrosine phosphatase, receptor type, U isoform 2 precursor (LOC651195), mRNA Length = 2934 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 ttgacagtggccttggtctc 82 |||||||||||||||||||| Sbjct: 587 ttgacagtggccttggtctc 568
>ref|XM_372775.3| PREDICTED: Homo sapiens similar to protein tyrosine phosphatase, receptor type, U isoform 2 precursor (LOC391025), mRNA Length = 2745 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 ttgacagtggccttggtctc 82 |||||||||||||||||||| Sbjct: 587 ttgacagtggccttggtctc 568
>gb|AC139128.6| Mus musculus chromosome 3, clone RP23-100B7, complete sequence Length = 239600 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 124 ttggaaactttcctgcctt 142 ||||||||||||||||||| Sbjct: 85562 ttggaaactttcctgcctt 85580
>gb|AY780794.1| Homo sapiens glutamate-cysteine ligase, catalytic subunit (GCLC) gene, complete cds Length = 51638 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 100 gggactcctggtgagacac 118 ||||||||||||||||||| Sbjct: 46161 gggactcctggtgagacac 46179
>gb|AC102595.9| Mus musculus chromosome 10, clone RP23-360M11, complete sequence Length = 223843 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 112 gagacaccaaagttggaaacttt 134 |||||| |||||||||||||||| Sbjct: 98724 gagacaacaaagttggaaacttt 98702
>gb|AY389923.1| Latimeria chalumnae ribosomal protein L10a mRNA, partial cds Length = 598 Score = 38.2 bits (19), Expect = 7.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtgg 72 |||||||| |||| ||||||||||| ||||| Sbjct: 459 agcaccttcttcatctggaacttgatagtgg 429
>gb|DQ226619.1| Boechera divaricarpa isolate SLW-4-A06 mRNA sequence Length = 634 Score = 38.2 bits (19), Expect = 7.4 Identities = 27/30 (90%) Strand = Plus / Minus Query: 122 agttggaaactttcctgccttgntaagacc 151 |||||| ||||||||||||||| | ||||| Sbjct: 435 agttgggaactttcctgccttgttgagacc 406
>emb|AL033397.7|HS27K12 Human DNA sequence from clone RP1-27K12 on chromosome 6p11.2-12.3 Contains the GCLC gene for glutamate-cysteine ligase catalytic subunit (GCS), a novel gene and one CpG island, complete sequence Length = 164027 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 100 gggactcctggtgagacac 118 ||||||||||||||||||| Sbjct: 44137 gggactcctggtgagacac 44119
>emb|BX053439.1|CNS09DEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 339 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 266 agcaccttcttcatctggaacttgatggtggcctt 300
>emb|BX072048.1|CNS09RR8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 446 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 269 agcaccttcttcatctggaacttgatggtggcctt 303
>emb|BX072047.1|CNS09RR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 771 agcaccttcttcatctggaacttgatggtggcctt 737
>emb|BX071756.1|CNS09RJ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 270 agcaccttcttcatctggaacttgatggtggcctt 304
>emb|BX071755.1|CNS09RJ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 870 agcaccttcttcatctggaacttgatggtggcctt 836
>emb|BX070708.1|CNS09QQ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 416 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 221 agcaccttcttcatctggaacttgatggtggcctt 255
>emb|BX070707.1|CNS09QPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 682 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 494 agcaccttcttcatctggaacttgatggtggcctt 460
>emb|BX070614.1|CNS09QNE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 527 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 242 agcaccttcttcatctggaacttgatggtggcctt 276
>emb|BX060982.1|CNS09J7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 236 agcaccttcttcatctggaacttgatggtggcctt 270
>emb|BX060981.1|CNS09J7T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 743 agcaccttcttcatctggaacttgatggtggcctt 709
>emb|BX069581.1|CNS09PUP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 623 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 260 agcaccttcttcatctggaacttgatggtggcctt 294
>emb|BX069580.1|CNS09PUO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 516 agcaccttcttcatctggaacttgatggtggcctt 482
>emb|BX069267.1|CNS09PLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 787 agcaccttcttcatctggaacttgatggtggcctt 753
>emb|BX068765.1|CNS09P81 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 263 agcaccttcttcatctggaacttgatggtggcctt 297
>emb|BX068764.1|CNS09P80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 764 agcaccttcttcatctggaacttgatggtggcctt 730
>emb|BX067034.1|CNS09NVY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 247 agcaccttcttcatctggaacttgatggtggcctt 281
>emb|BX067033.1|CNS09NVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 599 agcaccttcttcatctggaacttgatggtggcctt 565
>emb|BX066666.1|CNS09NLQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1026 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 260 agcaccttcttcatctggaacttgatggtggcctt 294
>emb|BX066665.1|CNS09NLP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1078 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 776 agcaccttcttcatctggaacttgatggtggcctt 742
>emb|BX065462.1|CNS09MOA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1013 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 253 agcaccttcttcatctggaacttgatggtggcctt 287
>emb|BX065461.1|CNS09MO9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1065 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 764 agcaccttcttcatctggaacttgatggtggcctt 730
>emb|BX065429.1|CNS09MND Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 656 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 269 agcaccttcttcatctggaacttgatggtggcctt 303
>emb|BX065428.1|CNS09MNC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 889 agcaccttcttcatctggaacttgatggtggcctt 855
>emb|BX064407.1|CNS09LUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 281 agcaccttcttcatctggaacttgatggtggcctt 315
>emb|BX064406.1|CNS09LUY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 784 agcaccttcttcatctggaacttgatggtggcctt 750
>emb|BX064040.1|CNS09LKS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 284 agcaccttcttcatctggaacttgatggtggcctt 318
>emb|BX064039.1|CNS09LKR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 784 agcaccttcttcatctggaacttgatggtggcctt 750
>emb|BX063712.1|CNS09LBO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 354 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 193 agcaccttcttcatctggaacttgatggtggcctt 227
>emb|BX063711.1|CNS09LBN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 425 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 322 agcaccttcttcatctggaacttgatggtggcctt 288
>emb|BX062611.1|CNS09KH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 255 agcaccttcttcatctggaacttgatggtggcctt 289
>emb|BX062610.1|CNS09KH2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 755 agcaccttcttcatctggaacttgatggtggcctt 721
>emb|BX062333.1|CNS09K9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 271 agcaccttcttcatctggaacttgatggtggcctt 305
>emb|BX062332.1|CNS09K9C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1079 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 758 agcaccttcttcatctggaacttgatggtggcctt 724
>emb|BX061889.1|CNS09JX1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 266 agcaccttcttcatctggaacttgatggtggcctt 300
>emb|BX061888.1|CNS09JX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 524 agcaccttcttcatctggaacttgatggtggcctt 490
>emb|BX059682.1|CNS09I7Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 259 agcaccttcttcatctggaacttgatggtggcctt 293
>emb|BX059681.1|CNS09I7P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 769 agcaccttcttcatctggaacttgatggtggcctt 735
>emb|BX059289.1|CNS09HWT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 270 agcaccttcttcatctggaacttgatggtggcctt 304
>emb|BX059288.1|CNS09HWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 779 agcaccttcttcatctggaacttgatggtggcctt 745
>emb|BX058910.1|CNS09HMA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 841 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 762 agcaccttcttcatctggaacttgatggtggcctt 728
>emb|BX056669.1|CNS09FW1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 519 agcaccttcttcatctggaacttgatggtggcctt 485
>emb|BX057965.1|CNS09GW1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 286 agcaccttcttcatctggaacttgatggtggcctt 320
>emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 975 agcaccttcttcatctggaacttgatggtggcctt 941
>emb|BX057413.1|CNS09GGP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 245 agcaccttcttcatctggaacttgatggtggcctt 279
>emb|BX057412.1|CNS09GGO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 792 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 752 agcaccttcttcatctggaacttgatggtggcctt 718
>emb|BX056303.1|CNS09FLV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 774 agcaccttcttcatctggaacttgatggtggcctt 740
>emb|BX055435.1|CNS09EXR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 249 agcaccttcttcatctggaacttgatggtggcctt 283
>emb|BX055434.1|CNS09EXQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 513 agcaccttcttcatctggaacttgatggtggcctt 479
>emb|BX053004.1|CNS09D28 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 574 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 277 agcaccttcttcatctggaacttgatggtggcctt 311
>emb|BX053954.1|CNS09DSM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 545 agcaccttcttcatctggaacttgatggtggcctt 511
>emb|BX052455.1|CNS09CMZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 265 agcaccttcttcatctggaacttgatggtggcctt 299
>emb|BX051666.1|CNS09C12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 638 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 259 agcaccttcttcatctggaacttgatggtggcctt 293
>emb|BX051022.1|CNS09BJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 810 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 243 agcaccttcttcatctggaacttgatggtggcctt 277
>emb|BX051021.1|CNS09BJ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 763 agcaccttcttcatctggaacttgatggtggcctt 729
>emb|BX050786.1|CNS09BCM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 481 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 41 agcaccttcttcatctggaacttgatggtggcctt 75
>emb|BX050785.1|CNS09BCL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 786 agcaccttcttcatctggaacttgatggtggcctt 752
>emb|BX050571.1|CNS09B6N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 249 agcaccttcttcatctggaacttgatggtggcctt 283
>emb|BX050570.1|CNS09B6M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 519 agcaccttcttcatctggaacttgatggtggcctt 485
>emb|BX050435.1|CNS09B2V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26DG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 807 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 485 agcaccttcttcatctggaacttgatggtggcctt 451
>emb|BX050016.1|CNS09AR8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX048699.1|CNS099QN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 505 agcaccttcttcatctggaacttgatggtggcctt 471
>emb|BX047504.1|CNS098TG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 429 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 241 agcaccttcttcatctggaacttgatggtggcctt 275
>emb|BX047486.1|CNS098SY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 253 agcaccttcttcatctggaacttgatggtggcctt 287
>emb|BX047485.1|CNS098SX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 748 agcaccttcttcatctggaacttgatggtggcctt 714
>emb|BX047410.1|CNS098QU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 777 agcaccttcttcatctggaacttgatggtggcctt 743
>emb|BX046235.1|CNS097U7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 268 agcaccttcttcatctggaacttgatggtggcctt 302
>emb|BX046234.1|CNS097U6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 889 agcaccttcttcatctggaacttgatggtggcctt 855
>emb|BX045438.1|CNS09782 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 765 agcaccttcttcatctggaacttgatggtggcctt 731
>emb|BX045382.1|CNS0976I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 865 agcaccttcttcatctggaacttgatggtggcctt 831
>emb|BX042925.1|CNS095A9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 272 agcaccttcttcatctggaacttgatggtggcctt 306
>emb|BX042924.1|CNS095A8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 782 agcaccttcttcatctggaacttgatggtggcctt 748
>emb|BX042921.1|CNS095A5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 388 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 86 agcaccttcttcatctggaacttgatggtggcctt 120
>emb|BX042920.1|CNS095A4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 765 agcaccttcttcatctggaacttgatggtggcctt 731
>emb|BX044464.1|CNS096H0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC18AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 365 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 178 agcaccttcttcatctggaacttgatggtggcctt 212
>emb|BX044463.1|CNS096GZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 729 agcaccttcttcatctggaacttgatggtggcctt 695
>emb|BX044228.1|CNS096AG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC17CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 373 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 281 agcaccttcttcatctggaacttgatggtggcctt 315
>emb|BX044077.1|CNS09669 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC17BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 260 agcaccttcttcatctggaacttgatggtggcctt 294
>emb|BX043941.1|CNS0962H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC17AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 529 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 274 agcaccttcttcatctggaacttgatggtggcctt 308
>emb|BX043475.1|CNS095PJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 221 agcaccttcttcatctggaacttgatggtggcctt 255
>emb|BX043474.1|CNS095PI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 869 agcaccttcttcatctggaacttgatggtggcctt 835
>emb|BX043383.1|CNS095MZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 277 agcaccttcttcatctggaacttgatggtggcctt 311
>emb|BX043302.1|CNS095KQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 762 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 545 agcaccttcttcatctggaacttgatggtggcctt 511
>emb|BX042626.1|CNS0951Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC14DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX042625.1|CNS0951X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 872 agcaccttcttcatctggaacttgatggtggcctt 838
>emb|BX042537.1|CNS094ZH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC14CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 696 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 269 agcaccttcttcatctggaacttgatggtggcctt 303
>emb|BX042361.1|CNS094UL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC14BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 256 agcaccttcttcatctggaacttgatggtggcctt 290
>emb|BX039562.1|CNS092OU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC1BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 424 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 281 agcaccttcttcatctggaacttgatggtggcctt 315
>emb|BX039561.1|CNS092OT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 826 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 783 agcaccttcttcatctggaacttgatggtggcctt 749
>emb|BX039004.1|CNS0929C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 670 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 293 agcaccttcttcatctggaacttgatggtggcctt 327
>emb|BX039003.1|CNS0929B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 545 agcaccttcttcatctggaacttgatggtggcctt 511
>emb|BX038956.1|CNS09280 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 309 agcaccttcttcatctggaacttgatggtggcctt 343
>emb|BX038848.1|CNS09250 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 714 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 254 agcaccttcttcatctggaacttgatggtggcctt 288
>emb|BX038847.1|CNS0924Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 547 agcaccttcttcatctggaacttgatggtggcctt 513
>emb|BX038776.1|CNS09230 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 646 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 290 agcaccttcttcatctggaacttgatggtggcctt 324
>emb|BX038775.1|CNS0922Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 545 agcaccttcttcatctggaacttgatggtggcctt 511
>emb|BX038464.1|CNS091UC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 753 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 283 agcaccttcttcatctggaacttgatggtggcctt 317
>emb|BX038463.1|CNS091UB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 744 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 549 agcaccttcttcatctggaacttgatggtggcctt 515
>emb|BX038343.1|CNS091QZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 701 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 288 agcaccttcttcatctggaacttgatggtggcctt 322
>emb|BX038342.1|CNS091QY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 762 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 549 agcaccttcttcatctggaacttgatggtggcctt 515
>emb|BX038198.1|CNS091MY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 255 agcaccttcttcatctggaacttgatggtggcctt 289
>emb|BX038197.1|CNS091MX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 701 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 549 agcaccttcttcatctggaacttgatggtggcctt 515
>emb|BX037774.1|CNS091B6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 308 agcaccttcttcatctggaacttgatggtggcctt 342
>emb|BX037773.1|CNS091B5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 581 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 552 agcaccttcttcatctggaacttgatggtggcctt 518
>emb|BX037611.1|CNS0916N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 687 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 297 agcaccttcttcatctggaacttgatggtggcctt 331
>emb|BX037610.1|CNS0916M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 547 agcaccttcttcatctggaacttgatggtggcctt 513
>emb|BX036037.1|CNS08ZYX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 280 agcaccttcttcatctggaacttgatggtggcctt 314
>emb|BX036036.1|CNS08ZYW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 857 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 531 agcaccttcttcatctggaacttgatggtggcctt 497
>emb|BX035851.1|CNS08ZTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 274 agcaccttcttcatctggaacttgatggtggcctt 308
>emb|BX035850.1|CNS08ZTQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 543 agcaccttcttcatctggaacttgatggtggcctt 509
>emb|BX035713.1|CNS08ZPX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 597 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 267 agcaccttcttcatctggaacttgatggtggcctt 301
>emb|BX035712.1|CNS08ZPW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 715 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 507 agcaccttcttcatctggaacttgatggtggcctt 473
>emb|BX034822.1|CNS08Z16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50DF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 823 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 246 agcaccttcttcatctggaacttgatggtggcctt 280
>emb|BX034639.1|CNS08YW3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 837 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 249 agcaccttcttcatctggaacttgatggtggcctt 283
>emb|BX034638.1|CNS08YW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 579 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 507 agcaccttcttcatctggaacttgatggtggcctt 473
>emb|BX033751.1|CNS08Y7F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 359 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 250 agcaccttcttcatctggaacttgatggtggcctt 284
>emb|BX033511.1|CNS08Y0R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX033510.1|CNS08Y0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 762 agcaccttcttcatctggaacttgatggtggcctt 728
>emb|BX033186.1|CNS08XRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 265 agcaccttcttcatctggaacttgatggtggcctt 299
>emb|BX033185.1|CNS08XRP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 770 agcaccttcttcatctggaacttgatggtggcctt 736
>emb|BX032601.1|CNS08XBH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 276 agcaccttcttcatctggaacttgatggtggcctt 310
>emb|BX032600.1|CNS08XBG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1018 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 783 agcaccttcttcatctggaacttgatggtggcctt 749
>emb|BX031651.1|CNS08WL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 546 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 259 agcaccttcttcatctggaacttgatggtggcctt 293
>emb|BX031650.1|CNS08WL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 751 agcaccttcttcatctggaacttgatggtggcctt 717
>emb|BX031104.1|CNS08W5W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 265 agcaccttcttcatctggaacttgatggtggcctt 299
>emb|BX031103.1|CNS08W5V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1082 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 791 agcaccttcttcatctggaacttgatggtggcctt 757
>emb|BX030459.1|CNS08VNZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 417 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 254 agcaccttcttcatctggaacttgatggtggcctt 288
>emb|BX030458.1|CNS08VNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 522 agcaccttcttcatctggaacttgatggtggcctt 488
>emb|BX030213.1|CNS08VH5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 257 agcaccttcttcatctggaacttgatggtggcctt 291
>emb|BX030212.1|CNS08VH4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 879 agcaccttcttcatctggaacttgatggtggcctt 845
>emb|BX029766.1|CNS08V4Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 754 agcaccttcttcatctggaacttgatggtggcctt 720
>emb|BX029426.1|CNS08UVA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 211 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 14 agcaccttcttcatctggaacttgatggtggcctt 48
>emb|BX029425.1|CNS08UV9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 522 agcaccttcttcatctggaacttgatggtggcctt 488
>emb|BX029209.1|CNS08UP9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 769 agcaccttcttcatctggaacttgatggtggcctt 735
>emb|BX029682.1|CNS08V2E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 277 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 176 agcaccttcttcacctggaacttgatggtggcctt 210
>emb|BX029639.1|CNS08V17 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 516 agcaccttcttcatctggaacttgatggtggcctt 482
>emb|BX029559.1|CNS08UYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 799 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 236 agcaccttcttcatctggaacttgatggtggcctt 270
>emb|BX029558.1|CNS08UYY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 298 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 266 agcaccttcttcatctggaacttgatggtggcctt 232
>emb|BX028822.1|CNS08UEI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 841 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 269 agcaccttcttcatctggaacttgatggtggcctt 303
>emb|BX028678.1|CNS08UAI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX028677.1|CNS08UAH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 776 agcaccttcttcatctggaacttgatggtggcctt 742
>emb|BX028645.1|CNS08U9L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 837 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 260 agcaccttcttcatctggaacttgatggtggcctt 294
>emb|BX028644.1|CNS08U9K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 529 agcaccttcttcatctggaacttgatggtggcctt 495
>emb|BX028137.1|CNS08TVH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 264 agcaccttcttcatctggaacttgatggtggcctt 298
>emb|BX028136.1|CNS08TVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 528 agcaccttcttcatctggaacttgatggtggcctt 494
>emb|BX027589.1|CNS08TG9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 266 agcaccttcttcatctggaacttgatggtggcctt 300
>emb|BX027588.1|CNS08TG8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 527 agcaccttcttcatctggaacttgatggtggcctt 493
>emb|BX027540.1|CNS08TEW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 203 agcaccttcttcatctggaacttgatggtggcctt 237
>emb|BX027539.1|CNS08TEV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 738 agcaccttcttcatctggaacttgatggtggcctt 704
>emb|BX027296.1|CNS08T84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 842 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 260 agcaccttcttcatctggaacttgatggtggcctt 294
>emb|BX027295.1|CNS08T83 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 533 agcaccttcttcatctggaacttgatggtggcctt 499
>emb|BX027262.1|CNS08T76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 431 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 265 agcaccttcttcatctggaacttgatggtggcctt 299
>emb|BX026799.1|CNS08SUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 842 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 246 agcaccttcttcatctggaacttgatggtggcctt 280
>emb|BX026798.1|CNS08SUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 758 agcaccttcttcatctggaacttgatggtggcctt 724
>emb|BX026525.1|CNS08SMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA4DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1028 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX026524.1|CNS08SMO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1059 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 773 agcaccttcttcatctggaacttgatggtggcctt 739
>emb|BX025489.1|CNS08RTX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX025488.1|CNS08RTW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 778 agcaccttcttcatctggaacttgatggtggcctt 744
>emb|BX022728.1|CNS08PP8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 543 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 40 aaagcacctttttcaactg 58 ||||||||||||||||||| Sbjct: 382 aaagcacctttttcaactg 400
>emb|BX024800.1|CNS08RAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 250 agcaccttcttcatctggaacttgatggtggcctt 284
>emb|BX024799.1|CNS08RAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 767 agcaccttcttcatctggaacttgatggtggcctt 733
>emb|BX024449.1|CNS08R11 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 530 agcaccttcttcatctggaacttgatggtggcctt 496
>emb|BX024290.1|CNS08QWM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1009 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 275 agcaccttcttcatctggaacttgatggtggcctt 309
>emb|BX024289.1|CNS08QWL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 889 agcaccttcttcatctggaacttgatggtggcctt 855
>emb|BX023969.1|CNS08QNP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 258 agcaccttcttcatctggaacttgatggtggcctt 292
>emb|BX023968.1|CNS08QNO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 893 agcaccttcttcatctggaacttgatggtggcctt 859
>emb|BX023519.1|CNS08QB7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 276 agcaccttcttcatctggaacttgatggtggcctt 310
>emb|BX023518.1|CNS08QB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 790 agcaccttcttcatctggaacttgatggtggcctt 756
>emb|BX023271.1|CNS08Q4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 532 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 510 agcaccttcttcatctggaacttgatggtggcctt 476
>emb|BX023067.1|CNS08PYN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 250 agcaccttcttcatctggaacttgatggtggcctt 284
>emb|BX023066.1|CNS08PYM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 511 agcaccttcttcatctggaacttgatggtggcctt 477
>emb|BX021977.1|CNS08P4D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 533 agcaccttcttcatctggaacttgatggtggcctt 499
>emb|BX021944.1|CNS08P3G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 241 agcaccttcttcatctggaacttgatggtggcctt 275
>emb|BX021509.1|CNS08ORD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 682 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 287 agcaccttcttcatctggaacttgatggtggcctt 321
>emb|BX021508.1|CNS08ORC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 806 agcaccttcttcatctggaacttgatggtggcctt 772
>emb|BX020783.1|CNS08O77 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 734 agcaccttcttcatctggaacttgatggtggcctt 700
>emb|BX020542.1|CNS08O0I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 186 agcaccttcttcatctggaacttgatggtggcctt 220
>emb|BX020541.1|CNS08O0H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 716 agcaccttcttcatctggaacttgatggtggcctt 682
>emb|BX019213.1|CNS08MZL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 253 agcaccttcttcatctggaacttgatggtggcctt 287
>emb|BX019212.1|CNS08MZK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 539 agcaccttcttcatctggaacttgatggtggcctt 505
>emb|BX019180.1|CNS08MYO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 305 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 156 agcaccttcttcatctggaacttgatggtggcctt 122
>emb|BX018566.1|CNS08MHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA28AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 355 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 294 agcaccttcttcatctggaacttgatggtggcctt 328
>emb|BX018565.1|CNS08MHL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 546 agcaccttcttcatctggaacttgatggtggcctt 512
>emb|BX018504.1|CNS08MFW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA28AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Plus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 282 agcaccttcttcatctggaacttgatggtggcctt 316
>emb|BX018503.1|CNS08MFV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1054 Score = 38.2 bits (19), Expect = 7.4 Identities = 31/35 (88%) Strand = Plus / Minus Query: 42 agcacctttttcaactggaacttgacagtggcctt 76 |||||||| |||| ||||||||||| |||||||| Sbjct: 779 agcaccttcttcatctggaacttgatggtggcctt 745 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,123,176 Number of Sequences: 3902068 Number of extensions: 1123176 Number of successful extensions: 74621 Number of sequences better than 10.0: 311 Number of HSP's better than 10.0 without gapping: 311 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 74234 Number of HSP's gapped (non-prelim): 386 length of query: 154 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 132 effective length of database: 17,147,199,772 effective search space: 2263430369904 effective search space used: 2263430369904 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
