Clone Name | rbasd20h22 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_464885.1| Oryza sativa (japonica cultivar-group), mRNA Length = 919 Score = 448 bits (226), Expect = e-123 Identities = 365/412 (88%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 656 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 597 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| ||||||||||||||||||||||||||| | ||||| || Sbjct: 596 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagac 537 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 ||||||||||| ||| |||||||||| ||||| | |||||||||||||||||||||||| Sbjct: 536 tatcactttatcatcccgtccctgttcctcaaccactgcatgaacagcagcattggtcac 477 Query: 215 cactggcatgccaatataagctttgtctctagttgacactagtagtaccttgttcaaaat 274 ||||||||||||||| ||||| |||||||||||||| || |||| ||||||||| || || Sbjct: 476 cactggcatgccaatgtaagccttgtctctagttgataccagtaataccttgtttaatat 417 Query: 275 gatctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcat 334 ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| Sbjct: 416 tatctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcat 357 Query: 335 cacaatgtattgtctggacccaatcatgacaacggcgaagatgtcggcatccttccccgc 394 ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 356 cacaatgtactgtctcgacccaatcatgacaacggcgaagatgtcggcgtccttcccggc 297 Query: 395 gccagcagcagccagctgcacctnaacaggctccggaaccgcggcatcctct 446 ||| || || || | |||| ||| ||||||||||| ||||| || |||||| Sbjct: 296 gcccgcggctgcgatctgcgcctccacaggctccggcaccgcagcctcctct 245
>ref|XM_506768.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0060K08.25 mRNA Length = 940 Score = 448 bits (226), Expect = e-123 Identities = 365/412 (88%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 677 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 618 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| ||||||||||||||||||||||||||| | ||||| || Sbjct: 617 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagac 558 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 ||||||||||| ||| |||||||||| ||||| | |||||||||||||||||||||||| Sbjct: 557 tatcactttatcatcccgtccctgttcctcaaccactgcatgaacagcagcattggtcac 498 Query: 215 cactggcatgccaatataagctttgtctctagttgacactagtagtaccttgttcaaaat 274 ||||||||||||||| ||||| |||||||||||||| || |||| ||||||||| || || Sbjct: 497 cactggcatgccaatgtaagccttgtctctagttgataccagtaataccttgtttaatat 438 Query: 275 gatctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcat 334 ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| Sbjct: 437 tatctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcat 378 Query: 335 cacaatgtattgtctggacccaatcatgacaacggcgaagatgtcggcatccttccccgc 394 ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 377 cacaatgtactgtctcgacccaatcatgacaacggcgaagatgtcggcgtccttcccggc 318 Query: 395 gccagcagcagccagctgcacctnaacaggctccggaaccgcggcatcctct 446 ||| || || || | |||| ||| ||||||||||| ||||| || |||||| Sbjct: 317 gcccgcggctgcgatctgcgcctccacaggctccggcaccgcagcctcctct 266
>dbj|AK104384.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-D06, full insert sequence Length = 919 Score = 448 bits (226), Expect = e-123 Identities = 365/412 (88%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 656 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 597 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| ||||||||||||||||||||||||||| | ||||| || Sbjct: 596 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagac 537 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 ||||||||||| ||| |||||||||| ||||| | |||||||||||||||||||||||| Sbjct: 536 tatcactttatcatcccgtccctgttcctcaaccactgcatgaacagcagcattggtcac 477 Query: 215 cactggcatgccaatataagctttgtctctagttgacactagtagtaccttgttcaaaat 274 ||||||||||||||| ||||| |||||||||||||| || |||| ||||||||| || || Sbjct: 476 cactggcatgccaatgtaagccttgtctctagttgataccagtaataccttgtttaatat 417 Query: 275 gatctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcat 334 ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| Sbjct: 416 tatctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcat 357 Query: 335 cacaatgtattgtctggacccaatcatgacaacggcgaagatgtcggcatccttccccgc 394 ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 356 cacaatgtactgtctcgacccaatcatgacaacggcgaagatgtcggcgtccttcccggc 297 Query: 395 gccagcagcagccagctgcacctnaacaggctccggaaccgcggcatcctct 446 ||| || || || | |||| ||| ||||||||||| ||||| || |||||| Sbjct: 296 gcccgcggctgcgatctgcgcctccacaggctccggcaccgcagcctcctct 245
>dbj|AK064863.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000I04, full insert sequence Length = 940 Score = 448 bits (226), Expect = e-123 Identities = 365/412 (88%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 677 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 618 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| ||||||||||||||||||||||||||| | ||||| || Sbjct: 617 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagac 558 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 ||||||||||| ||| |||||||||| ||||| | |||||||||||||||||||||||| Sbjct: 557 tatcactttatcatcccgtccctgttcctcaaccactgcatgaacagcagcattggtcac 498 Query: 215 cactggcatgccaatataagctttgtctctagttgacactagtagtaccttgttcaaaat 274 ||||||||||||||| ||||| |||||||||||||| || |||| ||||||||| || || Sbjct: 497 cactggcatgccaatgtaagccttgtctctagttgataccagtaataccttgtttaatat 438 Query: 275 gatctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcat 334 ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| Sbjct: 437 tatctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcat 378 Query: 335 cacaatgtattgtctggacccaatcatgacaacggcgaagatgtcggcatccttccccgc 394 ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 377 cacaatgtactgtctcgacccaatcatgacaacggcgaagatgtcggcgtccttcccggc 318 Query: 395 gccagcagcagccagctgcacctnaacaggctccggaaccgcggcatcctct 446 ||| || || || | |||| ||| ||||||||||| ||||| || |||||| Sbjct: 317 gcccgcggctgcgatctgcgcctccacaggctccggcaccgcagcctcctct 266
>gb|AY104304.1| Zea mays PCO077438 mRNA sequence Length = 963 Score = 416 bits (210), Expect = e-113 Identities = 355/404 (87%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 ||||||||| ||||||||||| || || |||||||||||||| || ||||||||||| || Sbjct: 683 aagtattgggtcagcagggtactcttcgtatccacttatgcctgtgattcttaaccttgt 624 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| |||||||||||||||||||||||||||| ||||||| || Sbjct: 623 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttgtacttgaacac 564 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 || |||||||| ||| |||||||||||||||| | ||| |||||||||||||||||||| Sbjct: 563 tataactttatcatcccgtccctgttcttcaaccactgcgtgaacagcagcattggtcac 504 Query: 215 cactggcatgccaatataagctttgtctctagttgacactagtagtaccttgttcaaaat 274 ||||||||| ||||| |||||||| |||||||||||||| ||||| |||||||| || || Sbjct: 503 cactggcatcccaatgtaagctttttctctagttgacaccagtagcaccttgtttaatat 444 Query: 275 gatctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcat 334 ||||||||||||||||||||| |||||| ||||| ||||||||||||| || ||||| Sbjct: 443 gatctgatcattgacattggcacctttcagtctctgtgtgtatatatacctgcccggcat 384 Query: 335 cacaatgtattgtctggacccaatcatgacaacggcgaagatgtcggcatccttccccgc 394 ||||||||||||||| || |||||||||||||| |||||||||||||| |||||||| || Sbjct: 383 cacaatgtattgtcttgaaccaatcatgacaacagcgaagatgtcggcgtccttcccagc 324 Query: 395 gccagcagcagccagctgcacctnaacaggctccggaaccgcgg 438 || || || || |||||| ||| || |||||||| ||||||| Sbjct: 323 ccccgcggcggcgagctgcgcctctacgggctccggtaccgcgg 280
>dbj|AK062182.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D10, full insert sequence Length = 543 Score = 262 bits (132), Expect = 9e-67 Identities = 195/216 (90%) Strand = Plus / Minus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 218 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 159 Query: 95 atttggctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaac 154 |||||||||||||||||| ||||||||||||||||||||||||||| | ||||| || Sbjct: 158 gtttggctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagac 99 Query: 155 aatcactttatcgtccagtccctgttcttcaacaattgcatgaacagcagcattggtcac 214 ||||||||||| ||| |||||||||| ||||| | |||||||||||||||||||||||| Sbjct: 98 tatcactttatcatcccgtccctgttcctcaaccactgcatgaacagcagcattggtcac 39 Query: 215 cactggcatgccaatataagctttgtctctagttga 250 ||||||||||||||| ||||| |||||||||||||| Sbjct: 38 cactggcatgccaatgtaagccttgtctctagttga 3
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 123 bits (62), Expect = 5e-25 Identities = 86/94 (91%) Strand = Plus / Plus Query: 175 cctgttcttcaacaattgcatgaacagcagcattggtcaccactggcatgccaatataag 234 ||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 9005030 cctgttcctcaaccactgcatgaacagcagcattggtcaccactggcatgccaatgtaag 9005089 Query: 235 ctttgtctctagttgacactagtagtaccttgtt 268 | |||||||||||||| || |||| ||||||||| Sbjct: 9005090 ccttgtctctagttgataccagtaataccttgtt 9005123 Score = 109 bits (55), Expect = 8e-21 Identities = 75/82 (91%) Strand = Plus / Plus Query: 278 ctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcatcac 337 ||||||||||||||||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 9005681 ctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcatcac 9005740 Query: 338 aatgtattgtctggacccaatc 359 |||||| ||||| ||||||||| Sbjct: 9005741 aatgtactgtctcgacccaatc 9005762 Score = 83.8 bits (42), Expect = 5e-13 Identities = 69/78 (88%) Strand = Plus / Plus Query: 101 ctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaacaatcac 160 ||||||||||||| ||||||||||||||||||||||||||| | ||||| || ||||| Sbjct: 9004873 ctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagactatcac 9004932 Query: 161 tttatcgtccagtccctg 178 |||||| ||| ||||||| Sbjct: 9004933 tttatcatcccgtccctg 9004950 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 9004688 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 9004747 Query: 95 atttggctg 103 |||||||| Sbjct: 9004748 gtttggctg 9004756 Score = 73.8 bits (37), Expect = 4e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 359 catgacaacggcgaagatgtcggcatccttccccgcgccagcagcagccagctgcacctn 418 |||||||||||||||||||||||| |||||||| ||||| || || || | |||| ||| Sbjct: 9006233 catgacaacggcgaagatgtcggcgtccttcccggcgcccgcggctgcgatctgcgcctc 9006292 Query: 419 aacaggctccggaaccgcggcatcctct 446 ||||||||||| ||||| || |||||| Sbjct: 9006293 cacaggctccggcaccgcagcctcctct 9006320
>dbj|AP006160.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1178F07 Length = 144454 Score = 123 bits (62), Expect = 5e-25 Identities = 86/94 (91%) Strand = Plus / Plus Query: 175 cctgttcttcaacaattgcatgaacagcagcattggtcaccactggcatgccaatataag 234 ||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 45476 cctgttcctcaaccactgcatgaacagcagcattggtcaccactggcatgccaatgtaag 45535 Query: 235 ctttgtctctagttgacactagtagtaccttgtt 268 | |||||||||||||| || |||| ||||||||| Sbjct: 45536 ccttgtctctagttgataccagtaataccttgtt 45569 Score = 109 bits (55), Expect = 8e-21 Identities = 75/82 (91%) Strand = Plus / Plus Query: 278 ctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcatcac 337 ||||||||||||||||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 46127 ctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcatcac 46186 Query: 338 aatgtattgtctggacccaatc 359 |||||| ||||| ||||||||| Sbjct: 46187 aatgtactgtctcgacccaatc 46208 Score = 83.8 bits (42), Expect = 5e-13 Identities = 69/78 (88%) Strand = Plus / Plus Query: 101 ctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaacaatcac 160 ||||||||||||| ||||||||||||||||||||||||||| | ||||| || ||||| Sbjct: 45319 ctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagactatcac 45378 Query: 161 tttatcgtccagtccctg 178 |||||| ||| ||||||| Sbjct: 45379 tttatcatcccgtccctg 45396 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 45134 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 45193 Query: 95 atttggctg 103 |||||||| Sbjct: 45194 gtttggctg 45202 Score = 73.8 bits (37), Expect = 4e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 359 catgacaacggcgaagatgtcggcatccttccccgcgccagcagcagccagctgcacctn 418 |||||||||||||||||||||||| |||||||| ||||| || || || | |||| ||| Sbjct: 46679 catgacaacggcgaagatgtcggcgtccttcccggcgcccgcggctgcgatctgcgcctc 46738 Query: 419 aacaggctccggaaccgcggcatcctct 446 ||||||||||| ||||| || |||||| Sbjct: 46739 cacaggctccggcaccgcagcctcctct 46766
>dbj|AP005803.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0060K08 Length = 159626 Score = 123 bits (62), Expect = 5e-25 Identities = 86/94 (91%) Strand = Plus / Plus Query: 175 cctgttcttcaacaattgcatgaacagcagcattggtcaccactggcatgccaatataag 234 ||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 77639 cctgttcctcaaccactgcatgaacagcagcattggtcaccactggcatgccaatgtaag 77698 Query: 235 ctttgtctctagttgacactagtagtaccttgtt 268 | |||||||||||||| || |||| ||||||||| Sbjct: 77699 ccttgtctctagttgataccagtaataccttgtt 77732 Score = 109 bits (55), Expect = 8e-21 Identities = 75/82 (91%) Strand = Plus / Plus Query: 278 ctgatcattgacattggcgtntttcagcctctgcgtgtatatataccgaccgggcatcac 337 ||||||||||||||||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 78290 ctgatcattgacattggcgcctttcagcctctgcgtgtatatataccttccaggcatcac 78349 Query: 338 aatgtattgtctggacccaatc 359 |||||| ||||| ||||||||| Sbjct: 78350 aatgtactgtctcgacccaatc 78371 Score = 83.8 bits (42), Expect = 5e-13 Identities = 69/78 (88%) Strand = Plus / Plus Query: 101 ctgtctgtgaccagctttcctctggtacttcttcttcttcttgaacttgaaaacaatcac 160 ||||||||||||| ||||||||||||||||||||||||||| | ||||| || ||||| Sbjct: 77482 ctgtctgtgaccaagtttcctctggtacttcttcttcttcttatatttgaagactatcac 77541 Query: 161 tttatcgtccagtccctg 178 |||||| ||| ||||||| Sbjct: 77542 tttatcatcccgtccctg 77559 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Plus Query: 35 aagtattggatcagcagggtattcctcatatccacttatgccggtaattcttaacctcgt 94 |||||| || ||||||||| | ||||| ||||||||||||||||||||||||||||| || Sbjct: 77297 aagtatcgggtcagcagggaagtcctcgtatccacttatgccggtaattcttaaccttgt 77356 Query: 95 atttggctg 103 |||||||| Sbjct: 77357 gtttggctg 77365 Score = 73.8 bits (37), Expect = 4e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 359 catgacaacggcgaagatgtcggcatccttccccgcgccagcagcagccagctgcacctn 418 |||||||||||||||||||||||| |||||||| ||||| || || || | |||| ||| Sbjct: 78842 catgacaacggcgaagatgtcggcgtccttcccggcgcccgcggctgcgatctgcgcctc 78901 Query: 419 aacaggctccggaaccgcggcatcctct 446 ||||||||||| ||||| || |||||| Sbjct: 78902 cacaggctccggcaccgcagcctcctct 78929
>ref|NM_103272.2| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT1G35680 mRNA, complete cds Length = 859 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 623 ccggtaatcctaatcctcgtattcggctgtctgtgacc 586
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttcttgaact 147 ||||||||||| |||||||||||||| Sbjct: 1033108 ctggtacttctgcttcttcttgaact 1033083
>ref|XM_714679.1| Candida albicans SC5314 hypothetical protein (CaO19_14085), mRNA Length = 1098 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 117 ttcctctggtacttcttcttcttctt 142 |||||||||| ||||||||||||||| Sbjct: 438 ttcctctggttcttcttcttcttctt 413
>ref|XM_714796.1| Candida albicans SC5314 hypothetical protein (CaO19_6793), mRNA Length = 1098 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 117 ttcctctggtacttcttcttcttctt 142 |||||||||| ||||||||||||||| Sbjct: 438 ttcctctggttcttcttcttcttctt 413
>ref|XM_838259.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1176) partial mRNA Length = 1488 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttcttgaact 147 ||||||||||| |||||||||||||| Sbjct: 393 ctggtacttctgcttcttcttgaact 368
>gb|AC145329.35| Medicago truncatula clone mth2-8i21, complete sequence Length = 123357 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 117 ttcctctggtacttcttcttcttctt 142 |||||||||| ||||||||||||||| Sbjct: 48488 ttcctctggttcttcttcttcttctt 48513
>gb|AY116944.1| Arabidopsis thaliana At1g35680/F15O4_7 mRNA, complete cds Length = 663 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 599 ccggtaatcctaatcctcgtattcggctgtctgtgacc 562
>gb|AC010377.7| Homo sapiens chromosome 5 clone CTD-2060J20, complete sequence Length = 139476 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttcttgaact 147 ||||| |||||||||||||||||||| Sbjct: 56810 ctggttcttcttcttcttcttgaact 56785
>gb|AC008966.9| Homo sapiens chromosome 5 clone CTD-2366F13, complete sequence Length = 174831 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttcttgaact 147 ||||| |||||||||||||||||||| Sbjct: 7821 ctggttcttcttcttcttcttgaact 7796
>gb|AY058118.1| Arabidopsis thaliana At1g35680/F15O4_7 mRNA, complete cds Length = 801 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 623 ccggtaatcctaatcctcgtattcggctgtctgtgacc 586
>gb|AF428363.1|AF428363 Arabidopsis thaliana At1g35680/F15O4_7 mRNA, complete cds Length = 835 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 623 ccggtaatcctaatcctcgtattcggctgtctgtgacc 586
>emb|BX815055.1|CNS0ABFB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS2ZC03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 818 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 609 ccggtaatcctaatcctcgtattcggctgtctgtgacc 572
>dbj|AB154357.1| Hordeum bulbosum GBSSI gene for granule bound starch synthase I, complete cds Length = 5275 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaacttg 149 |||||||||||||||||||||| Sbjct: 917 cttcttcttcttcttgaacttg 896
>emb|Z49787.1|ATRPL21MR A.thaliana rpl21 mRNA for chloroplast ribosomal large subunit protein L21 Length = 850 Score = 44.1 bits (22), Expect = 0.39 Identities = 34/38 (89%) Strand = Plus / Minus Query: 75 ccggtaattcttaacctcgtatttggctgtctgtgacc 112 |||||||| || | ||||||||| |||||||||||||| Sbjct: 622 ccggtaatcctaatcctcgtattcggctgtctgtgacc 585
>ref|XM_639843.1| Dictyostelium discoideum Ras GTPase (DDB0229437), partial mRNA Length = 618 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 123 tggtacttcttcttcttcttgaact 147 |||||||||||||||||||| |||| Sbjct: 387 tggtacttcttcttcttctttaact 363
>ref|XM_592033.2| PREDICTED: Bos taurus similar to Putative MAP kinase-activating protein C22orf5 (Putative MAPK-activating protein FM08) (LOC514220), mRNA Length = 1541 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 384 tccttccccgcgccagcagcagcca 408 ||||||||| ||||||||||||||| Sbjct: 1412 tccttccccccgccagcagcagcca 1388
>gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, complete sequence Length = 228842 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 96820 cttcttcttcttcttgaactt 96800
>ref|XM_706653.1| Candida albicans SC5314 putative protein kinase (CaO19.10297), mRNA Length = 2517 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttctt 142 ||||||||||||||||||||| Sbjct: 1330 ctggtacttcttcttcttctt 1310
>ref|XM_706631.1| Candida albicans SC5314 putative protein kinase (CaO19.2781), mRNA Length = 2517 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ctggtacttcttcttcttctt 142 ||||||||||||||||||||| Sbjct: 1330 ctggtacttcttcttcttctt 1310
>emb|Z46241.2|CEC38D4 Caenorhabditis elegans Cosmid C38D4, complete sequence Length = 32776 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 9137 cttcttcttcttcttgaactt 9117
>ref|XM_644173.1| Entamoeba histolytica HM-1:IMSS conserved hypothetical protein (325.t00009) partial mRNA Length = 1383 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 571 cttcttcttcttcttgaactt 551
>ref|XM_644179.1| Entamoeba histolytica HM-1:IMSS conserved hypothetical protein (325.t00010) partial mRNA Length = 1383 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 571 cttcttcttcttcttgaactt 551
>emb|AL078630.1|MM573K1 Mouse DNA sequence from clone CT7-BM573K1 on chromosome 17 Contains the gene for gamma-aminobutyric acid (GABA) B receptor 1, five genes for novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) proteins, the gene for a novel Ulp1 protease family member, a Ulp1 protease family pseudogene, a novel pseudogene, a Von Hippel-Lindau disease tumor suppressor (VHL) pseudogene, a 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) pseudogene, the gene for diubiquitin and three CpG islands, complete sequence Length = 154614 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 13168 cttcttcttcttcttgaactt 13188
>emb|AL596181.10| Mouse DNA sequence from clone RP23-234K24 on chromosome 11 Contains nine novel genes, the Trpv2 for member 2 transient receptor potential cation channel subfamily V, the Ubb gene for ubiquitin B, the 3' end of the gene for the ortholog of human and rat phosphatidylinositol glycan class L PIGL and five CpG islands, complete sequence Length = 195339 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 231 taagctttgtctctagttgacacta 255 |||||||||||||||| |||||||| Sbjct: 20264 taagctttgtctctaggtgacacta 20288
>gb|AC157978.25| Medicago truncatula clone mth2-47l16, complete sequence Length = 125021 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 120635 cttcttcttcttcttgaactt 120655
>ref|NM_065586.3| Caenorhabditis elegans C38D4.3 (C38D4.3) mRNA, complete cds Length = 5452 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 4715 cttcttcttcttcttgaactt 4695
>emb|BX682234.9| Zebrafish DNA sequence from clone CH211-193E13, complete sequence Length = 165319 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 115655 cttcttcttcttcttgaactt 115675
>gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 from the MHC region, complete sequence Length = 153869 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 cttcttcttcttcttgaactt 148 ||||||||||||||||||||| Sbjct: 131214 cttcttcttcttcttgaactt 131234
>gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047-5455781 strain AX4, complete sequence Length = 254733 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 123 tggtacttcttcttcttcttgaact 147 |||||||||||||||||||| |||| Sbjct: 10679 tggtacttcttcttcttctttaact 10703
>gb|AY190946.1| Drosophila pseudoobscura clone DPSF01_27_F17 (D1456) genomic sequence Length = 44117 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 115 ctttcctctggtacttcttcttcttcttg 143 |||||||||| | |||||||||||||||| Sbjct: 24721 ctttcctctgattcttcttcttcttcttg 24693
>emb|AL110504.6|CNS01DRB Human chromosome 14 DNA sequence BAC R-688G15 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 207117 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 118 tcctctggtacttcttcttcttctt 142 ||||||||| ||||||||||||||| Sbjct: 118078 tcctctggttcttcttcttcttctt 118054
>gb|AC108424.14| Mus musculus chromosome 7, clone RP23-105A10, complete sequence Length = 198191 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 ttcttcttcttcttgaactt 148 |||||||||||||||||||| Sbjct: 76506 ttcttcttcttcttgaactt 76525
>ref|NM_119728.2| Arabidopsis thaliana PSAT; phosphoserine transaminase/ transaminase AT4G35630 (PSAT) mRNA, complete cds Length = 1664 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1167 cagctttcctctggttcttcttct 1144
>ref|NM_119729.3| Arabidopsis thaliana ATSERAT3;2; acetyltransferase/ serine O-acetyltransferase AT4G35640 (ATSERAT3;2) mRNA, complete cds Length = 2251 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1978 cagctttcctctggttcttcttct 2001
>ref|NM_125623.2| Arabidopsis thaliana ion channel AT5G62290 mRNA, complete cds Length = 930 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 553 cttcttcttcttcttgaact 534
>ref|NM_112374.2| Arabidopsis thaliana unknown protein AT3G15115 mRNA, complete cds Length = 1384 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 126 tacttcttcttcttcttgaacttg 149 ||||||||||||||||| |||||| Sbjct: 281 tacttcttcttcttcttcaacttg 304
>ref|NM_119171.1| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding AT4G30250 mRNA, complete cds Length = 1539 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 117 ttcctctggtacttcttcttcttcttga 144 |||||||| | ||||||||||||||||| Sbjct: 1440 ttcctctgcttcttcttcttcttcttga 1413
>ref|NM_127317.2| Arabidopsis thaliana phosphoserine transaminase/ transaminase AT2G17630 mRNA, complete cds Length = 1472 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1049 cagctttcctctggttcttcttct 1026
>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete sequence Length = 271546 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 ttcttcttcttcttgaactt 148 |||||||||||||||||||| Sbjct: 186617 ttcttcttcttcttgaactt 186598 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 ttcttcttcttcttgaactt 148 |||||||||||||||||||| Sbjct: 186491 ttcttcttcttcttgaactt 186472
>gb|AY785069.1| Bicyclus anynana clone BA-CA5 microsatellite sequence Length = 609 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 cttcttcttcttcttgaacttgaa 151 |||||||||||||||| ||||||| Sbjct: 562 cttcttcttcttcttgtacttgaa 585
>gb|AE012983.1| Thermoanaerobacter tengcongensis MB4, section 10 of 244 of the complete genome Length = 14517 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 222 atgccaatataagctttgtc 241 |||||||||||||||||||| Sbjct: 3991 atgccaatataagctttgtc 3972
>gb|AF202180.3| Plasmodium falciparum erythrocyte membrane-associated giant protein antigen 332 gene, complete cds Length = 16377 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 ttcttcttcttcttgaactt 148 |||||||||||||||||||| Sbjct: 1242 ttcttcttcttcttgaactt 1223 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 129 ttcttcttcttcttgaactt 148 |||||||||||||||||||| Sbjct: 1116 ttcttcttcttcttgaactt 1097
>ref|NM_020637.1| Homo sapiens fibroblast growth factor 22 (FGF22), mRNA Length = 513 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 49 cccgcgccagcagcagccag 30
>gb|AC154508.2| Mus musculus BAC clone RP24-96P6 from chromosome 16, complete sequence Length = 214625 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 tggtacttcttcttcttctt 142 |||||||||||||||||||| Sbjct: 211232 tggtacttcttcttcttctt 211251
>ref|XM_808789.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511553.140) partial mRNA Length = 1584 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 ggtacttcttcttcttcttg 143 |||||||||||||||||||| Sbjct: 377 ggtacttcttcttcttcttg 358
>gb|AC123853.2| Mus musculus BAC clone RP23-326J1 from chromosome 19, complete sequence Length = 205768 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 252 actagtagtaccttgttcaa 271 |||||||||||||||||||| Sbjct: 78858 actagtagtaccttgttcaa 78877
>gb|AY426986.1| Homo sapiens fibroblast growth factor 22 (FGF22) gene, complete cds Length = 6160 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 1118 cccgcgccagcagcagccag 1099
>gb|AY359084.1| Homo sapiens DNA108912 FGF22 (UNQ2500) mRNA, complete cds Length = 520 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 55 cccgcgccagcagcagccag 36
>gb|AC115768.9| Mus musculus chromosome 19, clone RP23-107E10, complete sequence Length = 212161 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 agtccctgttcttcaacaat 190 |||||||||||||||||||| Sbjct: 124665 agtccctgttcttcaacaat 124684
>gb|AC101848.8| Mus musculus chromosome 1, clone RP23-267J24, complete sequence Length = 218654 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 tggtacttcttcttcttctt 142 |||||||||||||||||||| Sbjct: 49257 tggtacttcttcttcttctt 49276
>gb|AC146329.19| Medicago truncatula clone mth2-5i21, complete sequence Length = 142834 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 71032 cttcttcttcttcttgaact 71013
>gb|BC041334.2| Homo sapiens cDNA clone IMAGE:5277044, with apparent retained intron Length = 1712 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 96 cccgcgccagcagcagccag 77
>emb|AL159999.15| Human DNA sequence from clone RP11-8I8 on chromosome 9 Contains a phosphoribosylaminoimidazole carboxylase (PAICS) pseudogene and the 3' end of one variant of the ROR2 gene for receptor tyrosine kinase-like orphan receptor 2, complete sequence Length = 99959 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 118 tcctctggtacttcttcttcttct 141 ||||||| |||||||||||||||| Sbjct: 95581 tcctctgctacttcttcttcttct 95558
>ref|XM_965573.1| PREDICTED: Tribolium castaneum similar to CG7368-PA (LOC659248), mRNA Length = 1482 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 116 tttcctctggtacttcttcttcttcttg 143 |||| ||| ||||||||||||||||||| Sbjct: 861 tttcttcttgtacttcttcttcttcttg 834
>gb|AC154509.2| Mus musculus BAC clone RP23-207P21 from chromosome 16, complete sequence Length = 203692 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 tggtacttcttcttcttctt 142 |||||||||||||||||||| Sbjct: 67388 tggtacttcttcttcttctt 67369
>emb|AL109796.1|ATF9N11 Arabidopsis thaliana DNA chromosome 4, BAC clone F9N11 Length = 87635 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 117 ttcctctggtacttcttcttcttcttga 144 |||||||| | ||||||||||||||||| Sbjct: 77991 ttcctctgcttcttcttcttcttcttga 78018
>emb|AL161587.2|ATCHRIV83 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 83 Length = 197859 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 169843 cagctttcctctggttcttcttct 169820
>emb|AL161576.2|ATCHRIV72 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 72 Length = 198924 Score = 40.1 bits (20), Expect = 6.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 117 ttcctctggtacttcttcttcttcttga 144 |||||||| | ||||||||||||||||| Sbjct: 151012 ttcctctgcttcttcttcttcttcttga 151039
>emb|AL031135.1|ATF8D20 Arabidopsis thaliana DNA chromosome 4, BAC clone F8D20 (ESSAII project) Length = 94315 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 49083 cagctttcctctggttcttcttct 49060
>emb|AJ440777.1|XLA440777 Xenopus laevis mRNA for Fast-3 protein Length = 1236 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 120 ctctggtacttcttcttcttcttg 143 |||||||| ||||||||||||||| Sbjct: 229 ctctggtagttcttcttcttcttg 206
>emb|AL691431.20| Mouse DNA sequence from clone RP23-257P7 on chromosome 4 Contains the 5' end of a novel gene (2810031P15Rik), a ribosomal protein L10 (Rpl10) pseudogene, a ribosomal protein S6 (Rps6) pseudogene and two CpG islands, complete sequence Length = 199847 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 118 tcctctggtacttcttcttcttct 141 ||||||| |||||||||||||||| Sbjct: 20528 tcctctgttacttcttcttcttct 20551
>gb|AY128340.1| Arabidopsis thaliana phosphoserine aminotransferase (At4g35630) mRNA, complete cds Length = 1474 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1082 cagctttcctctggttcttcttct 1059
>gb|AC092124.2| Homo sapiens chromosome 16 clone RP11-1079H2, complete sequence Length = 197992 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 tgtctgtgaccagctttcct 121 |||||||||||||||||||| Sbjct: 119332 tgtctgtgaccagctttcct 119313
>gb|AC104626.3| Drosophila melanogaster X BAC RP98-28L7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184454 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 180938 cttcttcttcttcttgaact 180919
>emb|AL928657.21| Zebrafish DNA sequence from clone CH211-194I10 in linkage group 3, complete sequence Length = 187734 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 acttgaagtattggatcagc 49 |||||||||||||||||||| Sbjct: 22006 acttgaagtattggatcagc 21987
>gb|AC009377.7| Drosophila melanogaster 3L BAC RP98-26P20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194308 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 149 gaaaacaatcactttatcgtccag 172 ||||||||||||||||| |||||| Sbjct: 94424 gaaaacaatcactttattgtccag 94401
>gb|AC023718.4| Drosophila melanogaster X BAC RP98-7P15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164415 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 23535 cttcttcttcttcttgaact 23516
>gb|AC009367.9| Drosophila melanogaster 3L BAC RP98-48B15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178239 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 149 gaaaacaatcactttatcgtccag 172 ||||||||||||||||| |||||| Sbjct: 142819 gaaaacaatcactttattgtccag 142796
>ref|NM_206684.2| Drosophila melanogaster discs large 1 CG1725-RE, transcript variant E (dlg1), mRNA Length = 5952 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 97 cttcttcttcttcttgaact 78
>ref|NM_206682.2| Drosophila melanogaster discs large 1 CG1725-RG, transcript variant G (dlg1), mRNA Length = 6112 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 212 cttcttcttcttcttgaact 193
>ref|NM_167282.2| Drosophila melanogaster discs large 1 CG1725-RA, transcript variant A (dlg1), mRNA Length = 6109 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 230 cttcttcttcttcttgaact 211
>gb|AC007509.5| Arabidopsis thaliana chromosome 2 clone T19E12 map mi398, complete sequence Length = 16283 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 5788 cagctttcctctggttcttcttct 5811
>gb|AC004667.3| Arabidopsis thaliana chromosome 2 clone T4C15 map ve016, complete sequence Length = 91863 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 tggtacttcttcttcttctt 142 |||||||||||||||||||| Sbjct: 79792 tggtacttcttcttcttctt 79811
>ref|NM_078565.3| Drosophila melanogaster discs large 1 CG1725-RD, transcript variant D (dlg1), mRNA Length = 6067 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 212 cttcttcttcttcttgaact 193
>gb|AC131405.5| Rattus norvegicus BAC CH230-179I7 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 217197 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 204855 cccgcgccagcagcagccag 204874
>gb|AC009082.7| Homo sapiens chromosome 16 clone RP11-354N7, complete sequence Length = 160277 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 tcttcttcttcttgaacttg 149 |||||||||||||||||||| Sbjct: 23530 tcttcttcttcttgaacttg 23511
>gb|DQ090940.1| Homo sapiens cadherin 1, type 1, E-cadherin (epithelial) (CDH1) gene, complete cds Length = 100541 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 tcttcttcttcttgaacttg 149 |||||||||||||||||||| Sbjct: 15026 tcttcttcttcttgaacttg 15007
>gb|BT023418.1| Arabidopsis thaliana At2g17630 gene, complete cds Length = 1378 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1013 cagctttcctctggttcttcttct 990
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 374 gatgtcggcatccttccccg 393 |||||||||||||||||||| Sbjct: 21608473 gatgtcggcatccttccccg 21608492
>gb|AC099314.3| Homo sapiens chromosome 16 clone RP11-354M1, complete sequence Length = 184945 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 130 tcttcttcttcttgaacttg 149 |||||||||||||||||||| Sbjct: 94175 tcttcttcttcttgaacttg 94156
>emb|BX833603.1|CNS09ZBI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZE07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 864 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 519 cttcttcttcttcttgaact 500
>gb|AC093911.2| Homo sapiens BAC clone RP11-765B12 from 2, complete sequence Length = 186199 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 tgtctgtgaccagctttcct 121 |||||||||||||||||||| Sbjct: 168406 tgtctgtgaccagctttcct 168387
>gb|BT005429.1| Arabidopsis thaliana clone U51198 unknown protein (At5g62290) mRNA, complete cds Length = 721 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 472 cttcttcttcttcttgaact 453
>gb|AC084527.1|CBRG21F09 Caenorhabditis briggsae cosmid G21F09, complete sequence Length = 40701 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ttcttgaacttgaaaacaat 157 |||||||||||||||||||| Sbjct: 12551 ttcttgaacttgaaaacaat 12570
>ref|NM_130751.1| Rattus norvegicus fibroblast growth factor 22 (Fgf22), mRNA Length = 489 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 49 cccgcgccagcagcagccag 30
>gb|BT005106.1| Arabidopsis thaliana clone U50314 unknown protein (At3g15115) mRNA, complete cds Length = 1051 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 126 tacttcttcttcttcttgaacttg 149 ||||||||||||||||| |||||| Sbjct: 144 tacttcttcttcttcttcaacttg 167
>gb|AY088500.1| Arabidopsis thaliana clone 7236 mRNA, complete sequence Length = 900 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 553 cttcttcttcttcttgaact 534
>gb|AY087331.1| Arabidopsis thaliana clone 34272 mRNA, complete sequence Length = 1514 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1078 cagctttcctctggttcttcttct 1055
>dbj|AP001299.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F4B12 Length = 37262 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 126 tacttcttcttcttcttgaacttg 149 ||||||||||||||||| |||||| Sbjct: 3962 tacttcttcttcttcttcaacttg 3939
>dbj|AK119007.1| Arabidopsis thaliana At5g62290 mRNA for unknown protein, complete cds, clone: RAFL21-33-M15 Length = 931 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 554 cttcttcttcttcttgaact 535
>dbj|AK117539.1| Arabidopsis thaliana At3g15110 mRNA for unknown protein, complete cds, clone: RAFL17-19-G19 Length = 1384 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 126 tacttcttcttcttcttgaacttg 149 ||||||||||||||||| |||||| Sbjct: 281 tacttcttcttcttcttcaacttg 304
>dbj|AK108630.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-F01, full insert sequence Length = 1915 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 374 gatgtcggcatccttccccg 393 |||||||||||||||||||| Sbjct: 530 gatgtcggcatccttccccg 549
>gb|AY105126.1| Zea mays PCO124988 mRNA sequence Length = 991 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 379 cggcatccttccccgcgcca 398 |||||||||||||||||||| Sbjct: 108 cggcatccttccccgcgcca 89
>gb|AE003517.3| Drosophila melanogaster chromosome 3L, section 68 of 83 of the complete sequence Length = 257692 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 149 gaaaacaatcactttatcgtccag 172 ||||||||||||||||| |||||| Sbjct: 153553 gaaaacaatcactttattgtccag 153530
>gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 of 74 of the complete sequence Length = 328128 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 20763 cttcttcttcttcttgaact 20744
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 374 gatgtcggcatccttccccg 393 |||||||||||||||||||| Sbjct: 21536794 gatgtcggcatccttccccg 21536813
>emb|AL844497.4|CNS08CAU Oryza sativa chromosome 12, . BAC OSJNBa0085B23 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 158019 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 374 gatgtcggcatccttccccg 393 |||||||||||||||||||| Sbjct: 37416 gatgtcggcatccttccccg 37397
>gb|AC004449.1|AC004449 Homo sapiens chromosome 19, cosmid R33683, complete sequence Length = 38186 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 29038 cccgcgccagcagcagccag 29019
>dbj|AP004468.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09A24, TM0003, complete sequence Length = 88828 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 tggtacttcttcttcttctt 142 |||||||||||||||||||| Sbjct: 27552 tggtacttcttcttcttctt 27571
>gb|M73529.1|DRODLGA Drosophila melanogaster discs-large tumor suppressor mRNA, complete cds Length = 3263 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cttcttcttcttcttgaact 147 |||||||||||||||||||| Sbjct: 226 cttcttcttcttcttgaact 207
>dbj|AB078902.1| Rattus norvegicus FGF22 mRNA for fibroblast growth factor 22, complete cds Length = 489 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 49 cccgcgccagcagcagccag 30
>dbj|D88541.1| Arabidopsis thaliana mRNA for phosphoserine aminotransferase, complete cds Length = 1606 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 1167 cagctttcctctggttcttcttct 1144
>dbj|AB010408.1| Arabidopsis thaliana DNA for phosphoserine aminotransferase, complete cds Length = 6124 Score = 40.1 bits (20), Expect = 6.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 cagctttcctctggtacttcttct 135 ||||||||||||||| |||||||| Sbjct: 5570 cagctttcctctggttcttcttct 5547
>dbj|AB021925.1| Homo sapiens FGF22 mRNA for FGF-22, complete cds Length = 513 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 cccgcgccagcagcagccag 409 |||||||||||||||||||| Sbjct: 49 cccgcgccagcagcagccag 30
>emb|AL671896.4| Mouse DNA sequence from clone RP23-354F16 on chromosome X, complete sequence Length = 78197 Score = 40.1 bits (20), Expect = 6.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 103 gtctgtgaccagctttcctc 122 |||||||||||||||||||| Sbjct: 14187 gtctgtgaccagctttcctc 14206 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,252,503 Number of Sequences: 3902068 Number of extensions: 5252503 Number of successful extensions: 694927 Number of sequences better than 10.0: 114 Number of HSP's better than 10.0 without gapping: 114 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 693840 Number of HSP's gapped (non-prelim): 1077 length of query: 453 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 431 effective length of database: 17,147,199,772 effective search space: 7390443101732 effective search space used: 7390443101732 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)